Starting /dee2/code/volunteer_pipeline.sh SRR12919316 current disk space = 3051585159168 free memory = 1488820700 SRR12919316 SRAfilesize eef1fe0da72b54861a458bff66041b57 SRR12919316.sra SRR12919316.sra file validated SRR12919316 is paired end SRR12919316 is conventional basespace SRR12919316 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919316_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.501 37.0 37.0 37.0 37.0 37.0 2 36.159 37.0 37.0 37.0 37.0 37.0 3 36.554 37.0 37.0 37.0 37.0 37.0 4 36.6245 37.0 37.0 37.0 37.0 37.0 5 36.6235 37.0 37.0 37.0 37.0 37.0 6 36.694 37.0 37.0 37.0 37.0 37.0 7 36.6395 37.0 37.0 37.0 37.0 37.0 8 36.692 37.0 37.0 37.0 37.0 37.0 9 36.6635 37.0 37.0 37.0 37.0 37.0 10-14 36.6387 37.0 37.0 37.0 37.0 37.0 15-19 36.6272 37.0 37.0 37.0 37.0 37.0 20-24 36.587199999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.5702 37.0 37.0 37.0 37.0 37.0 30-34 36.5736 37.0 37.0 37.0 37.0 37.0 35-39 36.545 37.0 37.0 37.0 37.0 37.0 40-44 36.535199999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.5161 37.0 37.0 37.0 37.0 37.0 50-54 36.4708 37.0 37.0 37.0 37.0 37.0 55-59 36.4893 37.0 37.0 37.0 37.0 37.0 60-64 36.419 37.0 37.0 37.0 37.0 37.0 65-69 36.412099999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.4063 37.0 37.0 37.0 37.0 37.0 75-79 36.347699999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.34310000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.287200000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.2645 37.0 37.0 37.0 37.0 37.0 95-99 36.281299999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.291700000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.22089999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.129200000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.134699999999995 37.0 37.0 37.0 37.0 37.0 120-124 36.104499999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.9938 37.0 37.0 37.0 37.0 37.0 130-134 35.9524 37.0 37.0 37.0 37.0 37.0 135-139 35.96039999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.8661 37.0 37.0 37.0 37.0 37.0 145-149 35.8866 37.0 37.0 37.0 37.0 37.0 150-151 35.76325 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 2.0 26 2.0 27 3.0 28 9.0 29 14.0 30 25.0 31 35.0 32 45.0 33 52.0 34 117.0 35 286.0 36 3006.0 37 402.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.1 11.825 7.124999999999999 44.95 2 18.305597579425115 15.052950075642965 35.854765506807865 30.786686838124055 3 17.625 17.375 27.3 37.7 4 20.575 24.375 24.95 30.099999999999998 5 21.2 31.175000000000004 25.7 21.925 6 19.55 35.25 23.45 21.75 7 14.325 28.975 40.675 16.025 8 17.7 24.85 31.674999999999997 25.775 9 17.150000000000002 23.799999999999997 34.225 24.825 10-14 19.18 30.36 27.555000000000003 22.905 15-19 19.16 28.765 27.950000000000003 24.125 20-24 19.064999999999998 29.265 28.18 23.49 25-29 19.36 29.459999999999997 27.605 23.575 30-34 19.6 28.82 27.939999999999998 23.64 35-39 20.01 28.355000000000004 27.675 23.96 40-44 19.305 29.354999999999997 27.725 23.615 45-49 20.119999999999997 28.325 27.73 23.825 50-54 20.225 28.375 27.815 23.585 55-59 19.96 27.955000000000002 28.365000000000002 23.72 60-64 19.84 28.194999999999997 27.68 24.285 65-69 19.835 28.849999999999998 28.03 23.285 70-74 20.225 28.895 27.075 23.805 75-79 20.645 28.065 28.175 23.115 80-84 20.200000000000003 28.98 27.145000000000003 23.674999999999997 85-89 20.225 28.51 28.035 23.23 90-94 19.17 29.049999999999997 27.79 23.990000000000002 95-99 20.22 28.715000000000003 27.255000000000003 23.810000000000002 100-104 20.3 28.79 27.465 23.445 105-109 20.05 28.610000000000003 27.400000000000002 23.94 110-114 20.105 28.535 28.065 23.294999999999998 115-119 20.375 27.894999999999996 27.735 23.995 120-124 20.69 28.595 26.834999999999997 23.880000000000003 125-129 20.630000000000003 28.685 27.245 23.44 130-134 20.46 28.194999999999997 27.33 24.015 135-139 20.135 27.584999999999997 27.655 24.625 140-144 20.53 28.375 27.705000000000002 23.39 145-149 20.72 28.799999999999997 27.16 23.32 150-151 20.549999999999997 27.9125 28.025 23.