Starting /dee2/code/volunteer_pipeline.sh SRR12917585 current disk space = 3089075339264 free memory = 1427760904 SRR12917585 SRAfilesize 94264cbb5268aa5cc46f59760ef27f62 SRR12917585.sra SRR12917585.sra file validated SRR12917585 is paired end SRR12917585 is conventional basespace SRR12917585 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917585_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6695 37.0 37.0 37.0 37.0 37.0 2 36.54 37.0 37.0 37.0 37.0 37.0 3 36.6345 37.0 37.0 37.0 37.0 37.0 4 36.673 37.0 37.0 37.0 37.0 37.0 5 36.6345 37.0 37.0 37.0 37.0 37.0 6 36.6875 37.0 37.0 37.0 37.0 37.0 7 36.5565 37.0 37.0 37.0 37.0 37.0 8 36.571 37.0 37.0 37.0 37.0 37.0 9 36.6445 37.0 37.0 37.0 37.0 37.0 10-14 36.67190000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.6311 37.0 37.0 37.0 37.0 37.0 20-24 36.6081 37.0 37.0 37.0 37.0 37.0 25-29 36.580799999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.5185 37.0 37.0 37.0 37.0 37.0 35-39 36.493900000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.5173 37.0 37.0 37.0 37.0 37.0 45-49 36.4662 37.0 37.0 37.0 37.0 37.0 50-54 36.4234 37.0 37.0 37.0 37.0 37.0 55-59 36.4067 37.0 37.0 37.0 37.0 37.0 60-64 36.3773 37.0 37.0 37.0 37.0 37.0 65-69 36.3456 37.0 37.0 37.0 37.0 37.0 70-74 36.3512 37.0 37.0 37.0 37.0 37.0 75-79 36.3786 37.0 37.0 37.0 37.0 37.0 80-84 36.3796 37.0 37.0 37.0 37.0 37.0 85-89 36.3277 37.0 37.0 37.0 37.0 37.0 90-94 36.331900000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.2581 37.0 37.0 37.0 37.0 37.0 100-104 36.2248 37.0 37.0 37.0 37.0 37.0 105-109 36.248599999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1377 37.0 37.0 37.0 37.0 37.0 115-119 36.1469 37.0 37.0 37.0 37.0 37.0 120-124 36.1268 37.0 37.0 37.0 37.0 37.0 125-129 35.9885 37.0 37.0 37.0 37.0 37.0 130-134 35.9683 37.0 37.0 37.0 37.0 37.0 135-139 35.904700000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.7902 37.0 37.0 37.0 37.0 37.0 145-149 35.676300000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.53 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 2.0 22 1.0 23 2.0 24 1.0 25 7.0 26 8.0 27 3.0 28 5.0 29 12.0 30 21.0 31 32.0 32 38.0 33 71.0 34 94.0 35 279.0 36 3037.0 37 386.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.475 12.925 6.6000000000000005 40.0 2 20.375 11.95 37.15 30.525000000000002 3 17.549999999999997 16.150000000000002 27.275 39.025 4 21.65 21.5 24.3 32.550000000000004 5 22.75 29.2 25.224999999999998 22.825 6 22.575 33.15 22.575 21.7 7 17.325 27.85 38.3 16.525000000000002 8 17.2 28.199999999999996 31.275 23.325000000000003 9 16.950000000000003 24.55 35.05 23.45 10-14 19.8 30.064999999999998 27.794999999999998 22.34 15-19 20.01 27.810000000000002 27.715 24.465 20-24 20.544999999999998 28.26 27.584999999999997 23.61 25-29 20.205000000000002 28.595 27.16 24.04 30-34 20.380000000000003 28.88 26.900000000000002 23.84 35-39 20.285 27.944999999999997 27.305 24.465 40-44 21.005 28.825 26.939999999999998 23.23 45-49 20.985 28.165000000000003 26.884999999999998 23.965 50-54 20.575 27.765 27.779999999999998 23.880000000000003 55-59 21.099999999999998 28.065 27.42 23.415 60-64 20.965 27.79 27.445000000000004 23.799999999999997 65-69 20.064999999999998 28.13 