Starting /dee2/code/volunteer_pipeline.sh SRR12917587 current disk space = 3089173114880 free memory = 1392492388 SRR12917587 SRAfilesize d3f5e16abdef8026886c908b4af1bc3a SRR12917587.sra SRR12917587.sra file validated SRR12917587 is paired end SRR12917587 is conventional basespace SRR12917587 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917587_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.53525 37.0 37.0 37.0 37.0 37.0 2 36.491 37.0 37.0 37.0 37.0 37.0 3 36.598 37.0 37.0 37.0 37.0 37.0 4 36.67 37.0 37.0 37.0 37.0 37.0 5 36.6665 37.0 37.0 37.0 37.0 37.0 6 36.5815 37.0 37.0 37.0 37.0 37.0 7 36.525 37.0 37.0 37.0 37.0 37.0 8 36.586 37.0 37.0 37.0 37.0 37.0 9 36.6735 37.0 37.0 37.0 37.0 37.0 10-14 36.62179999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.611599999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5826 37.0 37.0 37.0 37.0 37.0 25-29 36.570299999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4887 37.0 37.0 37.0 37.0 37.0 35-39 36.470499999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.4771 37.0 37.0 37.0 37.0 37.0 45-49 36.474900000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.4606 37.0 37.0 37.0 37.0 37.0 55-59 36.403999999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.36469999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.2776 37.0 37.0 37.0 37.0 37.0 70-74 36.3197 37.0 37.0 37.0 37.0 37.0 75-79 36.335699999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.335699999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.3015 37.0 37.0 37.0 37.0 37.0 90-94 36.285000000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.276599999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.203700000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1633 37.0 37.0 37.0 37.0 37.0 110-114 36.122699999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.0436 37.0 37.0 37.0 37.0 37.0 120-124 36.0334 37.0 37.0 37.0 37.0 37.0 125-129 35.9022 37.0 37.0 37.0 37.0 37.0 130-134 35.7785 37.0 37.0 37.0 37.0 37.0 135-139 35.588499999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.3943 37.0 37.0 37.0 34.6 37.0 145-149 35.2274 37.0 37.0 37.0 29.8 37.0 150-151 34.98075 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 4.0 25 4.0 26 3.0 27 5.0 28 12.0 29 11.0 30 16.0 31 23.0 32 44.0 33 108.0 34 156.0 35 360.0 36 2930.0 37 323.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.957739434858716 10.277569392348088 8.627156789197299 50.13753438359589 2 19.075 12.174999999999999 38.5 30.25 3 17.775 16.150000000000002 26.025 40.050000000000004 4 21.0 24.25 22.35 32.4 5 22.95 31.05 24.075 21.925 6 20.225 33.925 24.925 20.925 7 14.725 27.55 40.65 17.075000000000003 8 17.875 26.85 32.5 22.775000000000002 9 17.95 23.799999999999997 35.6 22.650000000000002 10-14 19.655 30.075000000000003 26.87 23.400000000000002 15-19 19.41 28.305000000000003 28.04 24.245 20-24 19.53 28.449999999999996 27.08 24.94 25-29 19.49 28.345 28.315 23.849999999999998 30-34 19.189999999999998 28.43 27.97 24.41 35-39 20.04 28.615000000000002 27.189999999999998 24.154999999999998 40-44 19.950000000000003 28.59 27.98 23.48 45-49 20.585 28.165000000000003 27.37 23.880000000000003 50-54 19.67 28.055000000000003 28.16 24.115000000000002 55-59 