Starting /dee2/code/volunteer_pipeline.sh SRR12919315 current disk space = 3051290771456 free memory = 1576875784 SRR12919315 SRAfilesize 7a343602ef8b50336c4adfc8c24f0b68 SRR12919315.sra SRR12919315.sra file validated SRR12919315 is paired end SRR12919315 is conventional basespace SRR12919315 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919315_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.54 37.0 37.0 37.0 37.0 37.0 2 36.29275 37.0 37.0 37.0 37.0 37.0 3 36.6285 37.0 37.0 37.0 37.0 37.0 4 36.684 37.0 37.0 37.0 37.0 37.0 5 36.6315 37.0 37.0 37.0 37.0 37.0 6 36.569 37.0 37.0 37.0 37.0 37.0 7 36.594 37.0 37.0 37.0 37.0 37.0 8 36.661 37.0 37.0 37.0 37.0 37.0 9 36.678 37.0 37.0 37.0 37.0 37.0 10-14 36.67 37.0 37.0 37.0 37.0 37.0 15-19 36.638999999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.6105 37.0 37.0 37.0 37.0 37.0 25-29 36.5457 37.0 37.0 37.0 37.0 37.0 30-34 36.5224 37.0 37.0 37.0 37.0 37.0 35-39 36.553200000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.494800000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.4807 37.0 37.0 37.0 37.0 37.0 50-54 36.443599999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.4628 37.0 37.0 37.0 37.0 37.0 60-64 36.3952 37.0 37.0 37.0 37.0 37.0 65-69 36.394999999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3139 37.0 37.0 37.0 37.0 37.0 75-79 36.28789999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.3347 37.0 37.0 37.0 37.0 37.0 85-89 36.234899999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.224199999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.217499999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.19959999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.1207 37.0 37.0 37.0 37.0 37.0 110-114 36.039 37.0 37.0 37.0 37.0 37.0 115-119 36.0712 37.0 37.0 37.0 37.0 37.0 120-124 36.0389 37.0 37.0 37.0 37.0 37.0 125-129 36.017399999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.9529 37.0 37.0 37.0 37.0 37.0 135-139 35.8076 37.0 37.0 37.0 37.0 37.0 140-144 35.7234 37.0 37.0 37.0 37.0 37.0 145-149 35.6495 37.0 37.0 37.0 37.0 37.0 150-151 35.4105 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 3.0 24 0.0 25 4.0 26 3.0 27 13.0 28 7.0 29 24.0 30 22.0 31 29.0 32 34.0 33 63.0 34 128.0 35 327.0 36 2971.0 37 371.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.2 13.15 6.525 41.125 2 18.556701030927837 14.282122202665326 34.850389741010815 32.310787025396024 3 16.5 17.75 28.499999999999996 37.25 4 21.475 24.275 24.925 29.325000000000003 5 21.575 31.474999999999998 24.5 22.45 6 20.3 34.275 23.5 21.925 7 14.674999999999999 25.624999999999996 42.05 17.65 8 16.8 26.400000000000002 31.900000000000002 24.9 9 16.8 23.5 35.449999999999996 24.25 10-14 18.95 30.255 27.82 22.975 15-19 19.84 28.37 27.860000000000003 23.93 20-24 18.795 28.804999999999996 28.32 24.08 25-29 19.705000000000002 28.7 28.09 23.505000000000003 30-34 19.575 28.29 28.075 24.060000000000002 35-39 19.634999999999998 28.435 27.375 24.555 40-44 19.74 28.89 28.17 23.200000000000003 45-49 19.91 28.22 28.144999999999996 23.724999999999998 50-54 19.695 28.685 28.005000000000003 23.615 55-59 19.64 29.330000000000002 27.315 23.715 60-64 19.15 28.925 27.495000000000005 24.43 65-69 19.744999999999997 28.68 27.625 23.95 70-74 20.06 28.57 27.634999999999998 