Starting /dee2/code/volunteer_pipeline.sh SRR12919319 current disk space = 3051523891200 free memory = 1411810676 SRR12919319 SRAfilesize c134848e4b0cc9574f939e5e5b831d73 SRR12919319.sra SRR12919319.sra file validated SRR12919319 is paired end SRR12919319 is conventional basespace SRR12919319 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919319_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4915 37.0 37.0 37.0 37.0 37.0 2 36.35525 37.0 37.0 37.0 37.0 37.0 3 36.696 37.0 37.0 37.0 37.0 37.0 4 36.674 37.0 37.0 37.0 37.0 37.0 5 36.6175 37.0 37.0 37.0 37.0 37.0 6 36.6645 37.0 37.0 37.0 37.0 37.0 7 36.5715 37.0 37.0 37.0 37.0 37.0 8 36.677 37.0 37.0 37.0 37.0 37.0 9 36.627 37.0 37.0 37.0 37.0 37.0 10-14 36.6985 37.0 37.0 37.0 37.0 37.0 15-19 36.658699999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.648700000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.5906 37.0 37.0 37.0 37.0 37.0 30-34 36.575900000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.547399999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.5361 37.0 37.0 37.0 37.0 37.0 45-49 36.485 37.0 37.0 37.0 37.0 37.0 50-54 36.462799999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.4645 37.0 37.0 37.0 37.0 37.0 60-64 36.4319 37.0 37.0 37.0 37.0 37.0 65-69 36.4451 37.0 37.0 37.0 37.0 37.0 70-74 36.378699999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.378499999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.3642 37.0 37.0 37.0 37.0 37.0 85-89 36.28489999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.2872 37.0 37.0 37.0 37.0 37.0 95-99 36.265100000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.271699999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1791 37.0 37.0 37.0 37.0 37.0 110-114 36.0991 37.0 37.0 37.0 37.0 37.0 115-119 36.0845 37.0 37.0 37.0 37.0 37.0 120-124 36.1503 37.0 37.0 37.0 37.0 37.0 125-129 36.04430000000001 37.0 37.0 37.0 37.0 37.0 130-134 36.027699999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.9384 37.0 37.0 37.0 37.0 37.0 140-144 35.7681 37.0 37.0 37.0 37.0 37.0 145-149 35.793899999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.61125 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.0 25 3.0 26 5.0 27 6.0 28 9.0 29 15.0 30 16.0 31 24.0 32 38.0 33 68.0 34 121.0 35 299.0 36 2955.0 37 438.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.925 11.799999999999999 7.675 41.6 2 19.301331992963057 12.691631063081177 36.69263634078914 31.314400603166625 3 16.900000000000002 17.325 27.85 37.925 4 19.575 26.25 25.15 29.025000000000002 5 22.475 30.575000000000003 24.55 22.400000000000002 6 20.225 33.1 24.525 22.15 7 14.924999999999999 26.200000000000003 41.75 17.125 8 18.025 26.400000000000002 31.025000000000002 24.55 9 17.325 24.025 34.725 23.925 10-14 19.91 29.755 27.485 22.85 15-19 19.965 27.83 28.1 24.104999999999997 20-24 20.01 28.15 27.744999999999997 24.095 25-29 19.595000000000002 28.775000000000002 28.360000000000003 23.27 30-34 19.765 28.560000000000002 27.915 23.76 35-39 19.775000000000002 28.105000000000004 27.650000000000002 24.47 40-44 20.34 29.485 26.57 23.605 45-49 19.585 28.835 27.72 23.86 50-54 20.07 28.199999999999996 27.650000000000002 24.08 55-59 20.325 28.49 27.750000000000004 23.435 60-64 19.835 28.000000000000004 28.15 24.015 65-69 20.005 28.16 27.279999999999998 24.555 70-74 20.165 28.27 27.74 23.825 75-79 19.73 28.084999999999997 27.700000000000003 24.485 80-84 20.035 28.38 27.639999999999997 23.945 85-89 20.43 28.67 27.04 23.86 90-94 20.06 27.855 27.994999999999997 24.09 95-99 20.169999999999998 28.244999999999997 27.994999999999997 23.59 100-104 20.775 28.255000000000003 27.339999999999996 23.630000000000003 105-109 20.544999999999998 28.01 27.725 23.72 110-114 20.41 28.449999999999996 27.43 23.71 115-119 20.9 28.494999999999997 27.595 23.01 120-124 20.47 27.889999999999997 27.63 24.01 125-129 20.625 27.894999999999996 27.165 24.315 130-134 20.65 28.77 26.88 23.7 135-139 20.965 28.18 26.69 24.165 140-144 20.849999999999998 28.37 27.025 23.755000000000003 145-149 21.55 27.55 27.125 23.775 150-151 21.125 28.4 27.200000000000003 23.