27.62 24.185000000000002 70-74 21.145 27.834999999999997 27.185 23.835 75-79 20.07 28.475 27.455000000000002 24.0 80-84 21.185000000000002 28.315 26.655 23.845 85-89 21.05 28.689999999999998 27.139999999999997 23.119999999999997 90-94 21.375 27.715 26.634999999999998 24.275 95-99 21.51 27.87 27.605 23.015 100-104 21.115000000000002 28.22 26.555 24.11 105-109 21.41 28.375 26.625 23.59 110-114 21.55 28.185 26.68 23.585 115-119 20.905 27.655 27.22 24.22 120-124 21.495 27.700000000000003 26.665 24.14 125-129 21.27 27.67 26.540000000000003 24.52 130-134 20.82 27.855 27.51 23.815 135-139 21.560000000000002 27.644999999999996 26.505000000000003 24.29 140-144 21.44 27.525 26.61 24.425 145-149 21.85 27.474999999999998 26.545 24.13 150-151 21.125 27.1625 25.7125 26.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 1.5 23 3.0 24 1.5 25 1.5 26 2.5 27 5.5 28 8.5 29 12.0 30 16.5 31 17.0 32 23.5 33 42.5 34 58.0 35 72.0 36 90.5 37 104.0 38 117.5 39 141.0 40 170.0 41 179.5 42 207.5 43 224.0 44 223.5 45 233.5 46 246.0 47 272.5 48 254.5 49 211.5 50 199.5 51 181.5 52 145.0 53 124.5 54 101.0 55 76.0 56 67.0 57 51.5 58 30.0 59 21.5 60 15.5 61 9.0 62 8.0 63 5.0 64 3.0 65 3.5 66 3.5 67 3.0 68 3.0 69 2.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.25 #Duplication Level Percentage of deduplicated Percentage of total 1 90.33240997229916 81.525 2 8.753462603878116 15.8 3 0.7479224376731302 2.025 4 0.110803324099723 0.4 5 0.0554016620498615 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTGTGGTGCTCACGGTA 5 0.125 No Hit GTCCTATGATACAAGTCAGCAAGACGTACAAAGACGGATGCAACCGAAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.775 0.0 0.0 0.0 0.0 88-89 0.9624999999999999 0.0 0.0 0.0 0.0 90-91 1.275 0.0 0.0 0.0 0.0 92-93 1.3250000000000002 0.0 0.0 0.0 0.0 94-95 1.4625 0.0 0.0 0.0 0.0 96-97 1.6625 0.0 0.0 0.0 0.0 98-99 1.9874999999999998 0.0 0.0 0.0 0.0 100-101 2.45 0.0 0.0 0.0 0.0 102-103 2.775 0.0 0.0 0.0 0.0 104-105 3.275 0.0 0.0 0.0 0.0 106-107 3.7750000000000004 0.0 0.0 0.0 0.0 108-109 4.2375 0.0 0.0 0.0 0.0 110-111 4.7125 0.0 0.0 0.0 0.0 112-113 5.225 0.0 0.0 0.0 0.0 114-115 6.0 0.0 0.0 0.0 0.0 116-117 6.6875 0.0 0.0 0.0 0.0 118-119 7.387499999999999 0.0 0.0 0.0 0.0 120-121 7.875 0.0 0.0 0.0 0.0 122-123 8.274999999999999 0.0 0.0 0.0 0.0 124-125 8.875 0.0 0.0 0.0 0.0 126-127 9.6375 0.0 0.0 0.0 0.0 128-129 10.2875 0.0 0.0 0.0 0.0 130-131 10.8625 0.0 0.0 0.0 0.0 132-133 11.55 0.0 0.0 0.0 0.0 134-135 12.125 0.0 0.0 0.0 0.0 136-137 12.7875 0.0 0.0 0.0 0.0 138-139 13.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCGAGT 35 0.0035366106 20.714287 140-144 GTCACTC 40 0.0076550315 18.125 135-139 >>END_MODULE SRR12917585 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917585_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4665 37.0 37.0 37.0 37.0 37.0 2 36.4275 37.0 37.0 37.0 37.0 37.0 3 36.328 37.0 37.0 37.0 37.0 37.0 4 36.464 37.0 37.0 37.0 37.0 37.0 5 36.486 37.0 37.0 37.0 37.0 37.0 6 36.5025 37.0 37.0 37.0 37.0 37.0 7 36.4135 37.0 37.0 37.0 37.0 37.0 8 36.5625 37.0 37.0 37.0 37.0 37.0 9 36.5025 37.0 37.0 37.0 37.0 37.0 10-14 36.5156 37.0 37.0 37.0 37.0 37.0 15-19 36.521300000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.492599999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.4225 