Starting /dee2/code/volunteer_pipeline.sh SRR12919318 current disk space = 3051559575552 free memory = 993162616 SRR12919318 SRAfilesize 5590309e5f2cf85a4f53933a17b4687d SRR12919318.sra SRR12919318.sra file validated SRR12919318 is paired end SRR12919318 is conventional basespace SRR12919318 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919318_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5735 37.0 37.0 37.0 37.0 37.0 2 36.07575 37.0 37.0 37.0 37.0 37.0 3 36.6055 37.0 37.0 37.0 37.0 37.0 4 36.558 37.0 37.0 37.0 37.0 37.0 5 36.59 37.0 37.0 37.0 37.0 37.0 6 36.624 37.0 37.0 37.0 37.0 37.0 7 36.593 37.0 37.0 37.0 37.0 37.0 8 36.6405 37.0 37.0 37.0 37.0 37.0 9 36.6005 37.0 37.0 37.0 37.0 37.0 10-14 36.6462 37.0 37.0 37.0 37.0 37.0 15-19 36.594100000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.613699999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.541999999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.5024 37.0 37.0 37.0 37.0 37.0 35-39 36.494099999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.5001 37.0 37.0 37.0 37.0 37.0 45-49 36.4807 37.0 37.0 37.0 37.0 37.0 50-54 36.4473 37.0 37.0 37.0 37.0 37.0 55-59 36.439600000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.4042 37.0 37.0 37.0 37.0 37.0 65-69 36.36409999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.3645 37.0 37.0 37.0 37.0 37.0 75-79 36.273 37.0 37.0 37.0 37.0 37.0 80-84 36.2815 37.0 37.0 37.0 37.0 37.0 85-89 36.260400000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.23819999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.1993 37.0 37.0 37.0 37.0 37.0 100-104 36.21569999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.1946 37.0 37.0 37.0 37.0 37.0 110-114 36.11130000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.0226 37.0 37.0 37.0 37.0 37.0 120-124 36.0376 37.0 37.0 37.0 37.0 37.0 125-129 35.9461 37.0 37.0 37.0 37.0 37.0 130-134 35.9452 37.0 37.0 37.0 37.0 37.0 135-139 35.8596 37.0 37.0 37.0 37.0 37.0 140-144 35.7949 37.0 37.0 37.0 37.0 37.0 145-149 35.745799999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.64425 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 1.0 21 0.0 22 1.0 23 2.0 24 3.0 25 3.0 26 2.0 27 10.0 28 8.0 29 16.0 30 18.0 31 22.0 32 51.0 33 68.0 34 115.0 35 330.0 36 2933.0 37 415.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.275 12.475 10.100000000000001 42.15 2 19.2064695476371 12.43366186504928 37.14935557240334 31.210513014910283 3 16.975 18.575 30.3 34.150000000000006 4 21.2 26.6 24.625 27.575 5 23.849999999999998 29.475 25.2 21.475 6 18.9 35.8 25.2 20.1 7 14.05 24.675 43.35 17.925 8 16.55 25.674999999999997 31.65 26.125 9 16.2 24.025 34.599999999999994 25.174999999999997 10-14 19.205 29.695 27.334999999999997 23.765 15-19 19.919999999999998 28.02 28.42 23.64 20-24 19.38 28.055000000000003 28.58 23.985 25-29 19.235 28.485 28.310000000000002 23.97 30-34 19.794999999999998 28.835 27.555000000000003 23.815 35-39 19.650000000000002 28.32 27.860000000000003 24.169999999999998 40-44 19.695 28.485 28.01 23.810000000000002 45-49 19.5 28.444999999999997 27.33 24.725 50-54 19.189999999999998 29.125 27.505000000000003 24.18 55-59 19.71 28.845 27.150000000000002 24.295 60-64 20.150000000000002 28.29 27.485 24.075 65-69 19.585 28.884999999999998 27.29 24.240000000000002 70-74 20.015 28.815 27.500000000000004 23.669999999999998 75-79 19.91 28.49 27.805000000000003 23.794999999999998 80-84 20.26 28.37 27.455000000000002 23.915 85-89 20.14 28.57 27.57 23.72 90-94 19.900000000000002 28.645 26.72 24.735 95-99 19.564999999999998 28.884999999999998 27.400000000000002 24.15 100-104 20.745 28.65 26.895000000000003 23.71 105-109 19.955000000000002 28.610000000000003 27.439999999999998 23.995 110-114 20.135 28.355000000000004 