23.735 75-79 20.825 28.349999999999998 26.840000000000003 23.985 80-84 20.175 28.444999999999997 27.525 23.855 85-89 20.11 28.299999999999997 27.860000000000003 23.73 90-94 19.814999999999998 28.475 27.845 23.865 95-99 19.705000000000002 28.315 27.82 24.16 100-104 20.4 28.384999999999998 27.575 23.64 105-109 20.135 29.03 27.12 23.715 110-114 19.685 28.955 27.375 23.985 115-119 20.575 28.71 27.22 23.494999999999997 120-124 20.76 28.92 26.584999999999997 23.735 125-129 20.44 28.860000000000003 27.015 23.685000000000002 130-134 20.62 28.04 26.8 24.54 135-139 21.59 27.884999999999998 26.875 23.65 140-144 21.355 28.265 26.435 23.945 145-149 20.69 28.384999999999998 26.5 24.425 150-151 21.25 27.800000000000004 26.187500000000004 24.762500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 2.5 24 3.0 25 1.5 26 5.0 27 5.0 28 4.0 29 10.5 30 17.5 31 24.5 32 33.5 33 45.5 34 62.5 35 69.5 36 91.5 37 125.5 38 145.0 39 165.5 40 200.5 41 240.0 42 243.0 43 238.5 44 259.0 45 264.5 46 255.5 47 249.5 48 218.0 49 200.0 50 184.5 51 149.0 52 121.0 53 87.5 54 65.0 55 55.0 56 36.5 57 20.0 58 19.5 59 20.5 60 12.0 61 9.0 62 11.5 63 10.0 64 7.0 65 4.0 66 2.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.7 #Duplication Level Percentage of deduplicated Percentage of total 1 90.90407938257994 82.45 2 8.18632855567806 14.85 3 0.7993384785005513 2.175 4 0.08269018743109151 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.027563395810363836 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAAGTCGGAGGAATTGGACAATTTGTGCCCAGAACACCATCCTGCCAT 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.4500000000000002 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 2.0 0.0 0.0 0.0 0.0 104-105 2.2249999999999996 0.0 0.0 0.0 0.0 106-107 2.7 0.0 0.0 0.0 0.0 108-109 3.0 0.0 0.0 0.0 0.0 110-111 3.375 0.0 0.0 0.0 0.0 112-113 3.7875 0.0 0.0 0.0 0.0 114-115 4.2125 0.0 0.0 0.0 0.0 116-117 4.800000000000001 0.0 0.0 0.0 0.0 118-119 5.5 0.0 0.0 0.0 0.0 120-121 5.9875 0.0 0.0 0.0 0.0 122-123 6.4375 0.0 0.0 0.0 0.0 124-125 6.925 0.0 0.0 0.0 0.0 126-127 7.525 0.0 0.0 0.0 0.0 128-129 8.037500000000001 0.0 0.0 0.0 0.0 130-131 8.6125 0.0 0.0 0.0 0.0 132-133 9.25 0.0 0.0 0.0 0.0 134-135 9.9375 0.0 0.0 0.0 0.0 136-137 10.475 0.0 0.0 0.0 0.0 138-139 11.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAAAT 10 0.006830828 145.0 2 >>END_MODULE SRR12919315 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919315_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0895 37.0 37.0 37.0 37.0 37.0 2 36.074 37.0 37.0 37.0 37.0 37.0 3 36.1425 37.0 37.0 37.0 37.0 37.0 4 36.14 37.0 37.0 37.0 37.0 37.0 5 36.271 37.0 37.0 37.0 37.0 37.0 6 36.304 37.0 37.0 37.0 37.0 37.0 7 36.2785 37.0 37.0 37.0 37.0 37.0 8 36.2095 37.0 37.0 37.0 37.0 37.0 9 36.234 37.0 37.0 37.0 37.0 37.0 10-14 36.2749 37.0 37.0 37.0 37.0 37.0 15-19 36.217 37.0 37.0 37.0 37.0 37.0 20-24 36.2156 37.0 37.0 37.0 37.0 37.0 25-29 36.129000000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.1002 37.0 37.0 37.0 37.0 37.0 35-39 36.096799999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.0504 37.0 37.0 37.0 37.0 37.0 45-49 36.032 37.0 37.0 37.0 37.0 37.0 50-54 36.0222 37.0 37.0 37.0 37.0 37.0 55-59 35.96500000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.9618 37.0 37.0 37.0 37.0 