20.495 27.605 27.99 23.91 60-64 19.965 28.215 27.485 24.335 65-69 19.91 28.22 27.365000000000002 24.505 70-74 20.22 28.48 27.575 23.724999999999998 75-79 20.945 27.79 27.315 23.95 80-84 20.24 28.915000000000003 27.485 23.36 85-89 20.71 27.96 27.325 24.005000000000003 90-94 21.37 28.055000000000003 26.784999999999997 23.79 95-99 21.22 28.615000000000002 26.6 23.565 100-104 21.17 28.189999999999998 27.255000000000003 23.385 105-109 21.265 28.24 26.545 23.95 110-114 21.16 28.315 26.875 23.65 115-119 21.224999999999998 27.994999999999997 26.965 23.815 120-124 21.255 27.96 26.43 24.355 125-129 21.195 28.315 25.995 24.495 130-134 21.475 28.575 25.885 24.065 135-139 21.69 27.589999999999996 26.229999999999997 24.490000000000002 140-144 21.935 27.515 26.479999999999997 24.07 145-149 22.205 27.495000000000005 26.290000000000003 24.01 150-151 22.575 27.825 25.637500000000003 23.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.5 25 1.5 26 2.0 27 5.5 28 8.0 29 10.5 30 21.5 31 31.5 32 35.0 33 49.5 34 63.5 35 72.0 36 78.0 37 90.0 38 112.0 39 134.0 40 174.5 41 207.0 42 218.5 43 249.5 44 273.5 45 259.0 46 263.0 47 263.0 48 230.5 49 215.0 50 192.0 51 159.5 52 130.0 53 101.5 54 78.5 55 61.5 56 45.5 57 31.5 58 25.5 59 21.5 60 19.5 61 14.5 62 12.0 63 9.5 64 7.5 65 6.5 66 2.5 67 1.5 68 2.5 69 2.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.55238617663193 83.45 2 7.3230938014262215 13.350000000000001 3 0.9873834339001646 2.7 4 0.13713658804168952 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.2375 0.0 0.0 0.0 0.0 68-69 0.3 0.0 0.0 0.0 0.0 70-71 0.4375 0.0 0.0 0.0 0.0 72-73 0.55 0.0 0.0 0.0 0.0 74-75 0.7 0.0 0.0 0.0 0.0 76-77 0.875 0.0 0.0 0.0 0.0 78-79 1.0 0.0 0.0 0.0 0.0 80-81 1.15 0.0 0.0 0.0 0.0 82-83 1.3875000000000002 0.0 0.0 0.0 0.0 84-85 1.6625 0.0 0.0 0.0 0.0 86-87 2.0 0.0 0.0 0.0 0.0 88-89 2.4625 0.0 0.0 0.0 0.0 90-91 2.925 0.0 0.0 0.0 0.0 92-93 3.3875 0.0 0.0 0.0 0.0 94-95 3.85 0.0 0.0 0.0 0.0 96-97 4.275 0.0 0.0 0.0 0.0 98-99 4.85 0.0 0.0 0.0 0.0 100-101 5.4125 0.0 0.0 0.0 0.0 102-103 5.9875 0.0 0.0 0.0 0.0 104-105 6.625 0.0 0.0 0.0 0.0 106-107 7.225 0.0 0.0 0.0 0.0 108-109 7.8375 0.0 0.0 0.0 0.0 110-111 8.375 0.0 0.0 0.0 0.0 112-113 9.1625 0.0 0.0 0.0 0.0 114-115 9.8375 0.0 0.0 0.0 0.0 116-117 10.5375 0.0 0.0 0.0 0.0 118-119 11.15 0.0 0.0 0.0 0.0 120-121 12.025 0.0 0.0 0.0 0.0 122-123 12.8375 0.0 0.0 0.0 0.0 124-125 13.575 0.0 0.0 0.0 0.0 126-127 14.412500000000001 0.0 0.0 0.0 0.0 128-129 15.0 0.0 0.0 0.0 0.0 130-131 15.75 0.0 0.0 0.0 0.0 132-133 16.4125 0.0 0.0 0.0 0.0 134-135 17.3125 0.0 0.0 0.0 0.0 136-137 18.2375 0.0 0.0 0.0 0.0 138-139 18.950000000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATTA 10 0.006830828 145.0 8 >>END_MODULE SRR12917587 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917587_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1455 37.0 37.0 37.0 37.0 37.0 2 36.086 37.0 37.0 37.0 37.0 37.0 3 36.153 37.0 37.0 37.0 37.0 37.0 4 36.171 37.0 37.0 37.0 37.0 37.0 5 36.25 37.0 37.0 37.0 37.0 37.0 6 36.1925 37.0 37.0 37.0 37.0 37.0 7 36.2295 37.0 37.0 37.0 37.0 37.0 8 36.303 37.0 37.0 37.0 37.0 37.0 9 36.262 37.0 37.0 37.0 37.0 37.0 10-14 36.2749 37.0 37.0 37.0 37.0 37.0 15-19 