Starting /dee2/code/volunteer_pipeline.sh SRR12919317 current disk space = 2824485142528 free memory = 1575722484 SRR12919317 SRAfilesize 705875faeabbd9973c8efc91c90cea95 SRR12919317.sra SRR12919317.sra file validated SRR12919317 is paired end SRR12919317 is conventional basespace SRR12919317 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919317_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.541 37.0 37.0 37.0 37.0 37.0 2 36.39325 37.0 37.0 37.0 37.0 37.0 3 36.5895 37.0 37.0 37.0 37.0 37.0 4 36.7455 37.0 37.0 37.0 37.0 37.0 5 36.6815 37.0 37.0 37.0 37.0 37.0 6 36.6845 37.0 37.0 37.0 37.0 37.0 7 36.619 37.0 37.0 37.0 37.0 37.0 8 36.636 37.0 37.0 37.0 37.0 37.0 9 36.6435 37.0 37.0 37.0 37.0 37.0 10-14 36.6791 37.0 37.0 37.0 37.0 37.0 15-19 36.634699999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.6575 37.0 37.0 37.0 37.0 37.0 25-29 36.6511 37.0 37.0 37.0 37.0 37.0 30-34 36.584500000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.6084 37.0 37.0 37.0 37.0 37.0 40-44 36.5704 37.0 37.0 37.0 37.0 37.0 45-49 36.544000000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.5109 37.0 37.0 37.0 37.0 37.0 55-59 36.495000000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.454 37.0 37.0 37.0 37.0 37.0 65-69 36.4397 37.0 37.0 37.0 37.0 37.0 70-74 36.38629999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.3478 37.0 37.0 37.0 37.0 37.0 80-84 36.342 37.0 37.0 37.0 37.0 37.0 85-89 36.3266 37.0 37.0 37.0 37.0 37.0 90-94 36.272200000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.294000000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.2454 37.0 37.0 37.0 37.0 37.0 105-109 36.200100000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.160199999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.1545 37.0 37.0 37.0 37.0 37.0 120-124 36.1611 37.0 37.0 37.0 37.0 37.0 125-129 36.104499999999994 37.0 37.0 37.0 37.0 37.0 130-134 36.027499999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.9402 37.0 37.0 37.0 37.0 37.0 140-144 35.885600000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.810900000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.698750000000004 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 1.0 25 3.0 26 2.0 27 8.0 28 8.0 29 13.0 30 17.0 31 21.0 32 39.0 33 58.0 34 107.0 35 311.0 36 2976.0 37 434.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.575 11.924999999999999 6.175 41.325 2 19.643305702084906 12.785732228083397 35.59407184124591 31.97689022858578 3 15.725 18.55 29.549999999999997 36.175000000000004 4 22.3 24.975 23.200000000000003 29.525000000000002 5 23.150000000000002 30.125 24.099999999999998 22.625 6 20.575 34.575 23.525 21.325 7 14.625 28.525 39.5 17.349999999999998 8 17.675 25.374999999999996 32.375 24.575 9 17.299999999999997 23.825 34.675 24.2 10-14 19.235 29.515 28.115000000000002 23.135 15-19 20.03 28.025 29.01 22.935 20-24 19.575 28.98 27.860000000000003 23.585 25-29 20.064999999999998 27.915 28.315 23.705000000000002 30-34 19.52 29.64 27.16 23.68 35-39 19.755 29.299999999999997 27.265 23.68 40-44 20.674999999999997 28.544999999999998 27.12 23.66 45-49 19.689999999999998 28.835 