37.0 37.0 37.0 37.0 37.0 30-34 36.3037 37.0 37.0 37.0 37.0 37.0 35-39 36.2746 37.0 37.0 37.0 37.0 37.0 40-44 36.290299999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.248599999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.21669999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.2174 37.0 37.0 37.0 37.0 37.0 60-64 36.2338 37.0 37.0 37.0 37.0 37.0 65-69 36.2231 37.0 37.0 37.0 37.0 37.0 70-74 36.2121 37.0 37.0 37.0 37.0 37.0 75-79 36.0977 37.0 37.0 37.0 37.0 37.0 80-84 36.1755 37.0 37.0 37.0 37.0 37.0 85-89 36.1379 37.0 37.0 37.0 37.0 37.0 90-94 36.1589 37.0 37.0 37.0 37.0 37.0 95-99 36.1371 37.0 37.0 37.0 37.0 37.0 100-104 36.0718 37.0 37.0 37.0 37.0 37.0 105-109 36.0362 37.0 37.0 37.0 37.0 37.0 110-114 35.9735 37.0 37.0 37.0 37.0 37.0 115-119 35.9138 37.0 37.0 37.0 37.0 37.0 120-124 35.8488 37.0 37.0 37.0 37.0 37.0 125-129 35.7228 37.0 37.0 37.0 37.0 37.0 130-134 35.642900000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.5516 37.0 37.0 37.0 37.0 37.0 140-144 35.4008 37.0 37.0 37.0 37.0 37.0 145-149 35.1535 37.0 37.0 37.0 29.8 37.0 150-151 34.585750000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 3.0 16 2.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 2.0 23 4.0 24 3.0 25 2.0 26 5.0 27 10.0 28 11.0 29 11.0 30 22.0 31 29.0 32 44.0 33 84.0 34 150.0 35 521.0 36 2865.0 37 230.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.775 25.674999999999997 10.075000000000001 28.475 2 29.075 26.950000000000003 29.675 14.299999999999999 3 19.325 28.749999999999996 32.45 19.475 4 24.0 34.075 23.75 18.175 5 25.75 35.625 22.125 16.5 6 21.375 38.775 22.400000000000002 17.45 7 20.724999999999998 22.95 36.225 20.1 8 22.375 25.324999999999996 29.2 23.1 9 23.025000000000002 24.3 30.15 22.525000000000002 10-14 23.105 28.93 26.57 21.395 15-19 23.61 28.27 26.705000000000002 21.415 20-24 22.93 28.415000000000003 27.08 21.575 25-29 23.06 27.965 27.355 21.62 30-34 23.1 27.500000000000004 27.485 21.915000000000003 35-39 23.595 28.09 27.145000000000003 21.17 40-44 22.925 28.999999999999996 26.77 21.305 45-49 23.505000000000003 27.43 27.905 21.16 50-54 23.255 27.73 27.125 21.89 55-59 23.505000000000003 27.32 27.339999999999996 21.834999999999997 60-64 23.205000000000002 27.250000000000004 27.950000000000003 21.595 65-69 23.830000000000002 26.939999999999998 27.894999999999996 21.335 70-74 23.724999999999998 27.775 27.29 21.21 75-79 23.775 27.77 26.85 21.605 80-84 23.990000000000002 27.965 26.974999999999998 21.07 85-89 23.895 27.465 27.235 21.404999999999998 90-94 24.505 27.805000000000003 26.745 20.945 95-99 24.08 28.060000000000002 26.97 20.89 100-104 24.45 27.38 27.27 20.9 105-109 24.240000000000002 27.555000000000003 27.705000000000002 20.5 110-114 24.715 27.839999999999996 26.674999999999997 20.77 115-119 25.115 27.560000000000002 26.375 20.95 120-124 25.53 27.47 26.534999999999997 20.465 125-129 26.295 27.345000000000002 26.575 19.785 130-134 26.11 26.939999999999998 26.355 20.595 135-139 26.779999999999998 27.145000000000003 26.27 19.805 140-144 27.275 26.790000000000003 26.275 19.66 145-149 28.999999999999996 26.16 26.14 18.7 150-151 28.65 27.175 25.4 18.