37.0 65-69 35.9462 37.0 37.0 37.0 37.0 37.0 70-74 35.896499999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.8061 37.0 37.0 37.0 37.0 37.0 80-84 35.8019 37.0 37.0 37.0 37.0 37.0 85-89 35.848200000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.8034 37.0 37.0 37.0 37.0 37.0 95-99 35.7418 37.0 37.0 37.0 37.0 37.0 100-104 35.6783 37.0 37.0 37.0 37.0 37.0 105-109 35.6682 37.0 37.0 37.0 37.0 37.0 110-114 35.63799999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.6616 37.0 37.0 37.0 37.0 37.0 120-124 35.5349 37.0 37.0 37.0 37.0 37.0 125-129 35.5021 37.0 37.0 37.0 37.0 37.0 130-134 35.3769 37.0 37.0 37.0 37.0 37.0 135-139 35.19789999999999 37.0 37.0 37.0 32.2 37.0 140-144 35.06570000000001 37.0 37.0 37.0 27.4 37.0 145-149 34.9101 37.0 37.0 37.0 25.0 37.0 150-151 34.7965 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 1.0 15 4.0 16 1.0 17 1.0 18 3.0 19 2.0 20 3.0 21 3.0 22 6.0 23 5.0 24 8.0 25 9.0 26 8.0 27 6.0 28 11.0 29 25.0 30 25.0 31 35.0 32 54.0 33 110.0 34 244.0 35 621.0 36 2588.0 37 221.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.699999999999996 23.599999999999998 10.125 24.575 2 28.349999999999998 24.8 31.0 15.85 3 20.25 27.325 33.475 18.95 4 23.974999999999998 34.1 24.474999999999998 17.45 5 25.374999999999996 36.449999999999996 21.925 16.25 6 21.099999999999998 38.0 23.3 17.599999999999998 7 21.0 22.575 37.574999999999996 18.85 8 21.675 25.55 29.075 23.7 9 21.4 25.174999999999997 30.4 23.025000000000002 10-14 23.799999999999997 29.23 26.119999999999997 20.849999999999998 15-19 23.724999999999998 28.335 27.3 20.64 20-24 23.455000000000002 28.055000000000003 27.425 21.065 25-29 23.36 28.439999999999998 27.615000000000002 20.585 30-34 23.415 28.17 27.71 20.705000000000002 35-39 23.78 27.485 28.084999999999997 20.65 40-44 23.810000000000002 28.110000000000003 27.644999999999996 20.435 45-49 23.995 27.315 28.194999999999997 20.495 50-54 23.669999999999998 28.13 27.715 20.485 55-59 23.16 28.21 27.76 20.87 60-64 23.724999999999998 27.62 28.16 20.495 65-69 23.66 28.46 27.47 20.41 70-74 23.419999999999998 28.65 27.785 20.145 75-79 23.655 27.800000000000004 27.894999999999996 20.65 80-84 23.549999999999997 28.044999999999998 27.82 20.585 85-89 24.25 27.63 28.555000000000003 19.564999999999998 90-94 23.765 28.645 27.455000000000002 20.135 95-99 23.18 28.595 27.450000000000003 20.775 100-104 24.035 27.985 27.555000000000003 20.424999999999997 105-109 24.345 27.975 27.950000000000003 19.73 110-114 24.915000000000003 27.889999999999997 27.065 20.13 115-119 25.674999999999997 27.51 27.38 19.435 120-124 25.055 28.075 27.235 19.634999999999998 125-129 25.345000000000002 28.04 27.215 19.400000000000002 130-134 25.855 27.500000000000004 27.089999999999996 19.555 135-139 26.255 27.565 26.895000000000003 19.285 140-144 26.265 28.294999999999998 26.56 18.88 145-149 27.334999999999997 26.76 27.145000000000003 18.759999999999998 150-151 27.1375 26.5875 27.487499999999997 18.787499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.0 20 1.0 21 1.5 22 1.0 23 2.0 24 3.0 25 2.5 26 5.0 27 7.0 28 6.5 29 10.5 30 16.5 31 22.0 32 27.5 33 36.5 34 45.5 35 59.0 36 85.5 37 109.0 38 127.5 39 163.5 40 202.5 41 228.5 42 257.0 43 273.5 44 266.5 45 273.5 46 271.5 47 257.5 48 255.0 49 204.5 50 148.5 51 130.0 52 116.0 53 88.0 54 69.0 55 54.5 56 32.5 57 25.5 58 27.5 59 21.0 60 10.5 61 9.0 62 6.5 63 7.0 64 5.5 65 2.0 66 1.