27.894999999999996 23.615 115-119 20.265 28.395 27.355 23.985 120-124 20.79 28.499999999999996 26.63 24.08 125-129 19.865 28.544999999999998 27.500000000000004 24.09 130-134 20.62 28.470000000000002 27.105 23.805 135-139 20.86 28.084999999999997 27.11 23.945 140-144 20.26 28.189999999999998 26.924999999999997 24.625 145-149 20.52 28.675 26.729999999999997 24.075 150-151 20.375 28.050000000000004 26.4625 25.112499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.5 20 1.5 21 0.5 22 0.5 23 0.5 24 2.5 25 3.5 26 3.0 27 8.5 28 11.5 29 13.0 30 22.5 31 22.5 32 32.5 33 46.5 34 61.0 35 73.5 36 83.5 37 110.5 38 129.0 39 156.0 40 184.5 41 207.0 42 234.0 43 244.5 44 260.0 45 268.0 46 272.0 47 268.0 48 243.0 49 221.0 50 187.5 51 148.0 52 106.0 53 69.0 54 63.5 55 60.0 56 45.5 57 39.5 58 25.5 59 21.0 60 19.5 61 8.0 62 3.5 63 2.5 64 2.5 65 3.0 66 2.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.7 #Duplication Level Percentage of deduplicated Percentage of total 1 90.9316427783903 82.475 2 8.020948180815877 14.549999999999999 3 0.9371554575523704 2.55 4 0.08269018743109151 0.3 5 0.027563395810363836 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTAACAAATCTTTTTTCTTTCCAATTGAGTGGTAAGTACTTGAAGACAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.3624999999999998 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.175 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.7875 0.0 0.0 0.0 0.0 116-117 3.1624999999999996 0.0 0.0 0.0 0.0 118-119 3.75 0.0 0.0 0.0 0.0 120-121 4.25 0.0 0.0 0.0 0.0 122-123 4.4875 0.0 0.0 0.0 0.0 124-125 4.9125 0.0 0.0 0.0 0.0 126-127 5.475 0.0 0.0 0.0 0.0 128-129 6.0875 0.0 0.0 0.0 0.0 130-131 6.5125 0.0 0.0 0.0 0.0 132-133 6.825 0.0 0.0 0.0 0.0 134-135 7.175 0.0 0.0 0.0 0.0 136-137 7.6875 0.0 0.0 0.0 0.0 138-139 8.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTATATT 10 0.0068343505 144.975 6 >>END_MODULE SRR12919318 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919318_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3195 37.0 37.0 37.0 37.0 37.0 2 36.199 37.0 37.0 37.0 37.0 37.0 3 36.246 37.0 37.0 37.0 37.0 37.0 4 36.2215 37.0 37.0 37.0 37.0 37.0 5 36.336 37.0 37.0 37.0 37.0 37.0 6 36.259 37.0 37.0 37.0 37.0 37.0 7 36.2435 37.0 37.0 37.0 37.0 37.0 8 36.4055 37.0 37.0 37.0 37.0 37.0 9 36.369 37.0 37.0 37.0 37.0 37.0 10-14 36.381299999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.293899999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.2795 37.0 37.0 37.0 37.0 37.0 25-29 36.1769 37.0 37.0 37.0 37.0 37.0 30-34 36.188599999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.214800000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.1352 37.0 37.0 37.0 37.0 37.0 45-49 36.152 37.0 37.0 37.0 37.0 37.0 50-54 36.101600000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.1308 37.0 37.0 37.0 37.0 37.0 60-64 36.067 37.0 37.0 37.0 37.0 37.0 65-69 36.0766 37.0 37.0 37.0 37.0 37.0 70-74 36.0256 37.0 37.0 37.0 37.0 37.0 75-79 35.9972 37.0 37.0 37.0 37.0 37.0 80-84 35.979 37.0 37.0 37.0 37.0 37.0 85-89 35.9669 37.0 37.0 37.0 37.0 37.0 90-94 35.846599999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.8763 37.0 37.0 37.0 37.0 37.0 100-104 35.8676 37.0 37.0 37.0 37.0 37.0 105-109 35.8135 37.0 37.0 37.0 37.0 37.0 110-114 35.755100000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.7444 37.0 37.0 37.0 37.0 37.0 120-124 35.7314 37.0 37.0 37.0 37.0 37.0 125-129 35.7511 37.0 37.0 37.0 37.0 37.0 130-134 35.5971 37.0 37.0 37.0 37.0 37.0 135-139 35.397099999999995 37.0 37.0 37.0 34.6 37.0 140-144 35.3575 37.0 37.0 37.0 34.6 37.0 145-149 35.2999 37.0 37.0 37.0 34.6 37.0 150-151 35.03775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 6.0 15 3.0 16 1.0 17 0.0 18 1.0 19 2.0 20 2.0 21 2.0 22 2.0 23 3.0 24 6.0 25 9.0 26 6.0 27 12.0 28 9.0 29 18.0 30 27.0 31 30.0 32 63.0 33 93.0 34 191.0 35 520.0 36 2676.0 37 316.