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 2.0 24 4.0 25 6.5 26 7.0 27 8.0 28 11.0 29 13.0 30 22.5 31 31.5 32 43.0 33 50.5 34 49.5 35 62.5 36 96.5 37 119.5 38 124.5 39 140.5 40 166.5 41 212.5 42 256.0 43 266.5 44 270.0 45 283.5 46 268.0 47 244.0 48 236.5 49 204.0 50 175.5 51 151.0 52 113.0 53 92.0 54 73.5 55 51.5 56 39.0 57 29.0 58 17.0 59 12.0 60 13.0 61 13.5 62 7.5 63 1.5 64 2.0 65 2.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.8500000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.85382702403979 82.19999999999999 2 7.95799944736115 14.399999999999999 3 1.0223818734457033 2.775 4 0.13815971262779772 0.5 5 0.027631942525559547 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCTCCTTTCCGCCACCTTTCTGTTTGACATCTTGCTCGTCATCAATGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.2000000000000002 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.7375 0.0 0.0 0.0 0.0 116-117 1.9749999999999999 0.0 0.0 0.0 0.0 118-119 2.375 0.0 0.0 0.0 0.0 120-121 2.7375 0.0 0.0 0.0 0.0 122-123 2.975 0.0 0.0 0.0 0.0 124-125 3.3499999999999996 0.0 0.0 0.0 0.0 126-127 3.7 0.0 0.0 0.0 0.0 128-129 3.8875 0.0 0.0 0.0 0.0 130-131 4.2125 0.0 0.0 0.0 0.0 132-133 4.475 0.0 0.0 0.0 0.0 134-135 4.8875 0.0 0.0 0.0 0.0 136-137 5.3125 0.0 0.0 0.0 0.0 138-139 5.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919316 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919316_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.268 37.0 37.0 37.0 37.0 37.0 2 36.127 37.0 37.0 37.0 37.0 37.0 3 36.283 37.0 37.0 37.0 37.0 37.0 4 36.235 37.0 37.0 37.0 37.0 37.0 5 36.309 37.0 37.0 37.0 37.0 37.0 6 36.3065 37.0 37.0 37.0 37.0 37.0 7 36.155 37.0 37.0 37.0 37.0 37.0 8 36.4155 37.0 37.0 37.0 37.0 37.0 9 36.2925 37.0 37.0 37.0 37.0 37.0 10-14 36.37779999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.294200000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.2692 37.0 37.0 37.0 37.0 37.0 25-29 36.1993 37.0 37.0 37.0 37.0 37.0 30-34 36.197500000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.2301 37.0 37.0 37.0 37.0 37.0 40-44 36.0896 37.0 37.0 37.0 37.0 37.0 45-49 36.175599999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.12760000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.0477 37.0 37.0 37.0 37.0 37.0 60-64 35.9874 37.0 37.0 37.0 37.0 37.0 65-69 35.9803 37.0 37.0 37.0 37.0 37.0 70-74 35.972500000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.8913 37.0 37.0 37.0 37.0 37.0 80-84 35.8903 37.0 37.0 37.0 37.0 37.0 85-89 35.8478 37.0 37.0 37.0 37.0 37.0 90-94 35.7864 37.0 37.0 37.0 37.0 37.0 95-99 35.82149999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.7282 37.0 37.0 37.0 37.0 37.0 105-109 35.6721 37.0 37.0 37.0 37.0 37.0 110-114 35.7014 37.0 37.0 37.0 37.0 37.0 115-119 35.673899999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.632600000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.6603 37.0 37.0 37.0 37.0 37.0 130-134 35.5033 37.0 37.0 37.0 37.0 37.0 135-139 35.396699999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.4096 37.0 37.0 37.0 34.6 37.0 145-149 35.3324 37.0 37.0 37.0 34.6 37.0 150-151 35.184 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 2.0 16 0.0 17 2.0 18 0.0 19 2.0 20 3.0 21 5.0 22 3.0 23 5.0 24 6.0 25 7.0 26 8.0 27 8.0 28 13.0 29 24.0 30 24.0 31 47.0 32 40.0 33 111.0 34 211.0 35 562.0 36 2676.0 37 240.