36.260200000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.181799999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.0766 37.0 37.0 37.0 37.0 37.0 30-34 36.017399999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.98309999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.9662 37.0 37.0 37.0 37.0 37.0 45-49 35.9134 37.0 37.0 37.0 37.0 37.0 50-54 35.8934 37.0 37.0 37.0 37.0 37.0 55-59 35.9392 37.0 37.0 37.0 37.0 37.0 60-64 35.9519 37.0 37.0 37.0 37.0 37.0 65-69 35.891 37.0 37.0 37.0 37.0 37.0 70-74 35.842 37.0 37.0 37.0 37.0 37.0 75-79 35.7676 37.0 37.0 37.0 37.0 37.0 80-84 35.7868 37.0 37.0 37.0 37.0 37.0 85-89 35.811299999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.7586 37.0 37.0 37.0 37.0 37.0 95-99 35.61659999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.595299999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.578199999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.4942 37.0 37.0 37.0 37.0 37.0 115-119 35.39569999999999 37.0 37.0 37.0 34.6 37.0 120-124 35.2245 37.0 37.0 37.0 32.2 37.0 125-129 35.1034 37.0 37.0 37.0 25.0 37.0 130-134 34.820299999999996 37.0 37.0 37.0 25.0 37.0 135-139 34.77159999999999 37.0 37.0 37.0 25.0 37.0 140-144 34.4054 37.0 37.0 37.0 25.0 37.0 145-149 34.0866 37.0 37.0 37.0 25.0 37.0 150-151 33.658 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 3.0 16 2.0 17 1.0 18 1.0 19 2.0 20 1.0 21 2.0 22 2.0 23 5.0 24 8.0 25 6.0 26 8.0 27 13.0 28 18.0 29 20.0 30 27.0 31 66.0 32 102.0 33 153.0 34 302.0 35 761.0 36 2330.0 37 166.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.15 20.45 15.275 34.125 2 27.950000000000003 24.55 31.525 15.975 3 20.575 27.250000000000004 31.6 20.575 4 22.725 32.925 25.4 18.95 5 26.525 34.775 22.650000000000002 16.05 6 19.05 38.25 24.2 18.5 7 19.775000000000002 20.825 41.175 18.224999999999998 8 21.8 24.175 28.999999999999996 25.025 9 21.75 23.125 31.775 23.35 10-14 22.82 28.49 27.189999999999998 21.5 15-19 23.18 27.544999999999998 27.765 21.51 20-24 22.82 28.28 27.29 21.61 25-29 23.385 27.98 27.935 20.7 30-34 22.75 28.165000000000003 27.985 21.099999999999998 35-39 22.814999999999998 28.310000000000002 28.02 20.855 40-44 22.900000000000002 27.800000000000004 28.07 21.23 45-49 23.345 27.975 27.66 21.02 50-54 23.26 27.639999999999997 27.32 21.78 55-59 22.965 27.63 27.97 21.435000000000002 60-64 23.49 27.555000000000003 28.27 20.685000000000002 65-69 23.655 27.155 28.095 21.095 70-74 23.955000000000002 27.48 27.639999999999997 20.925 75-79 23.885 27.485 27.355 21.275 80-84 23.05 27.650000000000002 28.115000000000002 21.185000000000002 85-89 24.01 27.625 27.495000000000005 20.87 90-94 24.495 27.355 27.310000000000002 20.84 95-99 24.240000000000002 28.01 26.715 21.035 100-104 24.875 27.22 27.58 20.325 105-109 24.490000000000002 28.000000000000004 27.855 19.655 110-114 25.255 28.01 26.540000000000003 20.195 115-119 25.805 28.194999999999997 26.07 19.93 120-124 26.279999999999998 27.165 27.105 19.45 125-129 26.83 27.63 26.740000000000002 18.8 130-134 27.655 27.125 26.32 18.9 135-139 27.700000000000003 26.834999999999997 26.529999999999998 18.935 140-144 29.18 26.939999999999998 25.35 18.529999999999998 145-149 30.29 26.229999999999997 25.69 17.79 150-151 30.75 26.674999999999997 25.25 17.