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 2.0 26 2.5 27 5.5 28 8.5 29 6.0 30 8.0 31 16.0 32 24.0 33 30.0 34 40.5 35 56.0 36 74.5 37 108.5 38 137.5 39 160.0 40 183.0 41 206.5 42 244.0 43 254.0 44 251.5 45 248.5 46 251.5 47 249.5 48 223.5 49 217.5 50 189.5 51 151.5 52 136.5 53 113.5 54 92.0 55 75.0 56 60.0 57 49.5 58 33.5 59 18.5 60 15.0 61 14.5 62 9.5 63 4.5 64 3.5 65 4.0 66 3.0 67 0.5 68 0.5 69 0.5 70 1.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 1.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.05 #Duplication Level Percentage of deduplicated Percentage of total 1 90.67184897279289 81.65 2 8.078845086063298 14.549999999999999 3 0.9439200444197668 2.55 4 0.13881177123820101 0.5 5 0.1665741254858412 0.75 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTATTCTTCTCAAGCCTAGTATGGTCACTCCTGGTGCTGAATGCAAGG 5 0.125 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 5 0.125 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit CTTGTATGCGAGGCAAAGGGAGATTATGAATCAGCACTTGAGCACCTTGT 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.7124999999999999 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 90-91 1.25 0.0 0.0 0.0 0.0 92-93 1.3250000000000002 0.0 0.0 0.0 0.0 94-95 1.4625 0.0 0.0 0.0 0.0 96-97 1.6625 0.0 0.0 0.0 0.0 98-99 1.9625 0.0 0.0 0.0 0.0 100-101 2.425 0.0 0.0 0.0 0.0 102-103 2.7375 0.0 0.0 0.0 0.0 104-105 3.225 0.0 0.0 0.0 0.0 106-107 3.7249999999999996 0.0 0.0 0.0 0.0 108-109 4.1875 0.0 0.0 0.0 0.0 110-111 4.6625 0.0 0.0 0.0 0.0 112-113 5.175 0.0 0.0 0.0 0.0 114-115 5.95 0.0 0.0 0.0 0.0 116-117 6.6125 0.0 0.0 0.0 0.0 118-119 7.3125 0.0 0.0 0.0 0.0 120-121 7.8 0.0 0.0 0.0 0.0 122-123 8.175 0.0 0.0 0.0 0.0 124-125 8.775 0.0 0.0 0.0 0.0 126-127 9.5375 0.0 0.0 0.0 0.0 128-129 10.2125 0.0 0.0 0.0 0.0 130-131 10.8125 0.0 0.0 0.0 0.0 132-133 11.5 0.0 0.0 0.0 0.0 134-135 12.100000000000001 0.0 0.0 0.0 0.0 136-137 12.7625 0.0 0.0 0.0 0.0 138-139 13.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGGCT 10 0.006830828 145.0 7 GTGTTCC 35 0.0035366106 20.714287 135-139 CCGAGTT 40 0.0076550315 18.125 140-144 >>END_MODULE Read 636012 spots for SRR12917585.sra Written 636012 spots for SRR12917585.sra Read 636012 spots for SRR12917585.sra Written 636012 spots for SRR12917585.sra Read 636012 spots for SRR12917585.sra Written 636012 spots for SRR12917585.sra Read 636012 spots for SRR12917585.sra Written 636012 spots for SRR12917585.sra Read 636012 spots for SRR12917585.sra Written 636012 spots for SRR12917585.sra Read 636012 spots for SRR12917585.sra Written 636012 spots for SRR12917585.sra Read 636012 spots for SRR12917585.sra Written 636012 spots for SRR12917585.sra Read 636012 spots for SRR12917585.sra Written 636012 spots for SRR12917585.sra Read 636012 spots for SRR12917585.sra Written 636012 spots for SRR12917585.sra Read 636012 spots for SRR12917585.sra Written 636012 spots for SRR12917585.sra Read 636012 spots for SRR12917585.sra Written 636012 spots for SRR12917585.sra Read 636012 spots for SRR12917585.sra Written 636012 spots for SRR12917585.sra Read 636012 spots for SRR12917585.sra Written 636012 spots for SRR12917585.sra Read 636012 spots for SRR12917585.sra Written 636012 spots for SRR12917585.sra