Starting /dee2/code/volunteer_pipeline.sh SRR12917586 current disk space = 3089105178624 free memory = 1469871076 SRR12917586 SRAfilesize 9a7d67b19495e3c68da6dcfb70f5a766 SRR12917586.sra SRR12917586.sra file validated SRR12917586 is paired end SRR12917586 is conventional basespace SRR12917586 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917586_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.64425 37.0 37.0 37.0 37.0 37.0 2 36.495 37.0 37.0 37.0 37.0 37.0 3 36.611 37.0 37.0 37.0 37.0 37.0 4 36.7145 37.0 37.0 37.0 37.0 37.0 5 36.65 37.0 37.0 37.0 37.0 37.0 6 36.621 37.0 37.0 37.0 37.0 37.0 7 36.619 37.0 37.0 37.0 37.0 37.0 8 36.562 37.0 37.0 37.0 37.0 37.0 9 36.7045 37.0 37.0 37.0 37.0 37.0 10-14 36.672999999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.671099999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.6203 37.0 37.0 37.0 37.0 37.0 25-29 36.6154 37.0 37.0 37.0 37.0 37.0 30-34 36.54690000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.544200000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.5346 37.0 37.0 37.0 37.0 37.0 45-49 36.512499999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.486000000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.473600000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.425799999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.326499999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3481 37.0 37.0 37.0 37.0 37.0 75-79 36.3555 37.0 37.0 37.0 37.0 37.0 80-84 36.3412 37.0 37.0 37.0 37.0 37.0 85-89 36.3464 37.0 37.0 37.0 37.0 37.0 90-94 36.3563 37.0 37.0 37.0 37.0 37.0 95-99 36.2401 37.0 37.0 37.0 37.0 37.0 100-104 36.2449 37.0 37.0 37.0 37.0 37.0 105-109 36.1591 37.0 37.0 37.0 37.0 37.0 110-114 36.193200000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.116200000000006 37.0 37.0 37.0 37.0 37.0 120-124 36.0945 37.0 37.0 37.0 37.0 37.0 125-129 35.995799999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.969 37.0 37.0 37.0 37.0 37.0 135-139 35.8949 37.0 37.0 37.0 37.0 37.0 140-144 35.7541 37.0 37.0 37.0 37.0 37.0 145-149 35.6871 37.0 37.0 37.0 37.0 37.0 150-151 35.45025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 1.0 20 0.0 21 1.0 22 0.0 23 1.0 24 1.0 25 1.0 26 3.0 27 7.0 28 3.0 29 11.0 30 20.0 31 26.0 32 37.0 33 74.0 34 124.0 35 287.0 36 3074.0 37 328.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.7100325243933 11.48361270953215 5.354015511633725 36.45233925444083 2 19.175 10.975 39.15 30.7 3 17.424999999999997 15.4 28.1 39.074999999999996 4 22.225 22.75 25.6 29.425 5 23.150000000000002 30.599999999999998 23.9 22.35 6 19.8 32.675 24.75 22.775000000000002 7 15.6 27.750000000000004 40.550000000000004 16.1 8 14.75 25.5 34.525 25.224999999999998 9 16.975 22.8 36.575 23.65 10-14 19.27 30.415 28.275 22.040000000000003 15-19 20.18 28.134999999999998 28.02 23.665 20-24 19.885 28.075 28.235 23.805 25-29 20.075000000000003 28.194999999999997 28.33 23.400000000000002 30-34 19.805 28.050000000000004 27.445000000000004 24.7 35-39 19.45 27.834999999999997 28.27 24.445 40-44 20.26 28.084999999999997 27.450000000000003 24.205 45-49 19.165 29.12 27.91 23.805 50-54 20.085 28.77 27.47 23.674999999999997 55-59 20.165 28.155 27.455000000000002 24.224999999999998 60-64 19.384999999999998 28.175 28.065 24.375 65-69 19.955000000000002 29.175 27.04 23.830000000000002 70-74 20.625 28.139999999999997 27.400000000000002 23.835 75-79 20.09 27.845 27.85 24.215 80-84 20.435 28.384999999999998 27.384999999999998 23.794999999999998 85-89 20.66 28.84 27.18 23.32 90-94 20.53 28.26 26.715 24.495 95-99 20.47 28.105000000000004 27.395000000000003 24.03 100-104 19.985 28.555000000000003 27.224999999999998 24.235 105-109 20.625 28.294999999999998 27.3 23.78 110-114 21.07 28.15 26.735 24.044999999999998 115-119 