Starting /dee2/code/volunteer_pipeline.sh SRR12919313 current disk space = 3051713839104 free memory = 1422110632 SRR12919313 SRAfilesize c59c00eb007040ee4e5629d0d5d49048 SRR12919313.sra SRR12919313.sra file validated SRR12919313 is paired end SRR12919313 is conventional basespace SRR12919313 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919313_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5435 37.0 37.0 37.0 37.0 37.0 2 36.1755 37.0 37.0 37.0 37.0 37.0 3 36.5615 37.0 37.0 37.0 37.0 37.0 4 36.608 37.0 37.0 37.0 37.0 37.0 5 36.6985 37.0 37.0 37.0 37.0 37.0 6 36.678 37.0 37.0 37.0 37.0 37.0 7 36.543 37.0 37.0 37.0 37.0 37.0 8 36.6595 37.0 37.0 37.0 37.0 37.0 9 36.647 37.0 37.0 37.0 37.0 37.0 10-14 36.6606 37.0 37.0 37.0 37.0 37.0 15-19 36.617599999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5852 37.0 37.0 37.0 37.0 37.0 25-29 36.5653 37.0 37.0 37.0 37.0 37.0 30-34 36.5321 37.0 37.0 37.0 37.0 37.0 35-39 36.4688 37.0 37.0 37.0 37.0 37.0 40-44 36.4748 37.0 37.0 37.0 37.0 37.0 45-49 36.4941 37.0 37.0 37.0 37.0 37.0 50-54 36.4598 37.0 37.0 37.0 37.0 37.0 55-59 36.4294 37.0 37.0 37.0 37.0 37.0 60-64 36.4292 37.0 37.0 37.0 37.0 37.0 65-69 36.429199999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.363 37.0 37.0 37.0 37.0 37.0 75-79 36.339 37.0 37.0 37.0 37.0 37.0 80-84 36.3573 37.0 37.0 37.0 37.0 37.0 85-89 36.2251 37.0 37.0 37.0 37.0 37.0 90-94 36.243399999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.2254 37.0 37.0 37.0 37.0 37.0 100-104 36.1854 37.0 37.0 37.0 37.0 37.0 105-109 36.172200000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.090700000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.121300000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.03009999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.9414 37.0 37.0 37.0 37.0 37.0 130-134 35.889700000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.865300000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.739700000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.6844 37.0 37.0 37.0 37.0 37.0 150-151 35.55825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 0.0 25 2.0 26 7.0 27 5.0 28 10.0 29 24.0 30 21.0 31 23.0 32 40.0 33 54.0 34 138.0 35 344.0 36 2928.0 37 401.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.25 12.425 6.525 35.8 2 19.924433249370278 11.914357682619647 36.44836272040302 31.712846347607055 3 16.825000000000003 16.875 29.299999999999997 37.0 4 20.875 25.6 24.7 28.825 5 23.35 30.625000000000004 25.974999999999998 20.05 6 20.8 33.725 24.349999999999998 21.125 7 15.0 27.1 40.150000000000006 17.75 8 18.175 25.6 32.475 23.75 9 16.225 24.525 36.75 22.5 10-14 19.384999999999998 29.395 28.405 22.814999999999998 15-19 19.689999999999998 28.125 27.73 24.455 20-24 19.715 28.49 28.384999999999998 23.41 25-29 19.259999999999998 29.205 28.1 23.435 30-34 19.615 29.134999999999998 28.24 23.01 35-39 19.74 28.720000000000002 27.775 23.765 40-44 19.945 29.360000000000003 27.07 23.625 45-49 19.82 29.4 27.365000000000002 23.415 50-54 19.7 29.060000000000002 28.075 23.165 55-59 20.02 28.505000000000003 27.775 23.7 