27.48 23.995 50-54 20.41 28.365000000000002 27.165 24.060000000000002 55-59 20.200000000000003 28.34 27.584999999999997 23.875 60-64 19.425 28.67 27.375 24.529999999999998 65-69 20.044999999999998 28.79 27.700000000000003 23.465 70-74 20.3 29.465000000000003 26.125 24.11 75-79 20.325 28.935 26.924999999999997 23.815 80-84 20.355 29.185 26.83 23.630000000000003 85-89 20.810000000000002 28.585 28.1 22.505 90-94 20.34 28.87 26.939999999999998 23.849999999999998 95-99 20.22 28.660000000000004 27.544999999999998 23.575 100-104 20.355 28.515 27.735 23.395 105-109 20.36 28.57 26.88 24.19 110-114 20.995 28.485 27.29 23.23 115-119 20.61 28.79 27.29 23.31 120-124 20.335 28.555000000000003 27.33 23.78 125-129 19.89 28.02 27.529999999999998 24.560000000000002 130-134 20.91 28.405 26.895000000000003 23.79 135-139 21.095 27.91 27.265 23.73 140-144 20.830000000000002 27.76 27.22 24.19 145-149 21.535 28.08 26.884999999999998 23.5 150-151 21.05 28.525 26.637499999999996 23.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 2.0 22 2.0 23 0.0 24 1.5 25 5.0 26 5.5 27 3.0 28 5.0 29 14.5 30 19.0 31 24.5 32 35.0 33 44.0 34 53.5 35 67.0 36 84.5 37 107.0 38 133.5 39 164.5 40 191.5 41 213.5 42 240.5 43 245.0 44 259.5 45 278.0 46 271.5 47 261.5 48 235.5 49 202.0 50 163.0 51 130.5 52 119.0 53 106.5 54 76.5 55 51.5 56 48.0 57 36.0 58 21.5 59 21.0 60 16.5 61 9.5 62 6.5 63 3.5 64 2.5 65 3.5 66 4.5 67 3.0 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.475 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.675 #Duplication Level Percentage of deduplicated Percentage of total 1 91.73711480774475 84.1 2 7.499318243796019 13.750000000000002 3 0.7090264521407145 1.95 4 0.0545404963185165 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.7749999999999999 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.4875 0.0 0.0 0.0 0.0 108-109 1.7375 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114-115 2.4125 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 3.0 0.0 0.0 0.0 0.0 120-121 3.4000000000000004 0.0 0.0 0.0 0.0 122-123 3.7249999999999996 0.0 0.0 0.0 0.0 124-125 4.2625 0.0 0.0 0.0 0.0 126-127 4.8 0.0 0.0 0.0 0.0 128-129 5.1 0.0 0.0 0.0 0.0 130-131 5.4625 0.0 0.0 0.0 0.0 132-133 5.9125 0.0 0.0 0.0 0.0 134-135 6.3375 0.0 0.0 0.0 0.0 136-137 6.85 0.0 0.0 0.0 0.0 138-139 7.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919317 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919317_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0645 37.0 37.0 37.0 37.0 37.0 2 36.051 37.0 37.0 37.0 37.0 37.0 3 36.1365 37.0 37.0 37.0 37.0 37.0 4 36.1855 37.0 37.0 37.0 37.0 37.0 5 36.205 37.0 37.0 37.0 37.0 37.0 6 36.1665 37.0 37.0 37.0 37.0 37.0 7 36.196 37.0 37.0 37.0 37.0 37.0 8 36.227 37.0 37.0 37.0 37.0 37.0 9 36.1165 37.0 37.0 37.0 37.0 37.0 10-14 36.27720000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.2188 37.0 37.0 37.0 37.0 37.0 20-24 36.155499999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.1024 37.0 37.0 37.0 37.0 37.0 30-34 36.046 37.0 37.0 37.0 37.0 37.0 35-39 35.998799999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.0072 37.0 37.0 37.0 37.0 37.0 