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.1 24.05 12.475 27.375 2 28.549999999999997 25.7 29.175 16.575 3 21.125 27.825 32.65 18.4 4 23.05 34.449999999999996 23.65 18.85 5 24.875 35.85 20.974999999999998 18.3 6 21.025 39.7 21.224999999999998 18.05 7 20.7 23.325000000000003 37.974999999999994 18.0 8 22.075 25.8 27.700000000000003 24.425 9 21.05 27.0 29.25 22.7 10-14 23.75 28.305000000000003 26.505000000000003 21.44 15-19 23.775 27.689999999999998 27.67 20.865000000000002 20-24 23.635 27.96 27.62 20.785 25-29 23.919999999999998 27.939999999999998 27.939999999999998 20.200000000000003 30-34 23.755000000000003 28.255000000000003 27.950000000000003 20.04 35-39 23.265 28.499999999999996 27.3 20.935000000000002 40-44 23.105 28.58 27.88 20.435 45-49 23.35 28.02 28.189999999999998 20.44 50-54 23.674999999999997 28.465 26.965 20.895 55-59 23.880000000000003 27.87 27.6 20.65 60-64 23.77 28.12 27.584999999999997 20.525 65-69 23.805 28.235 27.650000000000002 20.31 70-74 24.145 28.27 27.575 20.01 75-79 23.515 28.000000000000004 28.07 20.415 80-84 23.474999999999998 28.07 27.700000000000003 20.755000000000003 85-89 23.625 27.944999999999997 27.605 20.825 90-94 24.035 28.21 27.505000000000003 20.25 95-99 24.035 28.455000000000002 27.08 20.43 100-104 23.74 28.23 27.474999999999998 20.555 105-109 24.104999999999997 27.750000000000004 27.62 20.525 110-114 23.96 28.155 27.47 20.415 115-119 24.555 27.77 27.495000000000005 20.18 120-124 24.575 28.115000000000002 26.76 20.549999999999997 125-129 24.884999999999998 28.655 26.465 19.994999999999997 130-134 25.119999999999997 27.250000000000004 27.189999999999998 20.44 135-139 25.165 28.849999999999998 26.484999999999996 19.5 140-144 26.119999999999997 27.939999999999998 26.415 19.525000000000002 145-149 26.055 28.01 26.240000000000002 19.695 150-151 26.5625 27.474999999999998 27.1375 18.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 1.5 22 0.5 23 0.0 24 0.5 25 2.0 26 4.5 27 5.5 28 10.5 29 12.0 30 10.0 31 18.5 32 29.0 33 39.0 34 55.0 35 68.0 36 76.5 37 100.0 38 118.0 39 161.5 40 201.5 41 223.0 42 254.5 43 266.5 44 261.5 45 278.5 46 290.5 47 262.0 48 236.0 49 208.0 50 175.0 51 145.0 52 118.0 53 83.0 54 57.5 55 53.0 56 43.0 57 24.5 58 19.5 59 17.5 60 11.5 61 8.5 62 8.0 63 8.5 64 4.5 65 4.0 66 5.5 67 2.5 68 0.5 69 0.0 70 0.0 71 0.0 72 1.5 73 1.5 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.9 #Duplication Level Percentage of deduplicated Percentage of total 1 91.1991199119912 82.89999999999999 2 7.838283828382838 14.249999999999998 3 0.7975797579757976 2.175 4 0.11001100110011 0.4 5 0.0275027502750275 0.125 6 0.0275027502750275 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTCTGGGCTCTCTCACATGGGTGGAATATCCGTAGCTAAACACATATTG 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.6625000000000001 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.175 0.0 0.0 0.0 0.0 102-103 1.3875000000000002 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.6125 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.2 0.0 0.0 0.0 0.0 112-113 2.5875 0.0 0.0 0.0 0.0 114-115 2.8875 0.0 0.0 0.0 0.0 116-117 3.2625 0.0 0.0 0.0 0.0 118-119 3.8375 0.0 0.0 0.0 0.0 120-121 4.325 0.0 0.0 0.0 0.0 122-123 4.575 0.0 0.0 0.0 0.0 124-125 5.012499999999999 0.0 0.0 0.0 0.0 126-127 5.575 0.0 0.0 0.0 0.0 128-129 6.1875 0.0 0.0 0.0 0.0 130-131 6.6 0.0 0.0 0.0 0.0 132-133 6.9 0.0 0.0 0.0 0.0 134-135 7.25 0.0 0.0 0.0 0.0 136-137 7.7625 0.0 0.0 0.0 0.0 138-139 8.