Starting /dee2/code/volunteer_pipeline.sh SRR12919314 current disk space = 3051617779712 free memory = 1443030132 SRR12919314 SRAfilesize 8720ba05f668fe9b3b528e3b5d1230e3 SRR12919314.sra SRR12919314.sra file validated SRR12919314 is paired end SRR12919314 is conventional basespace SRR12919314 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919314_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6175 37.0 37.0 37.0 37.0 37.0 2 36.24525 37.0 37.0 37.0 37.0 37.0 3 36.606 37.0 37.0 37.0 37.0 37.0 4 36.675 37.0 37.0 37.0 37.0 37.0 5 36.665 37.0 37.0 37.0 37.0 37.0 6 36.7055 37.0 37.0 37.0 37.0 37.0 7 36.628 37.0 37.0 37.0 37.0 37.0 8 36.669 37.0 37.0 37.0 37.0 37.0 9 36.657 37.0 37.0 37.0 37.0 37.0 10-14 36.6255 37.0 37.0 37.0 37.0 37.0 15-19 36.6302 37.0 37.0 37.0 37.0 37.0 20-24 36.6255 37.0 37.0 37.0 37.0 37.0 25-29 36.513600000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.5539 37.0 37.0 37.0 37.0 37.0 35-39 36.526700000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.5022 37.0 37.0 37.0 37.0 37.0 45-49 36.482299999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.4569 37.0 37.0 37.0 37.0 37.0 55-59 36.4197 37.0 37.0 37.0 37.0 37.0 60-64 36.422 37.0 37.0 37.0 37.0 37.0 65-69 36.374399999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.3096 37.0 37.0 37.0 37.0 37.0 75-79 36.2989 37.0 37.0 37.0 37.0 37.0 80-84 36.280899999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.21 37.0 37.0 37.0 37.0 37.0 90-94 36.224000000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.266999999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.2017 37.0 37.0 37.0 37.0 37.0 105-109 36.112199999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.057900000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.0848 37.0 37.0 37.0 37.0 37.0 120-124 36.0617 37.0 37.0 37.0 37.0 37.0 125-129 35.9217 37.0 37.0 37.0 37.0 37.0 130-134 35.87479999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.831100000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.736399999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.6687 37.0 37.0 37.0 37.0 37.0 150-151 35.60825 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 0.0 21 1.0 22 1.0 23 0.0 24 2.0 25 2.0 26 4.0 27 5.0 28 9.0 29 14.0 30 23.0 31 31.0 32 48.0 33 68.0 34 120.0 35 359.0 36 2924.0 37 387.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.050000000000004 14.224999999999998 5.65 40.075 2 18.597022457734038 13.474640423921272 38.60711582134746 29.321221296997223 3 16.35 17.349999999999998 30.825000000000003 35.475 4 20.9 26.200000000000003 26.150000000000002 26.75 5 22.975 31.45 24.925 20.65 6 20.974999999999998 34.2 25.5 19.325 7 15.2 27.1 41.199999999999996 16.5 8 17.025000000000002 26.375 32.225 24.375 9 16.950000000000003 23.75 37.175000000000004 22.125 10-14 19.005 30.964999999999996 27.71 22.32 15-19 19.63 29.125 27.405 23.84 20-24 19.325 29.215000000000003 27.845 23.615 25-29 19.725 29.09 28.075 23.11 30-34 19.615 29.28 27.61 23.494999999999997 35-39 19.245 29.244999999999997 27.63 23.880000000000003 40-44 20.1 28.99 28.189999999999998 22.720000000000002 45-49 19.285 28.705000000000002 28.48 23.53 50-54 20.135 28.735 28.1 23.03 55-59 19.675 29.349999999999998 27.98 22.994999999999997 60-64 19.905 28.675 28.07 23.35 65-69 19.99 28.439999999999998 28.37 23.200000000000003 70-74 19.830000000000002 29.18 27.650000000000002 23.34 75-79 19.755 28.98 28.015 23.25 80-84 19.59 28.515 28.625 23.27 85-89 20.07 29.075 27.955000000000002 22.900000000000002 90-94 20.235 28.68 28.199999999999996 22.884999999999998 95-99 19.685 28.810000000000002 27.834999999999997 23.669999999999998 100-104 20.225 29.044999999999998 27.400000000000002 23.330000000000002 105-109 20.21 29.110000000000003 27.235 23.445 110-114 20.325 28.37 27.279999999999998 24.025 115-119 20.395 28.73 27.61 23.265 120-124 20.185 27.900000000000002 28.165000000000003 23.75 125-129 20.555 28.42 27.495000000000005 23.53 130-134 20.044999999999998 28.910000000000004 27.250000000000004 23.794999999999998 135-139 19.84 28.735 27.58 23.845 140-144 20.175 28.225 28.065 23.535 145-149 20.555 28.560000000000002 27.534999999999997 23.35 150-151 20.549999999999997 27.6375 27.55 24.