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.675000000000004 24.2 11.55 28.575 2 26.1 27.525 30.775000000000002 15.6 3 21.45 28.675 31.35 18.525 4 22.650000000000002 34.575 23.775 19.0 5 24.9 36.575 21.375 17.150000000000002 6 20.724999999999998 39.4 23.125 16.75 7 20.0 22.825 38.925 18.25 8 21.099999999999998 26.674999999999997 28.000000000000004 24.224999999999998 9 21.8 26.224999999999998 29.7 22.275 10-14 22.900000000000002 29.349999999999998 26.405 21.345 15-19 23.22 28.28 27.77 20.73 20-24 22.955000000000002 28.67 27.525 20.849999999999998 25-29 22.915 28.175 27.839999999999996 21.07 30-34 22.830000000000002 28.494999999999997 28.21 20.465 35-39 22.509999999999998 27.915 28.48 21.095 40-44 23.03 27.97 28.225 20.775 45-49 22.455 28.299999999999997 28.29 20.955 50-54 23.315 27.73 28.32 20.635 55-59 23.46 27.905 27.860000000000003 20.775 60-64 22.895 28.24 28.225 20.64 65-69 23.415 28.249999999999996 28.025 20.31 70-74 23.51 27.765 28.525 20.200000000000003 75-79 23.935000000000002 28.205000000000002 27.875 19.985 80-84 23.674999999999997 28.189999999999998 27.834999999999997 20.3 85-89 23.285 28.025 28.315 20.375 90-94 23.305 28.585 28.035 20.075000000000003 95-99 23.515 27.889999999999997 28.27 20.325 100-104 23.49 28.17 27.894999999999996 20.445 105-109 23.630000000000003 28.044999999999998 27.735 20.59 110-114 24.255 28.62 27.33 19.794999999999998 115-119 24.335 28.01 27.765 19.89 120-124 23.595 28.225 27.689999999999998 20.49 125-129 23.955000000000002 29.110000000000003 26.924999999999997 20.01 130-134 24.215 28.345 27.250000000000004 20.19 135-139 25.095 28.134999999999998 27.375 19.395 140-144 25.44 28.255000000000003 27.045 19.259999999999998 145-149 25.44 27.905 26.555 20.1 150-151 25.2625 27.85 27.1625 19.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.5 10 1.0 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.0 21 1.5 22 3.0 23 3.0 24 3.5 25 5.0 26 3.0 27 5.0 28 10.5 29 14.5 30 19.5 31 26.0 32 30.0 33 38.5 34 57.5 35 69.5 36 90.5 37 112.5 38 136.0 39 161.0 40 183.5 41 223.5 42 254.0 43 270.0 44 291.0 45 291.0 46 287.5 47 264.0 48 232.5 49 209.0 50 161.5 51 131.5 52 98.5 53 69.5 54 59.0 55 41.5 56 29.0 57 27.0 58 19.0 59 12.5 60 9.5 61 6.5 62 6.0 63 7.5 64 6.0 65 1.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.5 97 0.5 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.625 #Duplication Level Percentage of deduplicated Percentage of total 1 90.95172413793104 82.425 2 8.027586206896551 14.549999999999999 3 0.7724137931034483 2.1 4 0.2206896551724138 0.8 5 0.027586206896551724 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCGCTTCCAGCTCACAACAAAAGCAGTGGAGAAAGATCCATCGAGACAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.475 0.0 0.0 0.0 0.0 120-121 2.8625 0.0 0.0 0.0 0.0 122-123 3.1 0.0 0.0 0.0 0.0 124-125 3.4749999999999996 0.0 0.0 0.0 0.0 126-127 3.825 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.3625 0.0 0.0 0.0 0.0 132-133 4.65 0.0 0.0 0.0 0.0 134-135 5.0625 0.0 0.0 0.0 0.0 136-137 5.4875 0.0 0.0 0.0 0.0 138-139 5.