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 1.0 23 1.5 24 1.0 25 2.5 26 3.5 27 6.5 28 13.5 29 18.0 30 20.0 31 20.0 32 25.0 33 36.5 34 55.0 35 68.0 36 83.0 37 104.0 38 131.5 39 165.5 40 190.5 41 218.5 42 237.0 43 250.0 44 269.5 45 277.5 46 261.5 47 227.5 48 210.0 49 203.0 50 187.5 51 160.0 52 122.5 53 91.5 54 75.5 55 74.0 56 58.5 57 34.5 58 27.5 59 23.0 60 16.5 61 10.0 62 6.0 63 6.0 64 3.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.825 #Duplication Level Percentage of deduplicated Percentage of total 1 92.15899809420092 84.625 2 6.942553770759598 12.75 3 0.7350939286686632 2.025 4 0.16335420637081405 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 1.0750000000000002 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.2875 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 2.1875 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 2.8 0.0 0.0 0.0 0.0 118-119 3.2 0.0 0.0 0.0 0.0 120-121 3.5875 0.0 0.0 0.0 0.0 122-123 3.9749999999999996 0.0 0.0 0.0 0.0 124-125 4.4625 0.0 0.0 0.0 0.0 126-127 4.8125 0.0 0.0 0.0 0.0 128-129 5.4125 0.0 0.0 0.0 0.0 130-131 5.975 0.0 0.0 0.0 0.0 132-133 6.4375 0.0 0.0 0.0 0.0 134-135 7.012499999999999 0.0 0.0 0.0 0.0 136-137 7.6875 0.0 0.0 0.0 0.0 138-139 8.225000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919319 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919319_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.353 37.0 37.0 37.0 37.0 37.0 2 36.197 37.0 37.0 37.0 37.0 37.0 3 36.253 37.0 37.0 37.0 37.0 37.0 4 36.23 37.0 37.0 37.0 37.0 37.0 5 36.2935 37.0 37.0 37.0 37.0 37.0 6 36.1985 37.0 37.0 37.0 37.0 37.0 7 36.213 37.0 37.0 37.0 37.0 37.0 8 36.4315 37.0 37.0 37.0 37.0 37.0 9 36.3645 37.0 37.0 37.0 37.0 37.0 10-14 36.3204 37.0 37.0 37.0 37.0 37.0 15-19 36.326100000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.28430000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.2763 37.0 37.0 37.0 37.0 37.0 30-34 36.2127 37.0 37.0 37.0 37.0 37.0 35-39 36.1527 37.0 37.0 37.0 37.0 37.0 40-44 36.1288 37.0 37.0 37.0 37.0 37.0 45-49 36.1509 37.0 37.0 37.0 37.0 37.0 50-54 36.091899999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.062 37.0 37.0 37.0 37.0 37.0 60-64 36.096 37.0 37.0 37.0 37.0 37.0 65-69 36.00789999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.967400000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.8851 37.0 37.0 37.0 37.0 37.0 80-84 35.8731 37.0 37.0 37.0 37.0 37.0 85-89 35.9766 37.0 37.0 37.0 37.0 37.0 90-94 35.881 37.0 37.0 37.0 37.0 37.0 95-99 35.8718 37.0 37.0 37.0 37.0 37.0 100-104 35.8076 37.0 37.0 37.0 37.0 37.0 105-109 35.7768 37.0 37.0 37.0 37.0 37.0 110-114 35.733799999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.7549 37.0 37.0 37.0 37.0 37.0 120-124 35.659 37.0 37.0 37.0 37.0 37.0 125-129 35.6295 37.0 37.0 37.0 37.0 37.0 130-134 35.4807 37.0 37.0 37.0 37.0 37.0 135-139 35.4543 37.0 37.0 37.0 34.6 37.0 140-144 35.3645 37.0 37.0 37.0 34.6 37.0 145-149 35.231700000000004 37.0 37.0 37.0 32.2 37.0 150-151 34.98725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 2.0 15 2.0 16 2.0 17 3.0 18 0.0 19 3.0 20 0.0 21 1.0 22 2.0 23 4.0 24 1.0 25 7.0 26 12.0 27 10.0 28 10.0 29 12.0 30 32.0 31 32.0 32 57.0 33 105.0 34 217.0 35 612.0 36 2614.0 37 258.