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 2.0 18 1.5 19 1.0 20 1.0 21 4.5 22 5.0 23 2.5 24 7.5 25 9.0 26 11.0 27 17.5 28 17.0 29 18.0 30 23.5 31 35.0 32 44.0 33 58.5 34 69.5 35 83.5 36 100.5 37 126.0 38 148.0 39 174.0 40 199.5 41 209.0 42 247.5 43 263.5 44 255.5 45 250.5 46 232.5 47 227.5 48 217.5 49 182.5 50 153.5 51 130.5 52 108.5 53 88.5 54 69.5 55 50.5 56 35.5 57 28.0 58 21.0 59 17.5 60 12.0 61 9.0 62 9.5 63 5.5 64 4.0 65 2.5 66 2.5 67 1.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.9249999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.35 #Duplication Level Percentage of deduplicated Percentage of total 1 89.59149412423055 80.05 2 9.065472859541131 16.2 3 1.1751538891997761 3.15 4 0.16787912702853947 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.6000000000000001 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.3625 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 1.85 0.0 0.0 0.0 0.0 106-107 2.0875 0.0 0.0 0.0 0.0 108-109 2.4 0.0 0.0 0.0 0.0 110-111 2.675 0.0 0.0 0.0 0.0 112-113 3.1125 0.0 0.0 0.0 0.0 114-115 3.475 0.0 0.0 0.0 0.0 116-117 3.875 0.0 0.0 0.0 0.0 118-119 4.1625 0.0 0.0 0.0 0.0 120-121 4.575 0.0 0.0 0.0 0.0 122-123 4.9625 0.0 0.0 0.0 0.0 124-125 5.225 0.0 0.0 0.0 0.0 126-127 5.525 0.0 0.0 0.0 0.0 128-129 5.9 0.0 0.0 0.0 0.0 130-131 6.55 0.0 0.0 0.0 0.0 132-133 6.975 0.0 0.0 0.0 0.0 134-135 7.425000000000001 0.0 0.0 0.0 0.0 136-137 7.9375 0.0 0.0 0.0 0.0 138-139 8.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCGTC 10 0.0068343505 144.975 9 >>END_MODULE SRR12919314 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919314_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.265 37.0 37.0 37.0 37.0 37.0 2 36.1465 37.0 37.0 37.0 37.0 37.0 3 36.2325 37.0 37.0 37.0 37.0 37.0 4 36.2 37.0 37.0 37.0 37.0 37.0 5 36.3155 37.0 37.0 37.0 37.0 37.0 6 36.375 37.0 37.0 37.0 37.0 37.0 7 36.2005 37.0 37.0 37.0 37.0 37.0 8 36.2325 37.0 37.0 37.0 37.0 37.0 9 36.391 37.0 37.0 37.0 37.0 37.0 10-14 36.37310000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.2869 37.0 37.0 37.0 37.0 37.0 20-24 36.2658 37.0 37.0 37.0 37.0 37.0 25-29 36.249900000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.1842 37.0 37.0 37.0 37.0 37.0 35-39 36.153999999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.1094 37.0 37.0 37.0 37.0 37.0 45-49 36.12 37.0 37.0 37.0 37.0 37.0 50-54 36.0712 37.0 37.0 37.0 37.0 37.0 55-59 36.009100000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.0007 37.0 37.0 37.0 37.0 37.0 65-69 35.910799999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.928799999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.921200000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.8683 37.0 37.0 37.0 37.0 37.0 85-89 35.8752 37.0 37.0 37.0 37.0 37.0 90-94 35.797399999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.775099999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.7473 37.0 37.0 37.0 37.0 37.0 105-109 35.7386 37.0 37.0 37.0 37.0 37.0 110-114 35.6581 37.0 37.0 37.0 37.0 37.0 115-119 35.6647 37.0 37.0 37.0 37.0 37.0 120-124 35.557100000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.5468 37.0 37.0 37.0 37.0 37.0 130-134 35.4502 37.0 37.0 37.0 37.0 37.0 135-139 35.2256 37.0 37.0 37.0 27.4 37.0 140-144 35.2266 37.0 37.0 37.0 29.8 37.0 145-149 35.053000000000004 37.0 37.0 37.0 27.4 37.0 150-151 34.945750000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 3.0 16 0.0 17 2.0 18 1.0 19 3.0 20 1.0 21 4.0 22 2.0 23 6.0 24 4.0 25 4.0 26 9.0 27 12.0 28 14.0 29 21.0 30 21.0 31 42.0 32 75.0 33 123.0 34 207.0 35 575.0 36 2590.0 37 278.