60-64 20.419999999999998 28.939999999999998 27.71 22.93 65-69 20.115 28.46 27.500000000000004 23.925 70-74 19.98 29.294999999999998 27.08 23.645 75-79 20.78 28.525 27.994999999999997 22.7 80-84 20.02 28.425 28.17 23.385 85-89 20.64 28.525 27.29 23.544999999999998 90-94 20.335 28.715000000000003 27.955000000000002 22.994999999999997 95-99 20.560000000000002 27.61 28.665000000000003 23.165 100-104 20.515 28.384999999999998 28.065 23.035 105-109 20.68 28.860000000000003 27.58 22.88 110-114 20.07 28.494999999999997 27.42 24.015 115-119 20.645 28.560000000000002 27.534999999999997 23.26 120-124 20.369999999999997 28.625 27.450000000000003 23.555 125-129 21.029999999999998 28.49 26.795 23.685000000000002 130-134 21.125 28.505000000000003 27.26 23.11 135-139 20.71 28.265 27.13 23.895 140-144 20.665 28.845 26.55 23.94 145-149 21.01 28.525 26.735 23.73 150-151 20.7125 28.599999999999998 26.6 24.087500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 2.0 17 3.5 18 3.0 19 1.5 20 1.5 21 2.0 22 1.0 23 3.5 24 5.0 25 7.5 26 9.0 27 13.5 28 15.5 29 14.5 30 20.0 31 29.5 32 33.5 33 44.0 34 64.5 35 79.0 36 91.0 37 115.5 38 125.0 39 138.5 40 168.0 41 218.5 42 259.5 43 249.5 44 239.0 45 268.0 46 276.5 47 259.0 48 237.5 49 208.0 50 182.0 51 131.0 52 104.5 53 91.5 54 70.0 55 58.0 56 41.0 57 21.0 58 20.5 59 20.5 60 15.5 61 8.0 62 3.5 63 8.5 64 7.0 65 3.5 66 2.5 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.75 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.375 #Duplication Level Percentage of deduplicated Percentage of total 1 91.00968188105118 82.25 2 7.551867219917012 13.65 3 1.272475795297372 3.45 4 0.13831258644536654 0.5 5 0.0 0.0 6 0.027662517289073305 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAGCTATTGGCACTTTTTAGCACTTGACCTCCTTCAAAGCATGACCAA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.1375000000000002 0.0 0.0 0.0 0.0 102-103 1.475 0.0 0.0 0.0 0.0 104-105 1.75 0.0 0.0 0.0 0.0 106-107 2.05 0.0 0.0 0.0 0.0 108-109 2.5 0.0 0.0 0.0 0.0 110-111 2.8625 0.0 0.0 0.0 0.0 112-113 3.325 0.0 0.0 0.0 0.0 114-115 3.8 0.0 0.0 0.0 0.0 116-117 4.3125 0.0 0.0 0.0 0.0 118-119 5.0 0.0 0.0 0.0 0.0 120-121 5.574999999999999 0.0 0.0 0.0 0.0 122-123 6.1 0.0 0.0 0.0 0.0 124-125 6.7875 0.0 0.0 0.0 0.0 126-127 7.2875 0.0 0.0 0.0 0.0 128-129 8.1125 0.0 0.0 0.0 0.0 130-131 8.575 0.0 0.0 0.0 0.0 132-133 9.025 0.0 0.0 0.0 0.0 134-135 9.7125 0.0 0.0 0.0 0.0 136-137 10.475000000000001 0.0 0.0 0.0 0.0 138-139 11.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAAAC 10 0.006830828 145.0 3 CCTATTT 10 0.006830828 145.0 3 >>END_MODULE SRR12919313 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919313_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.271 37.0 37.0 37.0 37.0 37.0 2 36.0815 37.0 37.0 37.0 37.0 37.0 3 36.122 37.0 37.0 37.0 37.0 37.0 4 36.0825 37.0 37.0 37.0 37.0 37.0 5 36.11 37.0 37.0 37.0 37.0 37.0 6 36.262 37.0 37.0 37.0 37.0 37.0 7 36.1065 37.0 37.0 37.0 37.0 37.0 8 36.2015 37.0 37.0 37.0 37.0 37.0 9 36.159 37.0 37.0 37.0 37.0 37.0 10-14 36.23559999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.2055 37.0 37.0 37.0 37.0 37.0 