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1679149 spots for SRR12919318.sra Written 1679149 spots for SRR12919318.sra Read 1679149 spots for SRR12919318.sra Written 1679149 spots for SRR12919318.sra Read 1679149 spots for SRR12919318.sra Written 1679149 spots for SRR12919318.sra Read 1679149 spots for SRR12919318.sra Written 1679149 spots for SRR12919318.sra Read 1679149 spots for SRR12919318.sra Written 1679149 spots for SRR12919318.sra Read 1679149 spots for SRR12919318.sra Written 1679149 spots for SRR12919318.sra Read 1679149 spots for SRR12919318.sra Written 1679149 spots for SRR12919318.sra Read 1679149 spots for SRR12919318.sra Written 1679149 spots for SRR12919318.sra Read 1679168 spots for SRR12919318.sra Written 1679168 spots for SRR12919318.sra Read 1679149 spots for SRR12919318.sra Written 1679149 spots for SRR12919318.sra Read 1679149 spots for SRR12919318.sra Written 1679149 spots for SRR12919318.sra Read 1679149 spots for SRR12919318.sra Written 1679149 spots for SRR12919318.sra Read 1679149 spots for SRR12919318.sra Written 1679149 spots for SRR12919318.sra Read 1679149 spots for SRR12919318.sra Written 1679149 spots for SRR12919318.sra Read 1679149 spots for SRR12919318.sra Written 1679149 spots for SRR12919318.sra Read 1679149 spots for SRR12919318.sra Written 1679149 spots for SRR12919318.sra Read 1679149 spots for SRR12919318.sra Written 1679149 spots for SRR12919318.sra Read 1679149 spots for SRR12919318.sra Written 1679149 spots for SRR12919318.sra Read 1679149 spots for SRR12919318.sra Written 1679149 spots for SRR12919318.sra Read 1679149 spots for SRR12919318.sra Written 1679149 spots for SRR12919318.sra SRR ids: ['SRR12919318.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d4w6j7q_ SRR12919318.sra spots: 33582999 blocks: [[1, 1679149], [1679150, 3358298], [3358299, 5037447], [5037448, 6716596], [6716597, 8395745], [8395746, 10074894], [10074895, 11754043], [11754044, 13433192], [13433193, 15112341], [15112342, 16791490], [16791491, 18470639], [18470640, 20149788], [20149789, 21828937], [21828938, 23508086], [23508087, 25187235], [25187236, 26866384], [26866385, 28545533], [28545534, 30224682], [30224683, 31903831], [31903832, 33582999]] SRR12919318 file size 11391271 SRR12919318 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919318 SRR12919318_1.fastq SRR12919318_2.fastq Input file: SRR12919318_1.fastq Paired file: SRR12919318_2.fastq trimmed: SRR12919318-trimmed-pair1.fastq, SRR12919318-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:58:30 2025 >> started Wed Feb 12 17:59:13 2025 >> done (43.357s) 33582999 read pairs processed; of these: 42 ( 0.00%) short read pairs filtered out after trimming by size control 1447 ( 0.00%) empty read pairs filtered out after trimming by size control 33581510 (100.00%) read pairs available; of these: 4204727 (12.52%) trimmed read pairs available after processing 29376783 (87.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 5 0.00% 20 6 0.00% 21 14 0.00% 22 8 0.00% 23 14 0.00% 24 18 0.00% 25 13 0.00% 26 16 0.00% 27 15 0.00% 28 18 0.00% 29 26 0.00% 30 14 0.00% 31 27 0.00% 32 31 0.00% 33 19 0.00% 34 20 0.00% 35 33 0.00% 36 30 0.00% 37 40 0.00% 38 45 0.00% 39 30 0.00% 40 44 0.00% 41 42 0.00% 42 58 0.00% 43 45 0.00% 44 66 0.00% 45 64 0.00% 46 78 0.00% 47 86 0.00% 48 85 0.00% 49 94 0.00% 50 124 0.00% 51 157 0.00% 52 159 0.00% 53 174 0.00% 54 220 0.00% 55 198 0.00% 56 270 0.00% 57 277 0.00% 58 319 0.00% 59 414 0.00% 60 500 0.00% 61 597 0.00% 62 634 0.00% 63 751 0.00% 64 793 0.00% 65 835 0.00% 66 936 0.00% 67 1057 0.00% 68 1342 0.00% 69 1514 0.00% 70 1793 0.01% 71 2172 0.01% 72 2525 0.01% 73 2739 0.01% 74 3230 0.01% 75 3468 0.01% 76 3839 0.01% 77 4278 0.01% 78 4631 0.01% 79 5406 0.02% 80 6218 0.02% 81 7430 0.02% 82 8591 0.03% 83 9746 0.03% 84 10607 0.03% 85 11601 0.03% 86 11737 0.03% 87 12757 0.04% 88 13853 0.04% 89 14992 0.04% 90 16875 0.05% 91 18528 0.06% 92 20606 0.06% 93 22568 