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 1.0 73 1.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.5 88 1.0 89 0.5 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.2 #Duplication Level Percentage of deduplicated Percentage of total 1 91.50219298245614 83.45 2 7.593201754385964 13.850000000000001 3 0.7949561403508772 2.175 4 0.08223684210526315 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.027412280701754384 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCTATCTTACATCACTGTCTCTCCTCTTGGTGTTCCTCAAAAGGTTATA 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.4500000000000002 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 2.0 0.0 0.0 0.0 0.0 104-105 2.2249999999999996 0.0 0.0 0.0 0.0 106-107 2.7 0.0 0.0 0.0 0.0 108-109 3.0 0.0 0.0 0.0 0.0 110-111 3.375 0.0 0.0 0.0 0.0 112-113 3.7875 0.0 0.0 0.0 0.0 114-115 4.2125 0.0 0.0 0.0 0.0 116-117 4.8125 0.0 0.0 0.0 0.0 118-119 5.5125 0.0 0.0 0.0 0.0 120-121 6.0125 0.0 0.0 0.0 0.0 122-123 6.4875 0.0 0.0 0.0 0.0 124-125 6.95 0.0 0.0 0.0 0.0 126-127 7.550000000000001 0.0 0.0 0.0 0.0 128-129 8.075 0.0 0.0 0.0 0.0 130-131 8.662500000000001 0.0 0.0 0.0 0.0 132-133 9.275 0.0 0.0 0.0 0.0 134-135 9.962499999999999 0.0 0.0 0.0 0.0 136-137 10.5125 0.0 0.0 0.0 0.0 138-139 11.212499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAACAA 10 0.006830828 145.0 2 >>END_MODULE Read 1022077 spots for SRR12919315.sra Written 1022077 spots for SRR12919315.sra Read 1022077 spots for SRR12919315.sra Written 1022077 spots for SRR12919315.sra Read 1022077 spots for SRR12919315.sra Written 1022077 spots for SRR12919315.sra Read 1022077 spots for SRR12919315.sra Written 1022077 spots for SRR12919315.sra Read 1022077 spots for SRR12919315.sra Written 1022077 spots for SRR12919315.sra Read 1022077 spots for SRR12919315.sra Written 1022077 spots for SRR12919315.sra Read 1022077 spots for SRR12919315.sra Written 1022077 spots for SRR12919315.sra Read 1022077 spots for SRR12919315.sra Written 1022077 spots for SRR12919315.sra Read 1022077 spots for SRR12919315.sra Written 1022077 spots for SRR12919315.sra Read 1022081 spots for SRR12919315.sra Written 1022081 spots for SRR12919315.sra Read 1022077 spots for SRR12919315.sra Written 1022077 spots for SRR12919315.sra Read 1022077 spots for SRR12919315.sra Written 1022077 spots for SRR12919315.sra Read 1022077 spots for SRR12919315.sra Written 1022077 spots for SRR12919315.sra Read 1022077 spots for SRR12919315.sra Written 1022077 spots for SRR12919315.sra Read 1022077 spots for SRR12919315.sra Written 1022077 spots for SRR12919315.sra Read 1022077 spots for SRR12919315.sra Written 1022077 spots for SRR12919315.sra Read 1022077 spots for SRR12919315.sra Written 1022077 spots for SRR12919315.sra Read 1022077 spots for SRR12919315.sra Written 1022077 spots for SRR12919315.sra Read 1022077 spots for SRR12919315.sra Written 1022077 spots for SRR12919315.sra Read 1022077 spots for SRR12919315.sra Written 1022077 spots for SRR12919315.sra SRR ids: ['SRR12919315.