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.125 24.325 11.275 28.275 2 27.975 26.25 30.349999999999998 15.425 3 20.200000000000003 28.050000000000004 31.525 20.225 4 21.55 36.125 23.799999999999997 18.525 5 24.175 36.85 20.925 18.05 6 21.075 40.400000000000006 22.125 16.400000000000002 7 20.5 22.400000000000002 37.95 19.15 8 21.65 25.874999999999996 27.224999999999998 25.25 9 22.925 24.675 29.25 23.150000000000002 10-14 22.919999999999998 29.475 26.365 21.240000000000002 15-19 23.549999999999997 27.529999999999998 28.175 20.745 20-24 22.715 29.23 27.485 20.57 25-29 23.380000000000003 28.52 27.105 20.995 30-34 22.765 29.14 26.905 21.19 35-39 22.755 28.804999999999996 27.555000000000003 20.885 40-44 22.71 28.925 27.555000000000003 20.810000000000002 45-49 22.93 27.755000000000003 28.52 20.794999999999998 50-54 23.07 27.815 28.335 20.78 55-59 23.205000000000002 28.34 27.779999999999998 20.674999999999997 60-64 22.189999999999998 28.660000000000004 27.805000000000003 21.345 65-69 23.305 27.43 27.855 21.41 70-74 23.255 27.675 28.04 21.029999999999998 75-79 23.06 28.65 27.295 20.995 80-84 23.935000000000002 27.889999999999997 27.284999999999997 20.89 85-89 23.26 28.29 27.93 20.52 90-94 23.775 27.875 27.62 20.73 95-99 23.47 27.935 27.77 20.825 100-104 24.25 28.575 26.900000000000002 20.275000000000002 105-109 24.04 27.200000000000003 28.360000000000003 20.4 110-114 24.255 28.175 27.08 20.49 115-119 23.86 27.915 27.965 20.26 120-124 24.395 27.77 27.315 20.52 125-129 25.045 27.66 27.334999999999997 19.96 130-134 25.215 27.36 27.310000000000002 20.115 135-139 25.11 27.425 26.950000000000003 20.515 140-144 25.535000000000004 26.950000000000003 27.375 20.14 145-149 26.27 27.57 26.625 19.535 150-151 26.825 26.4125 26.400000000000002 20.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 2.0 21 2.5 22 2.0 23 1.5 24 3.0 25 5.0 26 5.5 27 7.5 28 13.0 29 15.0 30 21.0 31 27.5 32 33.0 33 39.5 34 54.0 35 70.5 36 74.5 37 104.5 38 142.0 39 174.5 40 191.5 41 207.5 42 246.5 43 266.5 44 279.5 45 276.0 46 250.5 47 239.0 48 226.0 49 192.5 50 162.5 51 139.0 52 112.5 53 97.5 54 91.0 55 65.0 56 39.5 57 31.5 58 23.5 59 16.5 60 9.0 61 7.5 62 8.5 63 4.0 64 1.0 65 0.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 1.0 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.825 #Duplication Level Percentage of deduplicated Percentage of total 1 92.29512659950994 84.75 2 6.64307105907977 12.2 3 0.9256738361012796 2.55 4 0.1361285053090117 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.55 0.0 0.0 0.0 0.0 110-111 1.7625000000000002 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.85 0.0 0.0 0.0 0.0 118-119 3.25 0.0 0.0 0.0 0.0 120-121 3.6375 0.0 0.0 0.0 0.0 122-123 4.0375 0.0 0.0 0.0 0.0 124-125 4.5375 0.0 0.0 0.0 0.0 126-127 4.887499999999999 0.0 0.0 0.0 0.0 128-129 5.5 0.0 0.0 0.0 0.0 130-131 6.0625 0.0 0.0 0.0 0.0 132-133 6.487500000000001 0.0 0.0 0.0 0.0 134-135 7.1 0.0 0.0 0.0 0.0 136-137 7.7875 0.0 0.0 0.0 0.0 138-139 8.