20-24 36.2286 37.0 37.0 37.0 37.0 37.0 25-29 36.17 37.0 37.0 37.0 37.0 37.0 30-34 36.1084 37.0 37.0 37.0 37.0 37.0 35-39 36.072500000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.0393 37.0 37.0 37.0 37.0 37.0 45-49 36.0304 37.0 37.0 37.0 37.0 37.0 50-54 35.9637 37.0 37.0 37.0 37.0 37.0 55-59 35.9559 37.0 37.0 37.0 37.0 37.0 60-64 35.902 37.0 37.0 37.0 37.0 37.0 65-69 35.9984 37.0 37.0 37.0 37.0 37.0 70-74 35.9011 37.0 37.0 37.0 37.0 37.0 75-79 35.8489 37.0 37.0 37.0 37.0 37.0 80-84 35.863 37.0 37.0 37.0 37.0 37.0 85-89 35.8181 37.0 37.0 37.0 37.0 37.0 90-94 35.715999999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.7072 37.0 37.0 37.0 37.0 37.0 100-104 35.676700000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.6285 37.0 37.0 37.0 37.0 37.0 110-114 35.6233 37.0 37.0 37.0 37.0 37.0 115-119 35.54860000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.4676 37.0 37.0 37.0 37.0 37.0 125-129 35.390100000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.3538 37.0 37.0 37.0 32.2 37.0 135-139 35.1263 37.0 37.0 37.0 25.0 37.0 140-144 34.9016 37.0 37.0 37.0 25.0 37.0 145-149 34.8024 37.0 37.0 37.0 25.0 37.0 150-151 34.54275 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 0.0 15 2.0 16 1.0 17 0.0 18 1.0 19 1.0 20 0.0 21 1.0 22 3.0 23 8.0 24 5.0 25 12.0 26 7.0 27 17.0 28 14.0 29 34.0 30 38.0 31 53.0 32 74.0 33 122.0 34 247.0 35 581.0 36 2551.0 37 225.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.1 24.95 8.450000000000001 24.5 2 26.400000000000002 27.650000000000002 29.875 16.075 3 21.45 28.525 32.125 17.9 4 23.849999999999998 33.800000000000004 22.75 19.6 5 23.7 37.724999999999994 20.45 18.125 6 20.3 39.574999999999996 22.825 17.299999999999997 7 21.175 23.075000000000003 36.925000000000004 18.825 8 22.075 25.124999999999996 28.15 24.65 9 22.075 25.2 30.075000000000003 22.650000000000002 10-14 23.68 29.235 26.290000000000003 20.794999999999998 15-19 22.99 28.310000000000002 27.63 21.07 20-24 22.85 29.195 27.065 20.89 25-29 22.915 28.82 27.87 20.395 30-34 23.494999999999997 27.955000000000002 27.875 20.674999999999997 35-39 23.294999999999998 28.29 27.955000000000002 20.46 40-44 22.865 28.845 27.42 20.87 45-49 22.785 28.634999999999998 28.084999999999997 20.495 50-54 23.095 28.560000000000002 27.46 20.885 55-59 23.044999999999998 28.395 27.915 20.645 60-64 23.525 28.57 27.73 20.175 65-69 23.13 27.855 28.205000000000002 20.810000000000002 70-74 22.675 27.975 28.595 20.755000000000003 75-79 22.715 28.384999999999998 27.82 21.08 80-84 23.43 28.42 27.98 20.169999999999998 85-89 23.150000000000002 29.020000000000003 27.625 20.205000000000002 90-94 23.68 28.21 27.97 20.14 95-99 23.16 28.425 28.310000000000002 20.105 100-104 23.53 28.975 26.77 20.724999999999998 105-109 23.87 28.694999999999997 27.61 19.825 110-114 23.375 28.310000000000002 27.365000000000002 20.95 115-119 24.25 28.735 27.384999999999998 19.63 120-124 24.645 28.22 27.195000000000004 19.939999999999998 125-129 24.705 28.54 26.979999999999997 19.775000000000002 130-134 25.615 27.93 27.139999999999997 19.314999999999998 135-139 25.230000000000004 