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCCTA 10 0.006830828 145.0 5 >>END_MODULE Read 993700 spots for SRR12919316.sra Written 993700 spots for SRR12919316.sra Read 993700 spots for SRR12919316.sra Written 993700 spots for SRR12919316.sra Read 993700 spots for SRR12919316.sra Written 993700 spots for SRR12919316.sra Read 993700 spots for SRR12919316.sra Written 993700 spots for SRR12919316.sra Read 993700 spots for SRR12919316.sra Written 993700 spots for SRR12919316.sra Read 993700 spots for SRR12919316.sra Written 993700 spots for SRR12919316.sra Read 993700 spots for SRR12919316.sra Written 993700 spots for SRR12919316.sra Read 993700 spots for SRR12919316.sra Written 993700 spots for SRR12919316.sra Read 993700 spots for SRR12919316.sra Written 993700 spots for SRR12919316.sra Read 993700 spots for SRR12919316.sra Written 993700 spots for SRR12919316.sra Read 993700 spots for SRR12919316.sra Written 993700 spots for SRR12919316.sra Read 993700 spots for SRR12919316.sra Written 993700 spots for SRR12919316.sra Read 993700 spots for SRR12919316.sra Written 993700 spots for SRR12919316.sra Read 993700 spots for SRR12919316.sra Written 993700 spots for SRR12919316.sra Read 993700 spots for SRR12919316.sra Written 993700 spots for SRR12919316.sra Read 993711 spots for SRR12919316.sra Written 993711 spots for SRR12919316.sra Read 993700 spots for SRR12919316.sra Written 993700 spots for SRR12919316.sra Read 993700 spots for SRR12919316.sra Written 993700 spots for SRR12919316.sra Read 993700 spots for SRR12919316.sra Written 993700 spots for SRR12919316.sra Read 993700 spots for SRR12919316.sra Written 993700 spots for SRR12919316.sra SRR ids: ['SRR12919316.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z0_syqyz SRR12919316.sra spots: 19874011 blocks: [[1, 993700], [993701, 1987400], [1987401, 2981100], [2981101, 3974800], [3974801, 4968500], [4968501, 5962200], [5962201, 6955900], [6955901, 7949600], [7949601, 8943300], [8943301, 9937000], [9937001, 10930700], [10930701, 11924400], [11924401, 12918100], [12918101, 13911800], [13911801, 14905500], [14905501, 15899200], [15899201, 16892900], [16892901, 17886600], [17886601, 18880300], [18880301, 19874011]] SRR12919316 file size 6732358 SRR12919316 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919316 SRR12919316_1.fastq SRR12919316_2.fastq Input file: SRR12919316_1.fastq Paired file: SRR12919316_2.fastq trimmed: SRR12919316-trimmed-pair1.fastq, SRR12919316-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:57:27 2025 >> started Wed Feb 12 17:57:51 2025 >> done (23.873s) 19874011 read pairs processed; of these: 22 ( 0.00%) short read pairs filtered out after trimming by size control 398 ( 0.00%) empty read pairs filtered out after trimming by size control 19873591 (100.00%) read pairs available; of these: 1748392 ( 8.80%) trimmed read pairs available after processing 18125199 (91.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 4 0.00% 21 5 0.00% 22 6 0.00% 23 7 0.00% 24 6 0.00% 25 5 0.00% 26 5 0.00% 27 2 0.00% 28 4 0.00% 29 6 0.00% 30 9 0.00% 31 6 0.00% 32 9 0.00% 33 16 0.00% 34 9 0.00% 35 15 0.00% 36 22 0.00% 37 24 0.00% 38 10 0.00% 39 10 0.00% 40 25 0.00% 41 14 0.00% 42 16 0.00% 43 16 0.00% 44 19 0.00% 45 24 0.00% 46 26 0.00% 47 34 0.00% 48 42 0.00% 49 39 0.00% 50 59 0.00% 51 59 0.00% 52 77 0.00% 53 69 0.00% 54 65 0.00% 55 90 0.00% 56 79 0.00% 57 98 0.00% 58 123 0.00% 59 145 0.00% 60 155 0.00% 61 196 0.00% 62 205 0.00% 63 253 0.00% 64 287 0.00% 65 314 0.00% 66 333 0.00% 67 372 0.00% 68 463 0.00% 69 497 0.00% 70 580 0.00% 71 697 0.00% 72 804 0.00% 73 877 0.00% 74 1050 0.01% 75 1160 0.01% 76 1308 0.01% 77 1451 0.01% 78 1549 0.01% 79 1732 0.01% 80 1929 0.01% 81 2289 0.01% 82 2599 0.01% 83 2985 0.02% 84 3443 0.02% 85 3823 0.02% 86 4015 0.02% 87 4424 0.02% 88 4707 0.02% 89 4991 0.03% 90 5645 0.03% 91 6047 0.03% 92 6900 0.03% 93 7749 0.04% 94 8301 0.04% 95 8828 0.04% 96 9685 0.05% 97 10209 0.05% 98 10409 0.05% 99 11136 0.06% 100 11844 0.06% 101 12446 0.06% 102 13554 0.07% 103 14494 0.07% 104 15579 0.08% 105 16027 