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGGAC 10 0.006830828 145.0 1 ACATTAC 10 0.006830828 145.0 5 CATTACT 10 0.006830828 145.0 6 AGTTAAG 10 0.006830828 145.0 5 >>END_MODULE Read 920097 spots for SRR12919319.sra Written 920097 spots for SRR12919319.sra Read 920097 spots for SRR12919319.sra Written 920097 spots for SRR12919319.sra Read 920097 spots for SRR12919319.sra Written 920097 spots for SRR12919319.sra Read 920097 spots for SRR12919319.sra Written 920097 spots for SRR12919319.sra Read 920097 spots for SRR12919319.sra Written 920097 spots for SRR12919319.sra Read 920097 spots for SRR12919319.sra Written 920097 spots for SRR12919319.sra Read 920097 spots for SRR12919319.sra Written 920097 spots for SRR12919319.sra Read 920097 spots for SRR12919319.sra Written 920097 spots for SRR12919319.sra Read 920097 spots for SRR12919319.sra Written 920097 spots for SRR12919319.sra Read 920097 spots for SRR12919319.sra Written 920097 spots for SRR12919319.sra Read 920097 spots for SRR12919319.sra Written 920097 spots for SRR12919319.sra Read 920097 spots for SRR12919319.sra Written 920097 spots for SRR12919319.sra Read 920097 spots for SRR12919319.sra Written 920097 spots for SRR12919319.sra Read 920097 spots for SRR12919319.sra Written 920097 spots for SRR12919319.sra Read 920097 spots for SRR12919319.sra Written 920097 spots for SRR12919319.sra Read 920097 spots for SRR12919319.sra Written 920097 spots for SRR12919319.sra Read 920097 spots for SRR12919319.sra Written 920097 spots for SRR12919319.sra Read 920116 spots for SRR12919319.sra Written 920116 spots for SRR12919319.sra Read 920097 spots for SRR12919319.sra Written 920097 spots for SRR12919319.sra Read 920097 spots for SRR12919319.sra Written 920097 spots for SRR12919319.sra SRR ids: ['SRR12919319.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w9a3x1bt SRR12919319.sra spots: 18401959 blocks: [[1, 920097], [920098, 1840194], [1840195, 2760291], [2760292, 3680388], [3680389, 4600485], [4600486, 5520582], [5520583, 6440679], [6440680, 7360776], [7360777, 8280873], [8280874, 9200970], [9200971, 10121067], [10121068, 11041164], [11041165, 11961261], [11961262, 12881358], [12881359, 13801455], [13801456, 14721552], [14721553, 15641649], [15641650, 16561746], [16561747, 17481843], [17481844, 18401959]] SRR12919319 file size 6232090 SRR12919319 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919319 SRR12919319_1.fastq SRR12919319_2.fastq Input file: SRR12919319_1.fastq Paired file: SRR12919319_2.fastq trimmed: SRR12919319-trimmed-pair1.fastq, SRR12919319-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:59:40 2025 >> started Wed Feb 12 18:00:13 2025 >> done (32.607s) 18401959 read pairs processed; of these: 14 ( 0.00%) short read pairs filtered out after trimming by size control 186 ( 0.00%) empty read pairs filtered out after trimming by size control 18401759 (100.00%) read pairs available; of these: 1979902 (10.76%) trimmed read pairs available after processing 16421857 (89.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 0 0.00% 20 2 0.00% 21 5 0.00% 22 6 0.00% 23 5 0.00% 24 7 0.00% 25 1 0.00% 26 13 0.00% 27 6 0.00% 28 5 0.00% 29 14 0.00% 30 2 0.00% 31 4 0.00% 32 7 0.00% 33 4 0.00% 34 5 0.00% 35 4 0.00% 36 5 0.00% 37 8 0.00% 38 14 0.00% 39 19 0.00% 40 17 0.00% 41 9 0.00% 42 18 0.00% 43 22 0.00% 44 20 0.00% 45 21 0.00% 46 28 0.00% 47 23 0.00% 48 39 0.00% 49 50 0.00% 50 52 0.00% 51 65 0.00% 52 77 0.00% 53 81 0.00% 54 82 0.00% 55 101 0.00% 56 120 0.00% 57 143 0.00% 58 139 0.00% 59 179 0.00% 60 248 0.00% 61 243 0.00% 62 286 0.00% 63 354 0.00% 64 393 0.00% 65 388 0.00% 66 437 0.00% 67 542 0.00% 68 584 0.00% 69 718 0.00% 70 919 0.00% 71 1034 0.01% 72 1200 0.01% 73 1340 0.01% 74 1531 0.01% 75 1645 0.01% 76 1803 0.01% 77 2020 0.01% 78 2255 0.01% 79 2575 0.01% 80 2914 0.02% 81 3299 0.02% 82 3957 0.02% 83 4501 0.02% 84 4895 0.03% 85 5554 0.03% 86 5817 0.03% 87 6066 0.03% 88 6644 0.04% 89 7013 0.04% 90 7978 0.04% 91 8656 0.05% 92 9331 0.05% 93 10532 0.06% 94 11127 0.06% 95 12160 0.07% 96 12675 