Read 636012 spots for SRR12917585.sra Written 636012 spots for SRR12917585.sra Read 636012 spots for SRR12917585.sra Written 636012 spots for SRR12917585.sra Read 636031 spots for SRR12917585.sra Written 636031 spots for SRR12917585.sra Read 636012 spots for SRR12917585.sra Written 636012 spots for SRR12917585.sra Read 636012 spots for SRR12917585.sra Written 636012 spots for SRR12917585.sra Read 636012 spots for SRR12917585.sra Written 636012 spots for SRR12917585.sra SRR ids: ['SRR12917585.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ndgk1h0v SRR12917585.sra spots: 12720259 blocks: [[1, 636012], [636013, 1272024], [1272025, 1908036], [1908037, 2544048], [2544049, 3180060], [3180061, 3816072], [3816073, 4452084], [4452085, 5088096], [5088097, 5724108], [5724109, 6360120], [6360121, 6996132], [6996133, 7632144], [7632145, 8268156], [8268157, 8904168], [8904169, 9540180], [9540181, 10176192], [10176193, 10812204], [10812205, 11448216], [11448217, 12084228], [12084229, 12720259]] SRR12917585 file size 4301200 SRR12917585 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917585 SRR12917585_1.fastq SRR12917585_2.fastq Input file: SRR12917585_1.fastq Paired file: SRR12917585_2.fastq trimmed: SRR12917585-trimmed-pair1.fastq, SRR12917585-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:18:19 2025 >> started Thu Feb 13 15:18:33 2025 >> done (14.063s) 12720259 read pairs processed; of these: 61 ( 0.00%) short read pairs filtered out after trimming by size control 4711 ( 0.04%) empty read pairs filtered out after trimming by size control 12715487 (99.96%) read pairs available; of these: 2421768 (19.05%) trimmed read pairs available after processing 10293719 (80.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 5 0.00% 21 9 0.00% 22 17 0.00% 23 7 0.00% 24 9 0.00% 25 14 0.00% 26 18 0.00% 27 10 0.00% 28 20 0.00% 29 25 0.00% 30 16 0.00% 31 14 0.00% 32 21 0.00% 33 19 0.00% 34 21 0.00% 35 29 0.00% 36 21 0.00% 37 25 0.00% 38 29 0.00% 39 29 0.00% 40 43 0.00% 41 29 0.00% 42 31 0.00% 43 42 0.00% 44 41 0.00% 45 45 0.00% 46 51 0.00% 47 64 0.00% 48 69 0.00% 49 91 0.00% 50 72 0.00% 51 120 0.00% 52 113 0.00% 53 164 0.00% 54 178 0.00% 55 162 0.00% 56 191 0.00% 57 212 0.00% 58 276 0.00% 59 313 0.00% 60 413 0.00% 61 462 0.00% 62 560 0.00% 63 684 0.01% 64 680 0.01% 65 767 0.01% 66 854 0.01% 67 1023 0.01% 68 1209 0.01% 69 1344 0.01% 70 1555 0.01% 71 1771 0.01% 72 2108 0.02% 73 2523 0.02% 74 2734 0.02% 75 3157 0.02% 76 3609 0.03% 77 3729 0.03% 78 4268 0.03% 79 4674 0.04% 80 5107 0.04% 81 5736 0.05% 82 6418 0.05% 83 7162 0.06% 84 8124 0.06% 85 8787 0.07% 86 9454 0.07% 87 10294 0.08% 88 10891 0.09% 89 11362 0.09% 90 12218 0.10% 91 12688 0.10% 92 13425 0.11% 93 14728 0.12% 94 16015 0.13% 95 17151 0.13% 96 18273 0.14% 97 19273 0.15% 98 19875 0.16% 99 20279 0.16% 100 21160 0.17% 101 21487 0.17% 102 22660 0.18% 103 23237 0.18% 104 24942 0.20% 105 25982 0.20% 106 27360 0.22% 107 28159 0.22% 108 29324 0.23% 109 29830 0.23% 110 30377 0.24% 111 30818 0.24% 112 31848 0.25% 113 32137 0.25% 114 33272 0.26% 115 35037 0.28% 116 35773 0.28% 117 37587 0.30% 118 38565 0.30% 119 38983 0.31% 120 40503 0.32% 121 40513 0.32% 122 41349 0.33% 123 41797 0.33% 124 