28.965000000000003 26.43 19.375 140-144 26.51 28.425 26.424999999999997 18.64 145-149 26.395000000000003 28.185 26.405 19.015 150-151 26.987499999999997 28.65 25.224999999999998 19.1375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10 1.0 11 1.0 12 0.5 13 0.5 14 1.0 15 1.5 16 1.0 17 1.5 18 1.5 19 2.5 20 3.0 21 1.5 22 2.0 23 2.5 24 3.0 25 3.0 26 6.5 27 9.0 28 9.5 29 11.0 30 18.0 31 30.0 32 39.0 33 50.0 34 63.5 35 71.5 36 89.0 37 110.5 38 124.5 39 153.0 40 204.0 41 246.0 42 269.5 43 274.0 44 256.5 45 246.0 46 239.5 47 239.0 48 231.5 49 199.5 50 157.5 51 137.5 52 119.0 53 83.5 54 64.0 55 49.0 56 39.5 57 34.5 58 24.0 59 12.0 60 7.5 61 8.0 62 6.0 63 7.5 64 5.5 65 3.5 66 3.0 67 2.0 68 3.0 69 1.5 70 0.5 71 2.5 72 2.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.24208207105481 82.825 2 7.573671164968328 13.750000000000002 3 1.0740842743045993 2.9250000000000003 4 0.0550812448361333 0.2 5 0.0 0.0 6 0.0550812448361333 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GTGGGTTGTTCAAGGAGCTGTCGACGTAGACATTGGCGCTAATCCTTCTG 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.1375000000000002 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.775 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.525 0.0 0.0 0.0 0.0 110-111 2.9 0.0 0.0 0.0 0.0 112-113 3.375 0.0 0.0 0.0 0.0 114-115 3.85 0.0 0.0 0.0 0.0 116-117 4.3625 0.0 0.0 0.0 0.0 118-119 5.050000000000001 0.0 0.0 0.0 0.0 120-121 5.625 0.0 0.0 0.0 0.0 122-123 6.15 0.0 0.0 0.0 0.0 124-125 6.8375 0.0 0.0 0.0 0.0 126-127 7.375 0.0 0.0 0.0 0.0 128-129 8.2375 0.0 0.0 0.0 0.0 130-131 8.7 0.0 0.0 0.0 0.0 132-133 9.2 0.0 0.0 0.0 0.0 134-135 9.899999999999999 0.0 0.0 0.0 0.0 136-137 10.675 0.0 0.0 0.0 0.0 138-139 11.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1123847 spots for SRR12919313.sra Written 1123847 spots for SRR12919313.sra Read 1123847 spots for SRR12919313.sra Written 1123847 spots for SRR12919313.sra Read 1123847 spots for SRR12919313.sra Written 1123847 spots for SRR12919313.sra Read 1123847 spots for SRR12919313.sra Written 1123847 spots for SRR12919313.sra Read 1123854 spots for SRR12919313.sra Written 1123854 spots for SRR12919313.sra Read 1123847 spots for SRR12919313.sra Written 1123847 spots for SRR12919313.sra Read 1123847 spots for SRR12919313.sra Written 1123847 spots for SRR12919313.sra Read 1123847 spots for SRR12919313.sra Written 1123847 spots for SRR12919313.sra Read 1123847 spots for SRR12919313.sra Written 1123847 spots for SRR12919313.sra Read 1123847 spots for SRR12919313.sra Written 1123847 spots for SRR12919313.sra Read 1123847 spots for SRR12919313.sra Written 1123847 spots for SRR12919313.sra Read 1123847 spots for SRR12919313.sra Written 1123847 spots for SRR12919313.sra Read 1123847 spots for SRR12919313.sra Written 1123847 spots for SRR12919313.sra Read 1123847 spots for SRR12919313.sra Written 1123847 spots for SRR12919313.sra Read 1123847 spots for SRR12919313.sra Written 1123847 spots for SRR12919313.sra Read 1123847 spots for SRR12919313.sra Written 1123847 spots for SRR12919313.sra Read 1123847 spots for SRR12919313.sra Written 1123847 spots for SRR12919313.sra Read 1123847 spots for SRR12919313.sra Written 1123847 spots for SRR12919313.sra Read 1123847 spots for SRR12919313.sra Written 1123847 spots for SRR12919313.sra Read 1123847 spots for SRR12919313.sra Written 1123847 spots for SRR12919313.sra SRR ids: ['SRR12919313.