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.0 27.1 9.425 27.474999999999998 2 27.05 26.450000000000003 30.325000000000003 16.175 3 18.475 29.65 33.45 18.425 4 22.425 34.025 24.9 18.65 5 23.7 38.224999999999994 21.9 16.175 6 19.325 39.925 22.925 17.825 7 19.575 22.125 39.050000000000004 19.25 8 20.1 25.575 29.849999999999998 24.474999999999998 9 20.325 24.775 31.1 23.799999999999997 10-14 22.905 29.395 27.139999999999997 20.560000000000002 15-19 22.175 28.499999999999996 28.79 20.535 20-24 22.994999999999997 28.384999999999998 28.175 20.445 25-29 22.975 28.71 28.055000000000003 20.26 30-34 22.59 28.035 29.154999999999998 20.22 35-39 22.67 29.220000000000002 27.925 20.185 40-44 22.96 28.794999999999998 28.08 20.165 45-49 22.865 28.925 28.275 19.935 50-54 22.64 28.925 27.805000000000003 20.630000000000003 55-59 22.295 28.765 28.895 20.044999999999998 60-64 23.085 27.97 28.499999999999996 20.445 65-69 23.189999999999998 28.825 27.834999999999997 20.150000000000002 70-74 23.49 28.46 28.189999999999998 19.86 75-79 22.759999999999998 28.315 28.575 20.349999999999998 80-84 22.919999999999998 28.470000000000002 28.59 20.02 85-89 23.385 28.694999999999997 27.765 20.155 90-94 23.65 27.834999999999997 28.060000000000002 20.455000000000002 95-99 23.115 29.265 27.68 19.939999999999998 100-104 23.32 28.854999999999997 27.889999999999997 19.935 105-109 23.205000000000002 28.52 28.7 19.575 110-114 23.9 28.28 28.199999999999996 19.62 115-119 24.18 27.88 28.050000000000004 19.89 120-124 24.035 29.095 27.339999999999996 19.53 125-129 24.5 28.110000000000003 27.49 19.900000000000002 130-134 24.959999999999997 28.139999999999997 27.3 19.6 135-139 25.405 28.310000000000002 27.495000000000005 18.790000000000003 140-144 25.319999999999997 28.485 27.43 18.765 145-149 25.75 28.110000000000003 26.919999999999998 19.220000000000002 150-151 27.1 27.3625 26.700000000000003 18.8375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 1.0 15 1.0 16 1.5 17 1.5 18 0.5 19 1.5 20 3.0 21 5.0 22 3.5 23 2.5 24 6.5 25 9.0 26 12.0 27 17.5 28 18.0 29 20.0 30 30.0 31 37.5 32 43.0 33 65.0 34 77.0 35 76.0 36 91.5 37 116.0 38 155.0 39 186.0 40 202.5 41 232.0 42 261.0 43 251.5 44 259.0 45 266.5 46 246.5 47 235.0 48 202.0 49 162.5 50 136.5 51 119.0 52 94.5 53 78.0 54 66.0 55 50.5 56 35.5 57 24.0 58 21.5 59 19.5 60 10.5 61 5.0 62 7.0 63 5.5 64 5.0 65 4.0 66 2.0 67 2.5 68 2.0 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.425 #Duplication Level Percentage of deduplicated Percentage of total 1 89.62818003913894 80.15 2 9.057869723231757 16.2 3 1.1741682974559686 3.15 4 0.13978194017332962 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.36250000000000004 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.3375 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.825 0.0 0.0 0.0 0.0 106-107 2.0875 0.0 0.0 0.0 0.0 108-109 2.4 0.0 0.0 0.0 0.0 110-111 2.675 0.0 0.0 0.0 0.0 112-113 3.1125 0.0 0.0 0.0 0.0 114-115 3.475 0.0 0.0 0.0 0.0 116-117 3.9000000000000004 0.0 0.0 0.0 0.0 118-119 4.2125 0.0 0.0 0.0 0.0 120-121 4.625 0.0 0.0 0.0 0.0 122-123 5.0625 0.0 0.0 0.0 0.0 124-125 5.3125 0.0 0.0 0.0 0.0 126-127 5.6 0.0 0.0 0.0 0.0 128-129 5.975 0.0 0.0 0.0 0.0 130-131 6.625 0.0 0.0 0.0 0.0 132-133 7.025 0.0 0.0 0.0 0.0 134-135 7.5 0.0 0.0 0.0 0.0 136-137 8.0125 0.0 0.0 0.0 0.0 138-139 8.