0.07% 97 13251 0.07% 98 13519 0.07% 99 14412 0.08% 100 14943 0.08% 101 15971 0.09% 102 16966 0.09% 103 18583 0.10% 104 19486 0.11% 105 20239 0.11% 106 20662 0.11% 107 21007 0.11% 108 21561 0.12% 109 21945 0.12% 110 22735 0.12% 111 23898 0.13% 112 24855 0.14% 113 25751 0.14% 114 27276 0.15% 115 28729 0.16% 116 29150 0.16% 117 29451 0.16% 118 30034 0.16% 119 30215 0.16% 120 31047 0.17% 121 31690 0.17% 122 32562 0.18% 123 33928 0.18% 124 34990 0.19% 125 35737 0.19% 126 37272 0.20% 127 37609 0.20% 128 38045 0.21% 129 38568 0.21% 130 38685 0.21% 131 39552 0.21% 132 40021 0.22% 133 41548 0.23% 134 42431 0.23% 135 43970 0.24% 136 44788 0.24% 137 45162 0.25% 138 45647 0.25% 139 46238 0.25% 140 46065 0.25% 141 47041 0.26% 142 47361 0.26% 143 47832 0.26% 144 49385 0.27% 145 50708 0.28% 146 51567 0.28% 147 52134 0.28% 148 52741 0.29% 149 52823 0.29% 150 53056 0.29% 151 16421857 89.24% 18401759 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=22 prefix-density=0.53 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=21 fanout-score=22.60 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=7.4 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=25 prefix-density=0.63 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=62.59 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=3.3 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT SRR12919319 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:01:10 Started mapping on | Feb 12 18:01:10 Finished on | Feb 12 18:04:13 Mapping speed, Million of reads per hour | 362.00 Number of input reads | 18401759 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17200216 Uniquely mapped reads % | 93.47% Average mapped length | 295.24 Number of splices: Total | 17160489 Number of splices: Annotated (sjdb) | 16800271 Number of splices: GT/AG | 16817424 Number of splices: GC/AG | 278328 Number of splices: AT/AC | 12462 Number of splices: Non-canonical | 52275 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 426207 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 72219 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.70% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 775336 775336 775336 N_multimapping 426207 426207 426207 N_noFeature 636351 16963124 736156 N_ambiguous 239196 1309 101100 UnstrandedReadsAssigned:16324669 PositiveStrandReadsAssigned:235783 NegativeStrandReadsAssigned:16362960 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919319 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919319-trimmed-pair1.fastq SRR12919319-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,401,759 reads, 16,382,357 reads pseudoaligned [quant] estimated average fragment length: 265.234 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,045 rounds 52401 SRR12919319.ke.tsv 34699 SRR12919319.se.tsv 87100 total ==> SRR12919319.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.77 753 25.8772 Potri.005G024800.1.v4.1 1035 770.766 391 30.5737 Potri.004G059700.1.v4.1 961 696.89 48 4.15117 Potri.007G009000.2.v4.1 1416 1151.77 0 0 Potri.003G141000.2.v4.1 2943 2678.77 600.416 13.5086 Potri.016G087400.1.v4.1 270 85.2169 649 459.001 Potri.015G069301.1.v4.1 564 316.148 0 0 Potri.010G195200.1.v4.1 1773 1508.77 144 5.75221 Potri.012G127500.1.v4.1 977 712.823 735 62.144 ==> SRR12919319.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 69 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 215 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 38 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 18 SRR12919319 completed mapping pipeline successfully