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gjzs3n6h SRR12919313.sra spots: 22476947 blocks: [[1, 1123847], [1123848, 2247694], [2247695, 3371541], [3371542, 4495388], [4495389, 5619235], [5619236, 6743082], [6743083, 7866929], [7866930, 8990776], [8990777, 10114623], [10114624, 11238470], [11238471, 12362317], [12362318, 13486164], [13486165, 14610011], [14610012, 15733858], [15733859, 16857705], [16857706, 17981552], [17981553, 19105399], [19105400, 20229246], [20229247, 21353093], [21353094, 22476947]] SRR12919313 file size 7616949 SRR12919313 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919313 SRR12919313_1.fastq SRR12919313_2.fastq Input file: SRR12919313_1.fastq Paired file: SRR12919313_2.fastq trimmed: SRR12919313-trimmed-pair1.fastq, SRR12919313-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:36:07 2025 >> started Wed Feb 12 17:36:46 2025 >> done (38.938s) 22476947 read pairs processed; of these: 44 ( 0.00%) short read pairs filtered out after trimming by size control 2205 ( 0.01%) empty read pairs filtered out after trimming by size control 22474698 (99.99%) read pairs available; of these: 3530251 (15.71%) trimmed read pairs available after processing 18944447 (84.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 7 0.00% 21 5 0.00% 22 4 0.00% 23 6 0.00% 24 14 0.00% 25 4 0.00% 26 12 0.00% 27 11 0.00% 28 16 0.00% 29 10 0.00% 30 7 0.00% 31 18 0.00% 32 17 0.00% 33 17 0.00% 34 21 0.00% 35 17 0.00% 36 26 0.00% 37 13 0.00% 38 31 0.00% 39 33 0.00% 40 34 0.00% 41 43 0.00% 42 35 0.00% 43 57 0.00% 44 37 0.00% 45 41 0.00% 46 56 0.00% 47 58 0.00% 48 58 0.00% 49 88 0.00% 50 105 0.00% 51 131 0.00% 52 148 0.00% 53 125 0.00% 54 145 0.00% 55 154 0.00% 56 202 0.00% 57 214 0.00% 58 266 0.00% 59 295 0.00% 60 396 0.00% 61 452 0.00% 62 534 0.00% 63 614 0.00% 64 627 0.00% 65 707 0.00% 66 768 0.00% 67 922 0.00% 68 1005 0.00% 69 1153 0.01% 70 1482 0.01% 71 1722 0.01% 72 2032 0.01% 73 2299 0.01% 74 2600 0.01% 75 2879 0.01% 76 3197 0.01% 77 3541 0.02% 78 3880 0.02% 79 4257 0.02% 80 4993 0.02% 81 5704 0.03% 82 6886 0.03% 83 7911 0.04% 84 8287 0.04% 85 9590 0.04% 86 9831 0.04% 87 10671 0.05% 88 11544 0.05% 89 12296 0.05% 90 13947 0.06% 91 15308 0.07% 92 17533 0.08% 93 19119 0.09% 94 20871 0.09% 95 22122 0.10% 96 23677 0.11% 97 24768 0.11% 98 25618 0.11% 99 26826 0.12% 100 28803 0.13% 101 30126 0.13% 102 32877 0.15% 103 34925 0.16% 104 37231 0.17% 105 39389 0.18% 106 40546 0.18% 107 41397 0.18% 108 42061 0.19% 109 43469 0.19% 110 44167 0.20% 111 46336 0.21% 112 48502 0.22% 113 50868 0.23% 114 53046 0.24% 115 55188 0.25% 116 56227 0.25% 117 57269 0.25% 118 57606 0.26% 119 57957 0.26% 120 58758 0.26% 121 60039 0.27% 122 61765 0.27% 123 64279 0.29% 124 66498 0.30% 125 67304 0.30% 126 68995 0.31% 127 69618 0.31% 128 69178 0.31% 129 69167 0.31% 130 70133 0.31% 