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 2.0 22 2.0 23 1.5 24 1.5 25 2.5 26 4.5 27 5.0 28 10.5 29 13.5 30 12.0 31 23.5 32 34.5 33 37.0 34 51.5 35 69.5 36 98.5 37 122.0 38 137.0 39 159.0 40 167.5 41 184.0 42 232.5 43 252.0 44 263.5 45 268.0 46 250.5 47 242.0 48 225.5 49 211.5 50 175.5 51 137.0 52 113.0 53 99.0 54 88.5 55 74.5 56 51.0 57 28.5 58 28.0 59 29.0 60 22.5 61 14.0 62 8.5 63 9.5 64 6.0 65 1.0 66 3.0 67 3.5 68 1.0 69 2.0 70 2.0 71 0.0 72 1.0 73 1.0 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.5 88 1.0 89 1.0 90 0.5 91 0.0 92 0.5 93 0.5 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.4 #Duplication Level Percentage of deduplicated Percentage of total 1 92.04048140043764 84.125 2 6.75601750547046 12.35 3 0.9846827133479212 2.7 4 0.19146608315098468 0.7000000000000001 5 0.02735229759299781 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.21250000000000002 0.0 0.0 0.0 0.0 68-69 0.275 0.0 0.0 0.0 0.0 70-71 0.4125 0.0 0.0 0.0 0.0 72-73 0.525 0.0 0.0 0.0 0.0 74-75 0.675 0.0 0.0 0.0 0.0 76-77 0.8500000000000001 0.0 0.0 0.0 0.0 78-79 0.975 0.0 0.0 0.0 0.0 80-81 1.125 0.0 0.0 0.0 0.0 82-83 1.3624999999999998 0.0 0.0 0.0 0.0 84-85 1.6375000000000002 0.0 0.0 0.0 0.0 86-87 2.0 0.0 0.0 0.0 0.0 88-89 2.4625 0.0 0.0 0.0 0.0 90-91 2.95 0.0 0.0 0.0 0.0 92-93 3.4375 0.0 0.0 0.0 0.0 94-95 3.9000000000000004 0.0 0.0 0.0 0.0 96-97 4.324999999999999 0.0 0.0 0.0 0.0 98-99 4.9 0.0 0.0 0.0 0.0 100-101 5.487500000000001 0.0 0.0 0.0 0.0 102-103 6.05 0.0 0.0 0.0 0.0 104-105 6.675 0.0 0.0 0.0 0.0 106-107 7.2625 0.0 0.0 0.0 0.0 108-109 7.8625 0.0 0.0 0.0 0.0 110-111 8.4 0.0 0.0 0.0 0.0 112-113 9.175 0.0 0.0 0.0 0.0 114-115 9.8375 0.0 0.0 0.0 0.0 116-117 10.524999999999999 0.0 0.0 0.0 0.0 118-119 11.15 0.0 0.0 0.0 0.0 120-121 12.025 0.0 0.0 0.0 0.0 122-123 12.8375 0.0 0.0 0.0 0.0 124-125 13.575 0.0 0.0 0.0 0.0 126-127 14.412500000000001 0.0 0.0 0.0 0.0 128-129 15.0 0.0 0.0 0.0 0.0 130-131 15.7625 0.0 0.0 0.0 0.0 132-133 16.4375 0.0 0.0 0.0 0.0 134-135 17.35 0.0 0.0 0.0 0.0 136-137 18.2875 0.0 0.0 0.0 0.0 138-139 18.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACGGC 10 0.006830828 145.0 5 GGGGGGG 115 1.37751795E-5 12.608697 135-139 >>END_MODULE Read 634929 spots for SRR12917587.sra Written 634929 spots for SRR12917587.sra Read 634929 spots for SRR12917587.sra Written 634929 spots for SRR12917587.sra Read 634929 spots for SRR12917587.sra Written 634929 spots for SRR12917587.sra Read 634929 spots for SRR12917587.sra Written 634929 spots for SRR12917587.sra Read 634929 spots for SRR12917587.sra Written 634929 spots for SRR12917587.sra Read 634929 spots for SRR12917587.sra Written 634929 spots for SRR12917587.sra Read 634929 spots for SRR12917587.sra Written 634929 spots for SRR12917587.sra Read 634929 spots for SRR12917587.sra Written 634929 spots for SRR12917587.sra Read 634929 spots for SRR12917587.sra Written 634929 spots for SRR12917587.sra Read 634929 spots for SRR12917587.sra Written 634929 spots for SRR12917587.sra Read 634929 spots for SRR12917587.sra Written 634929 spots for SRR12917587.sra Read 634929 spots for SRR12917587.sra Written 634929 spots for SRR12917587.sra Read 634929 spots for SRR12917587.sra Written 634929 spots for SRR12917587.sra Read 634935 