20.419999999999998 29.160000000000004 27.389999999999997 23.03 120-124 20.495 28.37 27.32 23.815 125-129 21.025 27.900000000000002 27.35 23.724999999999998 130-134 20.77 28.48 27.445000000000004 23.305 135-139 21.740000000000002 27.48 27.04 23.74 140-144 21.145 27.839999999999996 26.834999999999997 24.18 145-149 21.015 27.605 27.169999999999998 24.21 150-151 20.225 28.050000000000004 26.650000000000002 25.074999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 1.5 20 1.5 21 0.5 22 0.0 23 2.0 24 3.5 25 3.5 26 3.5 27 7.0 28 13.5 29 13.5 30 13.5 31 26.5 32 38.0 33 37.0 34 42.0 35 68.0 36 92.0 37 101.0 38 125.5 39 157.0 40 169.0 41 191.5 42 233.0 43 248.0 44 241.5 45 252.0 46 253.0 47 261.5 48 267.0 49 238.5 50 194.5 51 158.0 52 132.5 53 99.0 54 74.5 55 61.0 56 53.0 57 36.0 58 21.5 59 22.0 60 16.5 61 8.0 62 5.0 63 3.5 64 2.0 65 0.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.79856313898867 82.15 2 8.123791102514506 14.7 3 0.8842221608179055 2.4 4 0.13815971262779772 0.5 5 0.055263885051119094 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACC 5 0.125 No Hit CTCTCTGGTATGTGCTGAAACCAGGGTCTTTCCAAGATTTTCCAAATTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.425 0.0 0.0 0.0 0.0 106-107 1.6375 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 1.9874999999999998 0.0 0.0 0.0 0.0 112-113 2.2125 0.0 0.0 0.0 0.0 114-115 2.5375 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 2.9749999999999996 0.0 0.0 0.0 0.0 120-121 3.35 0.0 0.0 0.0 0.0 122-123 3.7 0.0 0.0 0.0 0.0 124-125 4.1 0.0 0.0 0.0 0.0 126-127 4.5625 0.0 0.0 0.0 0.0 128-129 4.875 0.0 0.0 0.0 0.0 130-131 5.2375 0.0 0.0 0.0 0.0 132-133 5.612500000000001 0.0 0.0 0.0 0.0 134-135 6.075 0.0 0.0 0.0 0.0 136-137 6.5875 0.0 0.0 0.0 0.0 138-139 7.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917586 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917586_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4655 37.0 37.0 37.0 37.0 37.0 2 36.2085 37.0 37.0 37.0 37.0 37.0 3 36.1815 37.0 37.0 37.0 37.0 37.0 4 36.3 37.0 37.0 37.0 37.0 37.0 5 36.3205 37.0 37.0 37.0 37.0 37.0 6 36.213 37.0 37.0 37.0 37.0 37.0 7 36.223 37.0 37.0 37.0 37.0 37.0 8 36.3355 37.0 37.0 37.0 37.0 37.0 9 36.39 37.0 37.0 37.0 37.0 37.0 10-14 36.283 37.0 37.0 37.0 37.0 37.0 15-19 36.32490000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.290200000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.1379 37.0 37.0 37.0 37.0 37.0 30-34 36.1599 37.0 37.0 37.0 37.0 37.0 35-39 36.0906 37.0 37.0 37.0 37.0 37.0 40-44 36.0478 37.0 37.0 37.0 37.0 37.0 45-49 35.9803 37.0 37.0 37.0 37.0 37.0 50-54 35.997299999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.972899999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.9805 37.0 37.0 37.0 37.0 37.0 65-69 35.9209 37.0 37.0 37.0 37.0 37.0 70-74 35.9183 37.0 37.0 37.0 37.0 37.0 75-79 35.817099999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.876599999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.930899999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.8817 37.0 37.0 37.0 37.0 37.0 95-99 35.81269999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.764300000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.7358 37.0 37.0 37.0 37.0 37.0 110-114 35.736599999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.6211 37.0 37.0 37.0 37.0 37.0 120-124 35.4974 37.0 37.0 37.0 37.0 37.0 125-129 35.4209 37.0 37.0 37.0 37.0 37.0 130-134 35.339 37.0 37.0 37.0 34.6 37.0 135-139 35.2594 37.0 37.0 37.0 34.6 37.0 140-144 35.109500000000004 37.0 37.0 37.0 25.0 37.0 145-149 34.9023 37.0 37.0 37.0 25.0 37.0 150-151 34.4275 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 4.0 15 1.0 16 2.0 17 1.0 18 2.0 19 4.0 20 2.0 21 4.0 22 2.0 23 5.0 24 5.0 25 9.0 26 5.0 27 12.0 28 11.0 29 18.0 30 27.0 31 31.0 32 64.0 33 118.0 34 204.0 35 607.0 36 2699.0 37 160.