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z_yzegg1 SRR12919315.sra spots: 20441544 blocks: [[1, 1022077], [1022078, 2044154], [2044155, 3066231], [3066232, 4088308], [4088309, 5110385], [5110386, 6132462], [6132463, 7154539], [7154540, 8176616], [8176617, 9198693], [9198694, 10220770], [10220771, 11242847], [11242848, 12264924], [12264925, 13287001], [13287002, 14309078], [14309079, 15331155], [15331156, 16353232], [16353233, 17375309], [17375310, 18397386], [18397387, 19419463], [19419464, 20441544]] SRR12919315 file size 6925230 SRR12919315 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919315 SRR12919315_1.fastq SRR12919315_2.fastq Input file: SRR12919315_1.fastq Paired file: SRR12919315_2.fastq trimmed: SRR12919315-trimmed-pair1.fastq, SRR12919315-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:36:36 2025 >> started Wed Feb 12 18:36:58 2025 >> done (21.766s) 20441544 read pairs processed; of these: 22 ( 0.00%) short read pairs filtered out after trimming by size control 5444 ( 0.03%) empty read pairs filtered out after trimming by size control 20436078 (99.97%) read pairs available; of these: 3313536 (16.21%) trimmed read pairs available after processing 17122542 (83.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 2 0.00% 24 7 0.00% 25 6 0.00% 26 6 0.00% 27 5 0.00% 28 4 0.00% 29 10 0.00% 30 17 0.00% 31 9 0.00% 32 9 0.00% 33 14 0.00% 34 13 0.00% 35 13 0.00% 36 14 0.00% 37 16 0.00% 38 24 0.00% 39 18 0.00% 40 17 0.00% 41 27 0.00% 42 25 0.00% 43 36 0.00% 44 38 0.00% 45 37 0.00% 46 42 0.00% 47 63 0.00% 48 68 0.00% 49 52 0.00% 50 90 0.00% 51 89 0.00% 52 116 0.00% 53 121 0.00% 54 146 0.00% 55 132 0.00% 56 172 0.00% 57 197 0.00% 58 231 0.00% 59 284 0.00% 60 333 0.00% 61 486 0.00% 62 487 0.00% 63 514 0.00% 64 581 0.00% 65 621 0.00% 66 716 0.00% 67 779 0.00% 68 986 0.00% 69 1174 0.01% 70 1353 0.01% 71 1588 0.01% 72 1930 0.01% 73 2164 0.01% 74 2452 0.01% 75 2711 0.01% 76 2893 0.01% 77 3179 0.02% 78 3575 0.02% 79 4126 0.02% 80 4699 0.02% 81 5485 0.03% 82 6486 0.03% 83 7079 0.03% 84 8176 0.04% 85 8797 0.04% 86 9267 0.05% 87 10350 0.05% 88 11123 0.05% 89 12006 0.06% 90 13421 0.07% 91 14696 0.07% 92 16387 0.08% 93 17766 0.09% 94 19842 0.10% 95 21200 0.10% 96 22168 0.11% 97 23053 0.11% 98 23864 0.12% 99 25448 0.12% 100 27115 0.13% 101 28924 0.14% 102 31189 0.15% 103 33183 0.16% 104 34956 0.17% 105 36598 0.18% 106 37865 0.19% 107 38556 0.19% 108 39643 0.19% 109 40445 0.20% 110 41364 0.20% 111 43380 0.21% 112 45393 0.22% 113 47563 0.23% 114 49348 0.24% 115 51445 0.25% 116 52091 0.25% 117 52876 0.26% 118 53665 0.26% 119 53534 0.26% 120 55181 0.27% 121 56002 0.27% 122 57208 0.28% 123 60008 0.29% 124 61665 0.30% 125 62898 0.31% 126 64451 0.32% 127 65186 0.32% 128 64597 0.32% 129 65140 0.32% 130 65632 0.32% 131 65901 0.32% 132 67620 0.33% 133 69796 0.34% 134 69991 0.34% 135 72558 0.36% 136 73010 0.36% 137 73273 0.36% 138 72846 0.36% 139 73028 0.36% 140 72216 0.35% 141 72843 0.36% 142 73838 0.36% 143 75175 0.37% 144 77503 0.38% 145 79004 0.39% 146 78060 0.38% 147 79113 0.39% 148 78637 0.38% 149 77956 0.38% 150 77926 0.38% 151 17122542 83.79% 20436078 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=6.32 fanout-score-rank=20 prefix-density=0.21 prefix-fanout=4.2 sequence=CAATTTTCTCAATAGCTGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=10 fanout-score=333.31 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=33.9 sequence=CTTCTTCTTGAG criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=12.71 fanout-score-rank=16 prefix-density=0.37 prefix-fanout=6.5 sequence=TTTGACAAGAAGCAGTTTCTTACACAGATTAAGAAATTTATCAAGAATCTGTCGGAGAAACTTGATGAGGACCAGAAGGAACATTTTAGAAAGAACATTGAGGGAGCAACCAAGTTCTTGCTTTCAAAAATCAAGGACTTGCAATTCTTTGTGGGGGAGAGCATGCATGATGATGGTTGTTTGGTCTTTGCTTATTACAAAGAAGGTGCTACCGATCCAACATTCTTGTACTTTGCCCCTTCTTTGAAGGAGGTCAAGTGCTGAAGAGTGCCAATAGCTGGCCTTGATGTGCAAGTGCTAGCTTTATTAGTTTTAGTTTTATCCTTGAATGCTTTGCTATCTTTTGTTCTGGTGGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=341.17 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=13.8 sequence=AGAGAAAAGATAAGCTAGGCAAGATGGTTTTACTAGACAAGATGTGGGATGATGTTGTTGCTGGACCTCAGCCAGAACGTGGCCTTGGCAAGCTTAGAAAGATCAGCACCAGACCACTTAACATCAAAGATATTGACGTCGGAGAGGGGAGCAGTCCTGTTAATAAGTTTCAGAGGTCCATGACTATGCCAGGAACTCCAGGGACACCGACGACACCAGTGACCCCTACAACCCCAGTGTCGGCGCGTAGCAATGTTTGGAGGAGCGTGTTCCACCCTGGTAGCAACCTTGCTACTAAGAATATTGGTGCTCATGTTTTTGACAAGCCACAGCCTAACACACCCACTGTCTATGACTGGATGTACAGTGGAGAGACGAAGAGCGAGCATCGTTGATGAGGTTGCCTTCAACCAAGGTTGCCCATGTAAATACGTACTGTGTTTTGTTTTTCAGTACTCATCTGCAATATGTCTCTTGTTGTTATGGTTCTACGGTTCTACCGTGCCTGGAA SRR12919315 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:37:42 Started mapping on | Feb 12 18:37:42 Finished on | Feb 12 18:40:30 Mapping speed, Million of reads per hour | 437.92 Number of input reads | 20436078 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 18974685 Uniquely mapped reads % | 92.85% Average mapped length | 292.21 Number of splices: Total | 17318656 Number of splices: Annotated (sjdb) | 16903534 Number of splices: GT/AG | 16995890 Number of splices: GC/AG | 248121 Number of splices: AT/AC | 22105 Number of splices: Non-canonical | 52540 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 524281 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 84078 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.03% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 937112 937112 937112 N_multimapping 524281 524281 524281 N_noFeature 756707 18715688 876777 N_ambiguous 245603 1224 106047 UnstrandedReadsAssigned:17972375 PositiveStrandReadsAssigned:257773 NegativeStrandReadsAssigned:17991861 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919315 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919315-trimmed-pair1.fastq SRR12919315-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,436,078 reads, 18,147,220 reads pseudoaligned [quant] estimated average fragment length: 240.172 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52401 SRR12919315.ke.tsv 34699 SRR12919315.se.tsv 87100 total ==> SRR12919315.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.83 963 29.6783 Potri.005G024800.1.v4.1 1035 795.828 337 23.2144 Potri.004G059700.1.v4.1 961 721.886 107 8.12571 Potri.007G009000.2.v4.1 1416 1176.83 0 0 Potri.003G141000.2.v4.1 2943 2703.83 542.535 11 Potri.016G087400.1.v4.1 270 95.3358 1576 906.246 Potri.015G069301.1.v4.1 564 336.146 0 0 Potri.010G195200.1.v4.1 1773 1533.83 105 3.75283 Potri.012G127500.1.v4.1 977 737.876 13593 1009.9 ==> SRR12919315.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 418 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 376 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 47 SRR12919315 completed mapping pipeline successfully