45-49 35.9636 37.0 37.0 37.0 37.0 37.0 50-54 35.952799999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.8492 37.0 37.0 37.0 37.0 37.0 60-64 35.8976 37.0 37.0 37.0 37.0 37.0 65-69 35.877900000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.8079 37.0 37.0 37.0 37.0 37.0 75-79 35.7561 37.0 37.0 37.0 37.0 37.0 80-84 35.7096 37.0 37.0 37.0 37.0 37.0 85-89 35.714999999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.675 37.0 37.0 37.0 37.0 37.0 95-99 35.59669999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.5771 37.0 37.0 37.0 37.0 37.0 105-109 35.5909 37.0 37.0 37.0 37.0 37.0 110-114 35.5835 37.0 37.0 37.0 37.0 37.0 115-119 35.490899999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.4906 37.0 37.0 37.0 37.0 37.0 125-129 35.46319999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.3316 37.0 37.0 37.0 37.0 37.0 135-139 35.1456 37.0 37.0 37.0 27.4 37.0 140-144 35.0654 37.0 37.0 37.0 27.4 37.0 145-149 35.0138 37.0 37.0 37.0 25.0 37.0 150-151 34.918499999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 3.0 15 2.0 16 4.0 17 0.0 18 3.0 19 1.0 20 2.0 21 3.0 22 4.0 23 7.0 24 5.0 25 10.0 26 10.0 27 10.0 28 12.0 29 24.0 30 34.0 31 53.0 32 63.0 33 121.0 34 220.0 35 636.0 36 2578.0 37 190.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.175 22.85 10.475 27.500000000000004 2 27.700000000000003 26.525 29.075 16.7 3 20.925 27.625 31.025000000000002 20.424999999999997 4 22.6 33.300000000000004 24.675 19.425 5 25.224999999999998 36.0 21.349999999999998 17.424999999999997 6 21.0 38.7 22.7 17.599999999999998 7 21.925 21.349999999999998 37.55 19.175 8 22.05 26.924999999999997 27.05 23.974999999999998 9 22.275 25.1 30.175 22.45 10-14 22.935 29.48 26.31 21.275 15-19 22.745 28.73 27.6 20.925 20-24 24.385 27.794999999999998 27.485 20.335 25-29 23.665 28.465 27.250000000000004 20.62 30-34 23.72 27.465 28.144999999999996 20.669999999999998 35-39 23.27 28.015 28.1 20.615 40-44 23.405 27.92 27.944999999999997 20.73 45-49 23.3 28.03 27.76 20.91 50-54 23.44 28.665000000000003 27.205000000000002 20.69 55-59 23.435 27.675 28.565 20.325 60-64 24.03 27.36 27.71 20.9 65-69 23.105 28.384999999999998 27.875 20.635 70-74 23.22 28.665000000000003 27.605 20.51 75-79 23.66 28.12 27.860000000000003 20.36 80-84 23.52 27.935 27.905 20.64 85-89 24.240000000000002 27.985 27.765 20.01 90-94 23.599999999999998 27.860000000000003 28.715000000000003 19.825 95-99 23.435 27.87 28.375 20.32 100-104 24.14 27.944999999999997 27.705000000000002 20.21 105-109 23.935000000000002 28.255000000000003 27.61 20.200000000000003 110-114 23.580000000000002 27.905 28.299999999999997 20.215 115-119 24.285 27.845 27.87 20.0 120-124 23.505000000000003 28.62 27.49 20.385 125-129 24.19 28.055000000000003 27.72 20.035 130-134 25.224999999999998 28.310000000000002 27.169999999999998 19.295 135-139 24.73 27.800000000000004 27.150000000000002 20.32 140-144 25.71 27.544999999999998 26.889999999999997 19.855 145-149 26.06 28.07 26.97 18.9 150-151 26.1125 27.487499999999997 26.5375 19.8625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 1.0 11 1.