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.746373186593296 25.71285642821411 8.329164582291146 23.21160580290145 2 28.449999999999996 24.75 31.025000000000002 15.775 3 20.025000000000002 26.650000000000002 33.85 19.475 4 24.9 35.199999999999996 21.975 17.925 5 25.650000000000002 37.025000000000006 21.375 15.950000000000001 6 22.125 38.9 20.525 18.45 7 21.05 22.475 37.15 19.325 8 20.1 25.05 29.025000000000002 25.825 9 21.325 25.35 29.725 23.599999999999998 10-14 23.52 29.494999999999997 26.46 20.525 15-19 23.47 28.060000000000002 27.455000000000002 21.015 20-24 23.155 28.325 27.255000000000003 21.265 25-29 22.994999999999997 27.650000000000002 28.1 21.255 30-34 23.74 27.71 27.52 21.029999999999998 35-39 22.625 28.04 28.16 21.175 40-44 23.445 28.050000000000004 27.894999999999996 20.61 45-49 23.015 27.474999999999998 28.655 20.855 50-54 23.669999999999998 27.565 27.48 21.285 55-59 23.669999999999998 27.625 27.49 21.215 60-64 23.76 27.384999999999998 28.055000000000003 20.8 65-69 23.73 27.045 27.785 21.44 70-74 23.39 27.389999999999997 28.139999999999997 21.08 75-79 23.54 26.955000000000002 28.305000000000003 21.2 80-84 23.325000000000003 28.125 27.095000000000002 21.455 85-89 23.595 27.93 27.815 20.66 90-94 23.200000000000003 27.229999999999997 27.76 21.81 95-99 24.005000000000003 27.725 27.375 20.895 100-104 23.405 28.194999999999997 27.155 21.245 105-109 24.235 28.105000000000004 27.265 20.395 110-114 23.91 27.815 27.74 20.535 115-119 24.94 27.900000000000002 27.155 20.005 120-124 24.315 27.965 27.485 20.235 125-129 24.805 27.485 27.405 20.305 130-134 24.6 27.644999999999996 28.044999999999998 19.71 135-139 25.45 27.61 27.195000000000004 19.744999999999997 140-144 25.785000000000004 27.224999999999998 27.425 19.564999999999998 145-149 26.085 27.474999999999998 26.724999999999998 19.715 150-151 26.8375 26.8125 26.950000000000003 19.400000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 2.5 24 2.0 25 1.5 26 5.5 27 10.0 28 13.0 29 13.0 30 13.0 31 17.5 32 24.5 33 33.5 34 41.5 35 60.5 36 86.0 37 107.5 38 134.0 39 149.0 40 174.5 41 214.0 42 248.5 43 267.0 44 271.5 45 269.5 46 259.0 47 258.0 48 240.0 49 202.5 50 171.0 51 141.5 52 114.0 53 96.5 54 85.5 55 74.5 56 50.5 57 29.0 58 21.0 59 17.0 60 16.0 61 13.0 62 6.5 63 4.0 64 4.0 65 1.0 66 0.5 67 1.5 68 1.5 69 1.5 70 1.0 71 1.0 72 2.0 73 1.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.5 84 1.0 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.5 93 1.0 94 1.0 95 1.0 96 0.5 97 1.0 98 1.0 99 1.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.175 #Duplication Level Percentage of deduplicated Percentage of total 1 91.80148066904304 83.7 2 7.238826432684398 13.200000000000001 3 0.7677543186180422 2.1 4 0.10967918837400603 0.4 5 0.027419797093501508 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.027419797093501508 0.22499999999999998 >10 0.027419797093501508 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 9 0.22499999999999998 No Hit CTCAAGAGAACCAATTAGCATTACAACAGAGATCTGTCCTTCTAGATTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.6499999999999999 0.0 0.0 0.0 0.0 92-93 0.725 0.0 0.0 0.0 0.0 94-95 0.7875000000000001 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.1749999999999998 0.0 0.0 0.0 0.0 102-103 1.3624999999999998 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.5375 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.325 0.0 0.0 0.0 0.0 122-123 3.6624999999999996 0.0 0.0 0.0 0.0 124-125 4.05 0.0 0.0 0.0 0.0 126-127 4.4625 0.0 0.0 0.0 0.0 128-129 4.775 0.0 0.0 0.0 0.0 130-131 5.1375 0.0 0.0 0.0 0.0 132-133 5.512499999999999 0.0 0.0 0.0 0.0 134-135 5.987500000000001 0.0 0.0 0.0 0.0 136-137 6.4875 0.0 0.0 0.0 0.0 138-139 7.