0.08% 106 16902 0.09% 107 17219 0.09% 108 17953 0.09% 109 18859 0.09% 110 18944 0.10% 111 20051 0.10% 112 21191 0.11% 113 22150 0.11% 114 23124 0.12% 115 23992 0.12% 116 24872 0.13% 117 25671 0.13% 118 25919 0.13% 119 26131 0.13% 120 27095 0.14% 121 27749 0.14% 122 28852 0.15% 123 29750 0.15% 124 30878 0.16% 125 31847 0.16% 126 33170 0.17% 127 34085 0.17% 128 34070 0.17% 129 34782 0.18% 130 35199 0.18% 131 36147 0.18% 132 36800 0.19% 133 37963 0.19% 134 38847 0.20% 135 40387 0.20% 136 41330 0.21% 137 41341 0.21% 138 42489 0.21% 139 42614 0.21% 140 42718 0.21% 141 43933 0.22% 142 44308 0.22% 143 45464 0.23% 144 47373 0.24% 145 48215 0.24% 146 48298 0.24% 147 49348 0.25% 148 49967 0.25% 149 49981 0.25% 150 50770 0.26% 151 18125199 91.20% 19873591 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=9.50 fanout-score-rank=23 prefix-density=0.22 prefix-fanout=5.6 sequence=CAATTTTCTCAATAGCTGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=16 fanout-score=158.32 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=18.2 sequence=CATCATCATCACC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.32 fanout-score-rank=34 prefix-density=0.20 prefix-fanout=2.7 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=92.34 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.0 sequence=GCTCTCTGTAACTGCGAGAGAGCTCCTTATTTTTTAGATTCCCTAAACTTCCTTTCTTCAAGTTTCTCTCCCAAAGTTCATCATGGGCAAGGAGAAGGTTCACATTAACATTGTGGTTATTGGTCATGTTGACTCTGGCAAGTCAACCACTACTGGTCATTTGATCTACAA SRR12919316 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:58:39 Started mapping on | Feb 12 17:58:39 Finished on | Feb 12 18:00:42 Mapping speed, Million of reads per hour | 581.67 Number of input reads | 19873591 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18540911 Uniquely mapped reads % | 93.29% Average mapped length | 296.46 Number of splices: Total | 17875966 Number of splices: Annotated (sjdb) | 17464568 Number of splices: GT/AG | 17546354 Number of splices: GC/AG | 257181 Number of splices: AT/AC | 19686 Number of splices: Non-canonical | 52745 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 482838 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 68278 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.80% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 849842 849842 849842 N_multimapping 482838 482838 482838 N_noFeature 674280 18322258 783968 N_ambiguous 221802 1591 111719 UnstrandedReadsAssigned:17644829 PositiveStrandReadsAssigned:217062 NegativeStrandReadsAssigned:17645224 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919316 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919316-trimmed-pair1.fastq SRR12919316-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,873,591 reads, 17,724,837 reads pseudoaligned [quant] estimated average fragment length: 272.203 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR12919316.ke.tsv 34699 SRR12919316.se.tsv 87100 total ==> SRR12919316.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.8 774 25.4381 Potri.005G024800.1.v4.1 1035 763.797 191 14.3563 Potri.004G059700.1.v4.1 961 689.97 66 5.49161 Potri.007G009000.2.v4.1 1416 1144.8 0 0 Potri.003G141000.2.v4.1 2943 2671.8 734.903 15.7911 Potri.016G087400.1.v4.1 270 82.0447 1299.49 909.302 Potri.015G069301.1.v4.1 564 309.049 0 0 Potri.010G195200.1.v4.1 1773 1501.8 49 1.87314 Potri.012G127500.1.v4.1 977 705.901 12669 1030.35 ==> SRR12919316.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 301 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 297 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 99 SRR12919316 completed mapping pipeline successfully