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 2.0 24 2.5 25 1.5 26 4.0 27 5.5 28 6.0 29 12.0 30 15.0 31 19.5 32 32.5 33 42.5 34 52.5 35 64.0 36 84.0 37 102.0 38 120.5 39 155.0 40 216.5 41 260.0 42 267.0 43 259.5 44 244.0 45 265.0 46 273.0 47 250.5 48 227.0 49 200.0 50 166.0 51 134.0 52 112.5 53 84.0 54 68.0 55 58.5 56 37.0 57 32.0 58 29.5 59 20.5 60 17.0 61 11.0 62 9.0 63 6.5 64 4.5 65 3.0 66 1.5 67 2.0 68 1.0 69 0.0 70 0.5 71 1.0 72 0.5 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 1.0 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.2 #Duplication Level Percentage of deduplicated Percentage of total 1 92.29934924078091 85.1 2 7.022776572668113 12.950000000000001 3 0.596529284164859 1.6500000000000001 4 0.08134490238611713 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.7 0.0 0.0 0.0 0.0 110-111 1.8875 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.6500000000000004 0.0 0.0 0.0 0.0 118-119 2.9625 0.0 0.0 0.0 0.0 120-121 3.3499999999999996 0.0 0.0 0.0 0.0 122-123 3.675 0.0 0.0 0.0 0.0 124-125 4.2125 0.0 0.0 0.0 0.0 126-127 4.7 0.0 0.0 0.0 0.0 128-129 5.0 0.0 0.0 0.0 0.0 130-131 5.3625 0.0 0.0 0.0 0.0 132-133 5.8375 0.0 0.0 0.0 0.0 134-135 6.2625 0.0 0.0 0.0 0.0 136-137 6.800000000000001 0.0 0.0 0.0 0.0 138-139 7.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 721541 spots for SRR12919317.sra Written 721541 spots for SRR12919317.sra Read 721541 spots for SRR12919317.sra Written 721541 spots for SRR12919317.sra Read 721541 spots for SRR12919317.sra Written 721541 spots for SRR12919317.sra Read 721541 spots for SRR12919317.sra Written 721541 spots for SRR12919317.sra Read 721541 spots for SRR12919317.sra Written 721541 spots for SRR12919317.sra Read 721541 spots for SRR12919317.sra Written 721541 spots for SRR12919317.sra Read 721541 spots for SRR12919317.sra Written 721541 spots for SRR12919317.sra Read 721541 spots for SRR12919317.sra Written 721541 spots for SRR12919317.sra Read 721554 spots for SRR12919317.sra Written 721554 spots for SRR12919317.sra Read 721541 spots for SRR12919317.sra Written 721541 spots for SRR12919317.sra Read 721541 spots for SRR12919317.sra Written 721541 spots for SRR12919317.sra Read 721541 spots for SRR12919317.sra Written 721541 spots for SRR12919317.sra Read 721541 spots for SRR12919317.sra Written 721541 spots for SRR12919317.sra Read 721541 spots for SRR12919317.sra Written 721541 spots for SRR12919317.sra Read 721541 spots for SRR12919317.sra Written 721541 spots for SRR12919317.sra Read 721541 spots for SRR12919317.sra Written 721541 spots for SRR12919317.sra Read 721541 spots for SRR12919317.sra Written 721541 spots for SRR12919317.sra Read 721541 spots for SRR12919317.sra Written 721541 spots for SRR12919317.sra Read 721541 spots for SRR12919317.sra Written 721541 spots for SRR12919317.sra Read 721541 spots for SRR12919317.sra Written 721541 spots for SRR12919317.sra SRR ids: ['SRR12919317.