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGTGAG 10 0.006830828 145.0 145 GCAGCTT 10 0.006830828 145.0 1 CAGCTTT 10 0.006830828 145.0 2 >>END_MODULE Read 1122769 spots for SRR12917586.sra Written 1122769 spots for SRR12917586.sra Read 1122769 spots for SRR12917586.sra Written 1122769 spots for SRR12917586.sra Read 1122769 spots for SRR12917586.sra Written 1122769 spots for SRR12917586.sra Read 1122769 spots for SRR12917586.sra Written 1122769 spots for SRR12917586.sra Read 1122769 spots for SRR12917586.sra Written 1122769 spots for SRR12917586.sra Read 1122769 spots for SRR12917586.sra Written 1122769 spots for SRR12917586.sra Read 1122769 spots for SRR12917586.sra Written 1122769 spots for SRR12917586.sra Read 1122769 spots for SRR12917586.sra Written 1122769 spots for SRR12917586.sra Read 1122769 spots for SRR12917586.sra Written 1122769 spots for SRR12917586.sra Read 1122769 spots for SRR12917586.sra Written 1122769 spots for SRR12917586.sra Read 1122769 spots for SRR12917586.sra Written 1122769 spots for SRR12917586.sra Read 1122769 spots for SRR12917586.sra Written 1122769 spots for SRR12917586.sra Read 1122769 spots for SRR12917586.sra Written 1122769 spots for SRR12917586.sra Read 1122769 spots for SRR12917586.sra Written 1122769 spots for SRR12917586.sra Read 1122769 spots for SRR12917586.sra Written 1122769 spots for SRR12917586.sra Read 1122769 spots for SRR12917586.sra Written 1122769 spots for SRR12917586.sra Read 1122769 spots for SRR12917586.sra Written 1122769 spots for SRR12917586.sra Read 1122770 spots for SRR12917586.sra Written 1122770 spots for SRR12917586.sra Read 1122769 spots for SRR12917586.sra Written 1122769 spots for SRR12917586.sra Read 1122769 spots for SRR12917586.sra Written 1122769 spots for SRR12917586.sra SRR ids: ['SRR12917586.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wovrxksk SRR12917586.sra spots: 22455381 blocks: [[1, 1122769], [1122770, 2245538], [2245539, 3368307], [3368308, 4491076], [4491077, 5613845], [5613846, 6736614], [6736615, 7859383], [7859384, 8982152], [8982153, 10104921], [10104922, 11227690], [11227691, 12350459], [12350460, 13473228], [13473229, 14595997], [14595998, 15718766], [15718767, 16841535], [16841536, 17964304], [17964305, 19087073], [19087074, 20209842], [20209843, 21332611], [21332612, 22455381]] SRR12917586 file size 7609620 SRR12917586 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917586 SRR12917586_1.fastq SRR12917586_2.fastq Input file: SRR12917586_1.fastq Paired file: SRR12917586_2.fastq trimmed: SRR12917586-trimmed-pair1.fastq, SRR12917586-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:16:48 2025 >> started Thu Feb 13 15:17:13 2025 >> done (25.204s) 22455381 read pairs processed; of these: 179 ( 0.00%) short read pairs filtered out after trimming by size control 6043 ( 0.03%) empty read pairs filtered out after trimming by size control 22449159 (99.97%) read pairs available; of these: 2501296 (11.14%) trimmed read pairs available after processing 19947863 (88.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 7 0.00% 20 24 0.00% 21 26 0.00% 22 15 0.00% 23 28 0.00% 24 20 0.00% 25 17 0.00% 26 24 0.00% 27 29 0.00% 28 40 0.00% 29 32 0.00% 30 31 0.00% 31 37 0.00% 32 34 0.00% 33 27 0.00% 34 50 0.00% 35 52 0.00% 36 40 0.00% 37 39 0.00% 38 50 0.00% 39 36 0.00% 40 54 0.00% 41 52 0.00% 42 59 0.00% 43 72 0.00% 44 75 0.00% 45 73 0.00% 46 85 0.00% 47 88 0.00% 48 111 0.00% 49 116 0.00% 50 143 0.00% 51 181 0.00% 52 198 0.00% 53 251 0.00% 54 244 0.00% 55 250 0.00% 56 280 0.00% 57 338 0.00% 58 359 0.00% 59 444 0.00% 60 559 0.00% 61 635 0.00% 62 755 0.00% 63 818 0.00% 64 1012 0.00% 65 1020 0.00% 66 1241 0.01% 67 1339 0.01% 68 1491 0.01% 69 1575 0.01% 70 1944 0.01% 71 2314 0.01% 72 2628 0.01% 73 2950 0.01% 74 3348 0.01% 75 3597 0.02% 76 4006 0.02% 