42441 0.33% 125 42814 0.34% 126 44447 0.35% 127 45057 0.35% 128 46240 0.36% 129 46538 0.37% 130 47413 0.37% 131 47492 0.37% 132 47949 0.38% 133 48633 0.38% 134 48803 0.38% 135 49307 0.39% 136 50399 0.40% 137 50926 0.40% 138 51745 0.41% 139 53550 0.42% 140 53335 0.42% 141 54262 0.43% 142 54521 0.43% 143 54317 0.43% 144 54131 0.43% 145 54835 0.43% 146 54601 0.43% 147 55314 0.44% 148 56857 0.45% 149 56893 0.45% 150 58189 0.46% 151 10293719 80.95% 12715487 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=12 prefix-density=0.73 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=24 fanout-score=16.29 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=5.1 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=1.27 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=17 prefix-density=1.27 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.18 sequence-density-rank=22 fanout-score=14.66 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=5.1 sequence=AATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATT SRR12917585 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:19:12 Started mapping on | Feb 13 15:19:13 Finished on | Feb 13 15:20:47 Mapping speed, Million of reads per hour | 486.98 Number of input reads | 12715487 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 11974102 Uniquely mapped reads % | 94.17% Average mapped length | 290.61 Number of splices: Total | 11614431 Number of splices: Annotated (sjdb) | 11393125 Number of splices: GT/AG | 11337338 Number of splices: GC/AG | 226873 Number of splices: AT/AC | 6411 Number of splices: Non-canonical | 43809 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 341593 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 53841 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.59% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 399792 399792 399792 N_multimapping 341593 341593 341593 N_noFeature 308522 11736979 378234 N_ambiguous 250201 631 82513 UnstrandedReadsAssigned:11415379 PositiveStrandReadsAssigned:236492 NegativeStrandReadsAssigned:11513355 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917585 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917585-trimmed-pair1.fastq SRR12917585-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,715,487 reads, 11,499,959 reads pseudoaligned [quant] estimated average fragment length: 227.155 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR12917585.ke.tsv 34699 SRR12917585.se.tsv 87100 total ==> SRR12917585.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.85 395 15.0778 Potri.005G024800.1.v4.1 1035 808.845 246 20.8023 Potri.004G059700.1.v4.1 961 734.914 21 1.95445 Potri.007G009000.2.v4.1 1416 1189.85 0 0 Potri.003G141000.2.v4.1 2943 2716.85 394 9.91912 Potri.016G087400.1.v4.1 270 97.5681 591 414.306 Potri.015G069301.1.v4.1 564 347.094 0 0 Potri.010G195200.1.v4.1 1773 1546.85 60 2.65306 Potri.012G127500.1.v4.1 977 750.877 328 29.8777 ==> SRR12917585.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 234 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 178 Potri.001G212900.v4.1 19 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12917585 completed mapping pipeline successfully