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAATTG 10 0.006830828 145.0 3 >>END_MODULE Read 1169584 spots for SRR12919314.sra Written 1169584 spots for SRR12919314.sra Read 1169584 spots for SRR12919314.sra Written 1169584 spots for SRR12919314.sra Read 1169584 spots for SRR12919314.sra Written 1169584 spots for SRR12919314.sra Read 1169584 spots for SRR12919314.sra Written 1169584 spots for SRR12919314.sra Read 1169584 spots for SRR12919314.sra Written 1169584 spots for SRR12919314.sra Read 1169584 spots for SRR12919314.sra Written 1169584 spots for SRR12919314.sra Read 1169584 spots for SRR12919314.sra Written 1169584 spots for SRR12919314.sra Read 1169584 spots for SRR12919314.sra Written 1169584 spots for SRR12919314.sra Read 1169584 spots for SRR12919314.sra Written 1169584 spots for SRR12919314.sra Read 1169584 spots for SRR12919314.sra Written 1169584 spots for SRR12919314.sra Read 1169584 spots for SRR12919314.sra Written 1169584 spots for SRR12919314.sra Read 1169584 spots for SRR12919314.sra Written 1169584 spots for SRR12919314.sra Read 1169584 spots for SRR12919314.sra Written 1169584 spots for SRR12919314.sra Read 1169584 spots for SRR12919314.sra Written 1169584 spots for SRR12919314.sra Read 1169584 spots for SRR12919314.sra Written 1169584 spots for SRR12919314.sra Read 1169584 spots for SRR12919314.sra Written 1169584 spots for SRR12919314.sra Read 1169584 spots for SRR12919314.sra Written 1169584 spots for SRR12919314.sra Read 1169585 spots for SRR12919314.sra Written 1169585 spots for SRR12919314.sra Read 1169584 spots for SRR12919314.sra Written 1169584 spots for SRR12919314.sra Read 1169584 spots for SRR12919314.sra Written 1169584 spots for SRR12919314.sra SRR ids: ['SRR12919314.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sa6y7yxn SRR12919314.sra spots: 23391681 blocks: [[1, 1169584], [1169585, 2339168], [2339169, 3508752], [3508753, 4678336], [4678337, 5847920], [5847921, 7017504], [7017505, 8187088], [8187089, 9356672], [9356673, 10526256], [10526257, 11695840], [11695841, 12865424], [12865425, 14035008], [14035009, 15204592], [15204593, 16374176], [16374177, 17543760], [17543761, 18713344], [18713345, 19882928], [19882929, 21052512], [21052513, 22222096], [22222097, 23391681]] SRR12919314 file size 7927816 SRR12919314 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919314 SRR12919314_1.fastq SRR12919314_2.fastq Input file: SRR12919314_1.fastq Paired file: SRR12919314_2.fastq trimmed: SRR12919314-trimmed-pair1.fastq, SRR12919314-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:51:31 2025 >> started Wed Feb 12 17:51:57 2025 >> done (26.376s) 23391681 read pairs processed; of these: 33 ( 0.00%) short read pairs filtered out after trimming by size control 240 ( 0.00%) empty read pairs filtered out after trimming by size control 23391408 (100.00%) read pairs available; of these: 3170591 (13.55%) trimmed read pairs available after processing 20220817 (86.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 1 0.00% 21 7 0.00% 22 6 0.00% 23 11 0.00% 24 12 0.00% 25 14 0.00% 26 10 0.00% 27 11 0.00% 28 9 0.00% 29 10 0.00% 30 15 0.00% 31 12 0.00% 32 14 0.00% 33 19 0.00% 34 17 0.00% 35 18 0.00% 36 20 0.00% 37 13 0.00% 38 27 0.00% 39 15 0.00% 40 19 0.00% 41 29 0.00% 42 38 0.00% 43 26 0.00% 44 47 0.00% 45 38 0.00% 46 47 0.00% 47 47 0.00% 48 46 0.00% 49 65 0.00% 50 106 0.00% 51 81 0.00% 52 84 0.00% 53 111 0.00% 54 115 0.00% 55 125 0.00% 56 140 0.00% 57 160 0.00% 58 188 0.00% 59 261 0.00% 60 213 0.00% 61 312 0.00% 62 375 0.00% 63 426 0.00% 64 497 0.00% 65 501 0.00% 66 593 0.00% 67 675 0.00% 68 722 0.00% 69 928 0.00% 70 1085 0.00% 71 1238 0.01% 72 1532 0.01% 73 1698 0.01% 74 1902 0.01% 75 2066 0.01% 76 2475 0.01% 77 2551 0.01% 78 2979 0.01% 79 3316 0.01% 80 3696 0.02% 81 4367 0.02% 82 5146 0.02% 83 5651 0.02% 84 6702 0.03% 85 7385 0.03% 