spots for SRR12917587.sra Written 634935 spots for SRR12917587.sra Read 634929 spots for SRR12917587.sra Written 634929 spots for SRR12917587.sra Read 634929 spots for SRR12917587.sra Written 634929 spots for SRR12917587.sra Read 634929 spots for SRR12917587.sra Written 634929 spots for SRR12917587.sra Read 634929 spots for SRR12917587.sra Written 634929 spots for SRR12917587.sra Read 634929 spots for SRR12917587.sra Written 634929 spots for SRR12917587.sra Read 634929 spots for SRR12917587.sra Written 634929 spots for SRR12917587.sra SRR ids: ['SRR12917587.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xir1xo4p SRR12917587.sra spots: 12698586 blocks: [[1, 634929], [634930, 1269858], [1269859, 1904787], [1904788, 2539716], [2539717, 3174645], [3174646, 3809574], [3809575, 4444503], [4444504, 5079432], [5079433, 5714361], [5714362, 6349290], [6349291, 6984219], [6984220, 7619148], [7619149, 8254077], [8254078, 8889006], [8889007, 9523935], [9523936, 10158864], [10158865, 10793793], [10793794, 11428722], [11428723, 12063651], [12063652, 12698586]] SRR12917587 file size 4293834 SRR12917587 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917587 SRR12917587_1.fastq SRR12917587_2.fastq Input file: SRR12917587_1.fastq Paired file: SRR12917587_2.fastq trimmed: SRR12917587-trimmed-pair1.fastq, SRR12917587-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:07:11 2025 >> started Thu Feb 13 15:07:26 2025 >> done (14.666s) 12698586 read pairs processed; of these: 48 ( 0.00%) short read pairs filtered out after trimming by size control 9105 ( 0.07%) empty read pairs filtered out after trimming by size control 12689433 (99.93%) read pairs available; of these: 3083048 (24.30%) trimmed read pairs available after processing 9606385 (75.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 5 0.00% 20 1 0.00% 21 2 0.00% 22 9 0.00% 23 5 0.00% 24 13 0.00% 25 18 0.00% 26 15 0.00% 27 17 0.00% 28 23 0.00% 29 22 0.00% 30 29 0.00% 31 33 0.00% 32 34 0.00% 33 42 0.00% 34 48 0.00% 35 70 0.00% 36 70 0.00% 37 74 0.00% 38 105 0.00% 39 124 0.00% 40 173 0.00% 41 187 0.00% 42 196 0.00% 43 204 0.00% 44 241 0.00% 45 249 0.00% 46 299 0.00% 47 325 0.00% 48 410 0.00% 49 538 0.00% 50 661 0.01% 51 756 0.01% 52 877 0.01% 53 968 0.01% 54 1056 0.01% 55 1159 0.01% 56 1214 0.01% 57 1450 0.01% 58 1629 0.01% 59 1870 0.01% 60 2217 0.02% 61 2657 0.02% 62 2900 0.02% 63 3381 0.03% 64 3626 0.03% 65 4097 0.03% 66 4356 0.03% 67 4901 0.04% 68 5405 0.04% 69 6025 0.05% 70 6585 0.05% 71 7543 0.06% 72 8518 0.07% 73 9779 0.08% 74 10700 0.08% 75 11228 0.09% 76 12246 0.10% 77 12929 0.10% 78 13599 0.11% 79 14547 0.11% 80 15287 0.12% 81 16761 0.13% 82 18228 0.14% 83 19715 0.16% 84 21188 0.17% 85 22557 0.18% 86 23573 0.19% 87 24239 0.19% 88 25089 0.20% 89 25319 0.20% 90 26403 0.21% 91 27402 0.22% 92 28610 0.23% 93 30101 0.24% 94 31706 0.25% 95 33087 0.26% 96 33659 0.27% 97 34436 0.27% 98 34697 0.27% 99 35271 0.28% 100 35292 0.28% 101 35961 0.28% 102 36851 0.29% 103 38117 0.30% 104 39300 0.31% 105 39732 0.31% 106 40255 0.32% 107 41435 0.33% 108 41850 0.33% 109 42259 0.33% 110 42111 0.33% 111 41936 0.33% 112 42426 0.33% 113 42627 0.34% 114 43758 0.34% 115 45009 0.35% 116 45950 0.36% 117 46344 0.37% 118 46097 0.36% 