131 70223 0.31% 132 71296 0.32% 133 74168 0.33% 134 74691 0.33% 135 77565 0.35% 136 77719 0.35% 137 77717 0.35% 138 77236 0.34% 139 77793 0.35% 140 76914 0.34% 141 77328 0.34% 142 79101 0.35% 143 79300 0.35% 144 81562 0.36% 145 82783 0.37% 146 83606 0.37% 147 84242 0.37% 148 83636 0.37% 149 81983 0.36% 150 82507 0.37% 151 18944447 84.29% 22474698 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=5.59 fanout-score-rank=22 prefix-density=0.18 prefix-fanout=3.9 sequence=CAATTTTCTCAATAGCTGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=105.00 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=19.1 sequence=CCTTCTTCTCAA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=36 prefix-density=0.18 prefix-fanout=2.5 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=109.10 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=13.0 sequence=GTGAAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTG SRR12919313 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:37:52 Started mapping on | Feb 12 17:37:52 Finished on | Feb 12 17:46:15 Mapping speed, Million of reads per hour | 160.85 Number of input reads | 22474698 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 19128957 Uniquely mapped reads % | 85.11% Average mapped length | 292.38 Number of splices: Total | 18371281 Number of splices: Annotated (sjdb) | 17945404 Number of splices: GT/AG | 18039833 Number of splices: GC/AG | 256940 Number of splices: AT/AC | 22976 Number of splices: Non-canonical | 51532 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 514191 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 96858 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.95% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2831550 2831550 2831550 N_multimapping 514191 514191 514191 N_noFeature 687218 18896563 807180 N_ambiguous 214634 1301 101513 UnstrandedReadsAssigned:18227105 PositiveStrandReadsAssigned:231093 NegativeStrandReadsAssigned:18220264 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919313 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919313-trimmed-pair1.fastq SRR12919313-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,474,698 reads, 18,477,184 reads pseudoaligned [quant] estimated average fragment length: 245.177 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR12919313.ke.tsv 34699 SRR12919313.se.tsv 87100 total ==> SRR12919313.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.82 911 28.3144 Potri.005G024800.1.v4.1 1035 790.823 344.01 23.9823 Potri.004G059700.1.v4.1 961 716.95 34 2.61451 Potri.007G009000.2.v4.1 1416 1171.82 0 0 Potri.003G141000.2.v4.1 2943 2698.82 551 11.2558 Potri.016G087400.1.v4.1 270 94.7525 1192 693.562 Potri.015G069301.1.v4.1 564 333.293 0 0 Potri.010G195200.1.v4.1 1773 1528.82 157 5.66163 Potri.012G127500.1.v4.1 977 732.887 14994 1127.92 ==> SRR12919313.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 177 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 387 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 22 Potri.001G452600.v4.1 69 SRR12919313 completed mapping pipeline successfully