77 4408 0.02% 78 4480 0.02% 79 5008 0.02% 80 5604 0.02% 81 6129 0.03% 82 7003 0.03% 83 7588 0.03% 84 8365 0.04% 85 9008 0.04% 86 9625 0.04% 87 9933 0.04% 88 10505 0.05% 89 10980 0.05% 90 11754 0.05% 91 12143 0.05% 92 13111 0.06% 93 14256 0.06% 94 14923 0.07% 95 16295 0.07% 96 16522 0.07% 97 17420 0.08% 98 17970 0.08% 99 18811 0.08% 100 19228 0.09% 101 19620 0.09% 102 20903 0.09% 103 21733 0.10% 104 22604 0.10% 105 23813 0.11% 106 24538 0.11% 107 25425 0.11% 108 26372 0.12% 109 27202 0.12% 110 27631 0.12% 111 28388 0.13% 112 29288 0.13% 113 29876 0.13% 114 31370 0.14% 115 32756 0.15% 116 33891 0.15% 117 35434 0.16% 118 36227 0.16% 119 36975 0.16% 120 37961 0.17% 121 38623 0.17% 122 39573 0.18% 123 40383 0.18% 124 41408 0.18% 125 42655 0.19% 126 44793 0.20% 127 45322 0.20% 128 46812 0.21% 129 47957 0.21% 130 49002 0.22% 131 49262 0.22% 132 50163 0.22% 133 51140 0.23% 134 51687 0.23% 135 53293 0.24% 136 54547 0.24% 137 55250 0.25% 138 56858 0.25% 139 59157 0.26% 140 59891 0.27% 141 59938 0.27% 142 60757 0.27% 143 61542 0.27% 144 63313 0.28% 145 63861 0.28% 146 64398 0.29% 147 65366 0.29% 148 67483 0.30% 149 67735 0.30% 150 70679 0.31% 151 19947863 88.86% 22449159 reads passed initial QC criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=18 prefix-density=0.88 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=321.51 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=22 prefix-density=0.98 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=92.26 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.1 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT SRR12917586 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:17:57 Started mapping on | Feb 13 15:17:57 Finished on | Feb 13 15:20:01 Mapping speed, Million of reads per hour | 651.75 Number of input reads | 22449159 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 21255853 Uniquely mapped reads % | 94.68% Average mapped length | 294.89 Number of splices: Total | 21301272 Number of splices: Annotated (sjdb) | 20910105 Number of splices: GT/AG | 20876106 Number of splices: GC/AG | 346012 Number of splices: AT/AC | 11522 Number of splices: Non-canonical | 67632 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 450250 % of reads mapped to multiple loci | 2.01% Number of reads mapped to too many loci | 67604 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.87% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 743056 743056 743056 N_multimapping 450250 450250 450250 N_noFeature 692976 20946149 790663 N_ambiguous 359735 1384 146937 UnstrandedReadsAssigned:20203142 PositiveStrandReadsAssigned:308320 NegativeStrandReadsAssigned:20318253 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917586 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917586-trimmed-pair1.fastq SRR12917586-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,449,159 reads, 20,354,873 reads pseudoaligned [quant] estimated average fragment length: 256.587 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR12917586.ke.tsv 34699 SRR12917586.se.tsv 87100 total ==> SRR12917586.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.41 469 12.0244 Potri.005G024800.1.v4.1 1035 779.413 656 38.0308 Potri.004G059700.1.v4.1 961 705.588 70 4.48276 Potri.007G009000.2.v4.1 1416 1160.41 0 0 Potri.003G141000.2.v4.1 2943 2687.41 718.808 12.0859 Potri.016G087400.1.v4.1 270 86.303 781 408.907 Potri.015G069301.1.v4.1 564 322.607 0 0 Potri.010G195200.1.v4.1 1773 1517.41 7 0.208446 Potri.012G127500.1.v4.1 977 721.526 309 19.3511 ==> SRR12917586.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 219 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 240 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 17 SRR12917586 completed mapping pipeline successfully