0.07% 94 24495 0.07% 95 25678 0.08% 96 27072 0.08% 97 27755 0.08% 98 28927 0.09% 99 30374 0.09% 100 32365 0.10% 101 34723 0.10% 102 37244 0.11% 103 39901 0.12% 104 42290 0.13% 105 44065 0.13% 106 45085 0.13% 107 46152 0.14% 108 47118 0.14% 109 48532 0.14% 110 49798 0.15% 111 52180 0.16% 112 55232 0.16% 113 56683 0.17% 114 59818 0.18% 115 61823 0.18% 116 63045 0.19% 117 64184 0.19% 118 65137 0.19% 119 64721 0.19% 120 67094 0.20% 121 68742 0.20% 122 70839 0.21% 123 73751 0.22% 124 76135 0.23% 125 78265 0.23% 126 79951 0.24% 127 81125 0.24% 128 80871 0.24% 129 80939 0.24% 130 82892 0.25% 131 83464 0.25% 132 86734 0.26% 133 88845 0.26% 134 90645 0.27% 135 92642 0.28% 136 94537 0.28% 137 95090 0.28% 138 95219 0.28% 139 95304 0.28% 140 95823 0.29% 141 96883 0.29% 142 98103 0.29% 143 100767 0.30% 144 103555 0.31% 145 105007 0.31% 146 106832 0.32% 147 106523 0.32% 148 107337 0.32% 149 106486 0.32% 150 107356 0.32% 151 29376783 87.48% 33581510 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=5.90 fanout-score-rank=32 prefix-density=0.47 prefix-fanout=3.6 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=16 fanout-score=430.69 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=34.7 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=10.02 fanout-score-rank=18 prefix-density=0.43 prefix-fanout=5.8 sequence=TTTGACAAGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=550.68 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=21.0 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAA SRR12919318 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:00:01 Started mapping on | Feb 12 18:00:01 Finished on | Feb 12 18:04:29 Mapping speed, Million of reads per hour | 451.09 Number of input reads | 33581510 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 31237570 Uniquely mapped reads % | 93.02% Average mapped length | 294.42 Number of splices: Total | 29194820 Number of splices: Annotated (sjdb) | 28482194 Number of splices: GT/AG | 28641941 Number of splices: GC/AG | 430033 Number of splices: AT/AC | 38074 Number of splices: Non-canonical | 84772 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.03% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 798946 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 187346 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.85% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1544994 1544994 1544994 N_multimapping 798946 798946 798946 N_noFeature 1149022 30893512 1314068 N_ambiguous 373981 1946 193753 UnstrandedReadsAssigned:29714567 PositiveStrandReadsAssigned:342112 NegativeStrandReadsAssigned:29729749 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919318 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919318-trimmed-pair1.fastq SRR12919318-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,581,510 reads, 29,960,208 reads pseudoaligned [quant] estimated average fragment length: 256.752 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52401 SRR12919318.ke.tsv 34699 SRR12919318.se.tsv 87100 total ==> SRR12919318.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.25 1486 28.3627 Potri.005G024800.1.v4.1 1035 779.248 498 21.4956 Potri.004G059700.1.v4.1 961 705.409 16 0.762914 Potri.007G009000.2.v4.1 1416 1160.25 0 0 Potri.003G141000.2.v4.1 2943 2687.25 1108.44 13.8739 Potri.016G087400.1.v4.1 270 89.2203 2748.48 1036.15 Potri.015G069301.1.v4.1 564 323.819 0 0 Potri.010G195200.1.v4.1 1773 1517.25 132 2.92626 Potri.012G127500.1.v4.1 977 721.324 18392 857.62 ==> SRR12919318.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 162 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 518 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 123 SRR12919318 completed mapping pipeline successfully