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_36jzu3nj SRR12919317.sra spots: 14430833 blocks: [[1, 721541], [721542, 1443082], [1443083, 2164623], [2164624, 2886164], [2886165, 3607705], [3607706, 4329246], [4329247, 5050787], [5050788, 5772328], [5772329, 6493869], [6493870, 7215410], [7215411, 7936951], [7936952, 8658492], [8658493, 9380033], [9380034, 10101574], [10101575, 10823115], [10823116, 11544656], [11544657, 12266197], [12266198, 12987738], [12987739, 13709279], [13709280, 14430833]] SRR12919317 file size 4882528 SRR12919317 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919317 SRR12919317_1.fastq SRR12919317_2.fastq Input file: SRR12919317_1.fastq Paired file: SRR12919317_2.fastq trimmed: SRR12919317-trimmed-pair1.fastq, SRR12919317-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 12:08:14 2025 >> started Thu Apr 10 12:08:32 2025 >> done (18.001s) 14430833 read pairs processed; of these: 14 ( 0.00%) short read pairs filtered out after trimming by size control 577 ( 0.00%) empty read pairs filtered out after trimming by size control 14430242 (100.00%) read pairs available; of these: 1603473 (11.11%) trimmed read pairs available after processing 12826769 (88.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 6 0.00% 22 6 0.00% 23 5 0.00% 24 8 0.00% 25 3 0.00% 26 4 0.00% 27 9 0.00% 28 6 0.00% 29 6 0.00% 30 10 0.00% 31 3 0.00% 32 11 0.00% 33 14 0.00% 34 14 0.00% 35 10 0.00% 36 12 0.00% 37 11 0.00% 38 7 0.00% 39 14 0.00% 40 6 0.00% 41 18 0.00% 42 18 0.00% 43 24 0.00% 44 24 0.00% 45 29 0.00% 46 15 0.00% 47 21 0.00% 48 33 0.00% 49 44 0.00% 50 48 0.00% 51 46 0.00% 52 64 0.00% 53 73 0.00% 54 65 0.00% 55 87 0.00% 56 75 0.00% 57 85 0.00% 58 114 0.00% 59 128 0.00% 60 137 0.00% 61 181 0.00% 62 201 0.00% 63 216 0.00% 64 260 0.00% 65 252 0.00% 66 297 0.00% 67 296 0.00% 68 369 0.00% 69 483 0.00% 70 556 0.00% 71 656 0.00% 72 770 0.01% 73 890 0.01% 74 927 0.01% 75 1136 0.01% 76 1221 0.01% 77 1334 0.01% 78 1415 0.01% 79 1624 0.01% 80 1872 0.01% 81 2212 0.02% 82 2534 0.02% 83 2754 0.02% 84 3240 0.02% 85 3594 0.02% 86 3766 0.03% 87 4093 0.03% 88 4566 0.03% 89 4767 0.03% 90 5336 0.04% 91 5977 0.04% 92 6538 0.05% 93 7243 0.05% 94 7883 0.05% 95 8540 0.06% 96 9252 0.06% 97 9410 0.07% 98 9859 0.07% 99 10539 0.07% 100 11109 0.08% 101 11879 0.08% 102 12432 0.09% 103 13926 0.10% 104 14337 0.10% 105 15345 0.11% 106 15819 0.11% 107 16556 0.11% 108 17174 0.12% 109 17750 0.12% 110 17531 0.12% 111 19017 0.13% 112 20036 0.14% 113 20748 0.14% 114 22046 0.15% 115 22828 0.16% 116 23505 0.16% 117 24030 0.17% 118 24669 0.17% 119 24955 0.17% 120 25450 0.18% 121 26169 0.18% 122 26797 0.19% 123 27664 0.19% 124 28621 0.20% 125 29250 0.20% 126 30441 0.21% 127 31128 0.22% 128 31559 0.22% 129 31770 0.22% 130 32283 0.22% 131 33114 0.23% 132 33702 0.23% 133 34612 0.24% 134 35440 0.25% 135 36617 0.25% 136 37163 0.26% 137 37660 0.26% 138 38379 0.27% 139 38644 0.27% 140 39010 0.27% 141 39194 0.27% 142 40351 0.28% 143 40545 0.28% 144 41790 0.29% 145 42773 0.30% 146 42738 0.30% 147 43916 0.30% 148 43927 0.30% 149 44022 0.31% 150 44674 0.31% 151 12826769 88.89% 14430242 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=4.20 fanout-score-rank=19 prefix-density=0.35 prefix-fanout=3.2 sequence=TGGTGATGGGAAGCCAGAAAACTTCCTTGGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=113.46 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=11.9 