119 46716 0.37% 120 47027 0.37% 121 47012 0.37% 122 46884 0.37% 123 47739 0.38% 124 47255 0.37% 125 48272 0.38% 126 49439 0.39% 127 49739 0.39% 128 49606 0.39% 129 49990 0.39% 130 50149 0.40% 131 50002 0.39% 132 50230 0.40% 133 49926 0.39% 134 49435 0.39% 135 50378 0.40% 136 50753 0.40% 137 51312 0.40% 138 51541 0.41% 139 52607 0.41% 140 51585 0.41% 141 51679 0.41% 142 51940 0.41% 143 51238 0.40% 144 51468 0.41% 145 51661 0.41% 146 51705 0.41% 147 51132 0.40% 148 52235 0.41% 149 52534 0.41% 150 52750 0.42% 151 9606385 75.70% 12689433 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=25 prefix-density=0.64 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=27 fanout-score=16.34 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=3.9 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=21 prefix-density=0.84 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=69.89 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.3 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACC SRR12917587 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:08:07 Started mapping on | Feb 13 15:08:07 Finished on | Feb 13 15:09:26 Mapping speed, Million of reads per hour | 578.25 Number of input reads | 12689433 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 11821756 Uniquely mapped reads % | 93.16% Average mapped length | 284.47 Number of splices: Total | 11276967 Number of splices: Annotated (sjdb) | 11043093 Number of splices: GT/AG | 11033237 Number of splices: GC/AG | 203108 Number of splices: AT/AC | 7382 Number of splices: Non-canonical | 33240 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 295237 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 201316 % of reads mapped to too many loci | 1.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.71% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 572440 572440 572440 N_multimapping 295237 295237 295237 N_noFeature 522497 11670024 581814 N_ambiguous 161355 565 68680 UnstrandedReadsAssigned:11137904 PositiveStrandReadsAssigned:151167 NegativeStrandReadsAssigned:11171262 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=140 echo kmer=135 SRR12917587 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917587-trimmed-pair1.fastq SRR12917587-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,689,433 reads, 11,313,381 reads pseudoaligned [quant] estimated average fragment length: 223.405 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 998 rounds 52401 SRR12917587.ke.tsv 34699 SRR12917587.se.tsv 87100 total ==> SRR12917587.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.6 348 18.495 Potri.005G024800.1.v4.1 1035 812.595 319 37.4628 Potri.004G059700.1.v4.1 961 738.694 89 11.4977 Potri.007G009000.2.v4.1 1416 1193.6 0 0 Potri.003G141000.2.v4.1 2943 2720.6 340 11.9261 Potri.016G087400.1.v4.1 270 108.081 483 426.463 Potri.015G069301.1.v4.1 564 354.601 0 0 Potri.010G195200.1.v4.1 1773 1550.6 5 0.30772 Potri.012G127500.1.v4.1 977 754.643 124 15.6807 ==> SRR12917587.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 155 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 135 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 2 SRR12917587 completed mapping pipeline successfully