86 7654 0.03% 87 8501 0.04% 88 8977 0.04% 89 9904 0.04% 90 10756 0.05% 91 12225 0.05% 92 13745 0.06% 93 14914 0.06% 94 16468 0.07% 95 17924 0.08% 96 18909 0.08% 97 19761 0.08% 98 20844 0.09% 99 21687 0.09% 100 23240 0.10% 101 24930 0.11% 102 26799 0.11% 103 28968 0.12% 104 30589 0.13% 105 32617 0.14% 106 33790 0.14% 107 34895 0.15% 108 36066 0.15% 109 36439 0.16% 110 37147 0.16% 111 39183 0.17% 112 41742 0.18% 113 43433 0.19% 114 45376 0.19% 115 47823 0.20% 116 48485 0.21% 117 49405 0.21% 118 50549 0.22% 119 50606 0.22% 120 51631 0.22% 121 52967 0.23% 122 54331 0.23% 123 57226 0.24% 124 58640 0.25% 125 60363 0.26% 126 62260 0.27% 127 63478 0.27% 128 62608 0.27% 129 62909 0.27% 130 64135 0.27% 131 64919 0.28% 132 66653 0.28% 133 68146 0.29% 134 69387 0.30% 135 71220 0.30% 136 72503 0.31% 137 72821 0.31% 138 73855 0.32% 139 73393 0.31% 140 73374 0.31% 141 74433 0.32% 142 75356 0.32% 143 77076 0.33% 144 78435 0.34% 145 79811 0.34% 146 80048 0.34% 147 81364 0.35% 148 80923 0.35% 149 80300 0.34% 150 80597 0.34% 151 20220817 86.45% 23391408 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=7.98 fanout-score-rank=27 prefix-density=0.19 prefix-fanout=4.3 sequence=TCCTTGTCCTGGATCTTGGCCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=457.95 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=34.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.40 fanout-score-rank=34 prefix-density=0.18 prefix-fanout=2.8 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=432.06 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=32.9 sequence=AAGAAGAAGAAG SRR12919314 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:52:50 Started mapping on | Feb 12 17:52:51 Finished on | Feb 12 17:59:29 Mapping speed, Million of reads per hour | 211.58 Number of input reads | 23391408 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 20335485 Uniquely mapped reads % | 86.94% Average mapped length | 293.83 Number of splices: Total | 19442637 Number of splices: Annotated (sjdb) | 18970775 Number of splices: GT/AG | 19094110 Number of splices: GC/AG | 268472 Number of splices: AT/AC | 21206 Number of splices: Non-canonical | 58849 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 517610 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 66391 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.37% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2538313 2538313 2538313 N_multimapping 517610 517610 517610 N_noFeature 824876 20096838 945414 N_ambiguous 238969 1599 119740 UnstrandedReadsAssigned:19271640 PositiveStrandReadsAssigned:237048 NegativeStrandReadsAssigned:19270331 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919314 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919314-trimmed-pair1.fastq SRR12919314-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,391,408 reads, 19,407,198 reads pseudoaligned [quant] estimated average fragment length: 250.536 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR12919314.ke.tsv 34699 SRR12919314.se.tsv 87100 total ==> SRR12919314.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.46 823 25.3869 Potri.005G024800.1.v4.1 1035 785.464 217 15.0709 Potri.004G059700.1.v4.1 961 711.566 35 2.68324 Potri.007G009000.2.v4.1 1416 1166.46 0 0 Potri.003G141000.2.v4.1 2943 2693.46 710.341 14.3867 Potri.016G087400.1.v4.1 270 91.2016 1593.47 953.12 Potri.015G069301.1.v4.1 564 328.036 0 0 Potri.010G195200.1.v4.1 1773 1523.46 111 3.97463 Potri.012G127500.1.v4.1 977 727.51 18602 1394.85 ==> SRR12919314.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 284 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 335 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 14 SRR12919314 completed mapping pipeline successfully