sequence=CATCACCATCCCTGATTGATCTTTGATTCACAACAAGACCAACCAACCGTACAATGTTTACATAACTTGGGATAATCTCACAAGAAAGAAAGATCAATACAAAACTAGTCAGCTCAGGATGTTCCAGGCACGGTAGAACCGTAGAACCATAACAACAAGAGACATATTGCAGATGAGTACTGAAAAACAAAACACAGTACGTATTTACATGGGCAACCTTGGTTGAAGGCAACCTCATCAACGATGCTCGCTCTTCGTCTCTCCACTGTACATCCAGTCATAGACAGTGGGTGTGTTAGGCTGTGGCTTGTCAAAAACATGAGCACCAATATTCTTAGTAGCAAGGTTGCTACCAGGGTGGAACACGCTCCTCCAAACATTGCTACGCGCCGACACTGGGGTTGTAGGGGTCACTGGTGTCGTCGGTGTCCCTGGAGTTCCTGGCATAGTCATGGACCTCTGAAACTTATTAACAGGACTGCTCCCCTCTCCGACGTCAATATCTTTGATG criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=31 prefix-density=0.27 prefix-fanout=2.0 sequence=CATAGAATGTCTACAGTCAATTTGGCAGCACTGCTGTTGCTTGGGCTGCTGCTGGTTATGCCACAGCAGTCCATGCAAGCGAGTTTGATAGACCCCATTGCTGAAATCGAGAGAAGCAACTGCAAAATCGCACACCTTCGCTTAGGGCTTGTTTTTAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=52.77 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.2 sequence=CACAAAGCAGTTGCATTTATCTAAAGTATT SRR12919317 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 12:09:19 Started mapping on | Apr 10 12:09:20 Finished on | Apr 10 12:11:22 Mapping speed, Million of reads per hour | 425.81 Number of input reads | 14430242 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13133962 Uniquely mapped reads % | 91.02% Average mapped length | 295.27 Number of splices: Total | 12386968 Number of splices: Annotated (sjdb) | 12076355 Number of splices: GT/AG | 12153361 Number of splices: GC/AG | 180554 Number of splices: AT/AC | 15042 Number of splices: Non-canonical | 38011 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 350496 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 94397 % of reads mapped to too many loci | 0.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.70% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 945784 945784 945784 N_multimapping 350496 350496 350496 N_noFeature 502369 12979945 572199 N_ambiguous 166378 995 81551 UnstrandedReadsAssigned:12465215 PositiveStrandReadsAssigned:153022 NegativeStrandReadsAssigned:12480212 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919317 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919317-trimmed-pair1.fastq SRR12919317-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,430,242 reads, 12,610,934 reads pseudoaligned [quant] estimated average fragment length: 255.368 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR12919317.ke.tsv 34699 SRR12919317.se.tsv 87100 total ==> SRR12919317.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.63 695 31.0378 Potri.005G024800.1.v4.1 1035 780.632 147 14.8315 Potri.004G059700.1.v4.1 961 706.693 49 5.46109 Potri.007G009000.2.v4.1 1416 1161.63 0 0 Potri.003G141000.2.v4.1 2943 2688.63 582.527 17.0647 Potri.016G087400.1.v4.1 270 86.4497 1121 1021.31 Potri.015G069301.1.v4.1 564 321.437 0 0 Potri.010G195200.1.v4.1 1773 1518.63 54 2.80063 Potri.012G127500.1.v4.1 977 722.671 8071 879.632 ==> SRR12919317.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 113 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 211 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 24 SRR12919317 completed mapping pipeline successfully