Starting /dee2/code/volunteer_pipeline.sh SRR12919320 current disk space = 3051228508160 free memory = 1574606312 SRR12919320 SRAfilesize c59d0a0bfe42cba32c6f8ecd01135ab4 SRR12919320.sra SRR12919320.sra file validated SRR12919320 is paired end SRR12919320 is conventional basespace SRR12919320 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919320_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6075 37.0 37.0 37.0 37.0 37.0 2 36.26275 37.0 37.0 37.0 37.0 37.0 3 36.6015 37.0 37.0 37.0 37.0 37.0 4 36.641 37.0 37.0 37.0 37.0 37.0 5 36.691 37.0 37.0 37.0 37.0 37.0 6 36.6145 37.0 37.0 37.0 37.0 37.0 7 36.6795 37.0 37.0 37.0 37.0 37.0 8 36.709 37.0 37.0 37.0 37.0 37.0 9 36.677 37.0 37.0 37.0 37.0 37.0 10-14 36.657 37.0 37.0 37.0 37.0 37.0 15-19 36.6642 37.0 37.0 37.0 37.0 37.0 20-24 36.6144 37.0 37.0 37.0 37.0 37.0 25-29 36.5972 37.0 37.0 37.0 37.0 37.0 30-34 36.5664 37.0 37.0 37.0 37.0 37.0 35-39 36.5681 37.0 37.0 37.0 37.0 37.0 40-44 36.533500000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.481 37.0 37.0 37.0 37.0 37.0 50-54 36.5055 37.0 37.0 37.0 37.0 37.0 55-59 36.492 37.0 37.0 37.0 37.0 37.0 60-64 36.3752 37.0 37.0 37.0 37.0 37.0 65-69 36.4437 37.0 37.0 37.0 37.0 37.0 70-74 36.40220000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.3267 37.0 37.0 37.0 37.0 37.0 80-84 36.3966 37.0 37.0 37.0 37.0 37.0 85-89 36.334399999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.2957 37.0 37.0 37.0 37.0 37.0 95-99 36.326800000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.2327 37.0 37.0 37.0 37.0 37.0 105-109 36.219899999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.113 37.0 37.0 37.0 37.0 37.0 115-119 36.088800000000006 37.0 37.0 37.0 37.0 37.0 120-124 36.1403 37.0 37.0 37.0 37.0 37.0 125-129 36.034800000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.9314 37.0 37.0 37.0 37.0 37.0 135-139 35.867399999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8267 37.0 37.0 37.0 37.0 37.0 145-149 35.817899999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.569500000000005 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 2.0 25 3.0 26 1.0 27 6.0 28 8.0 29 17.0 30 23.0 31 25.0 32 36.0 33 66.0 34 112.0 35 297.0 36 2985.0 37 418.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.325 14.35 3.925 38.4 2 17.928086497359818 12.748302740759366 39.40155896404325 29.922051797837568 3 16.075 17.349999999999998 29.75 36.825 4 21.475 24.025 25.724999999999998 28.775000000000002 5 22.95 30.85 25.25 20.95 6 20.1 34.425 22.925 22.55 7 15.75 26.775 40.6 16.875 8 16.475 26.125 33.550000000000004 23.849999999999998 9 17.1 23.625 35.775 23.5 10-14 20.355 29.585 27.384999999999998 22.675 15-19 20.18 27.33 27.755000000000003 24.735 20-24 19.455 29.18 27.639999999999997 23.724999999999998 25-29 19.5 28.720000000000002 27.57 24.21 30-34 19.985 28.79 27.665 23.56 35-39 19.705000000000002 28.57 27.91 23.815 40-44 19.62 28.505000000000003 27.93 23.945 45-49 20.225 28.660000000000004 27.49 23.625 50-54 20.34 28.565 27.495000000000005 23.599999999999998 55-59 20.19 28.715000000000003 27.805000000000003 23.29 60-64 20.035 28.65 27.439999999999998 23.875 65-69 20.05 28.065 27.889999999999997 23.995 70-74 20.044999999999998 28.29 27.794999999999998 23.87 75-79 20.02 28.33 28.425 23.225 80-84 20.3 28.04 27.91 23.75 85-89 20.32 28.144999999999996 27.805000000000003 23.73 90-94 20.455000000000002 28.444999999999997 28.095 23.005 95-99 20.169999999999998 28.685 27.415 23.73 100-104 20.05 28.475 27.744999999999997 23.73 105-109 19.86 28.515 27.67 23.955000000000002 110-114 20.485 28.395 27.224999999999998 23.895 115-119 20.465 28.9 27.325 23.31 120-124 20.72 28.665000000000003 26.755000000000003 23.86 125-129 20.615 28.43 27.315 23.64 130-134 20.48 28.349999999999998 27.455000000000002 23.715 135-139 20.45 27.98 27.32 24.25 140-144 21.044999999999998 28.205000000000002 26.97 23.78 145-149 21.165 28.465 26.71 23.66 150-151 20.4875 28.075 27.037499999999998 24.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 0.5 24 1.0 25 3.0 26 3.0 27 3.0 28 7.5 29 11.0 30 19.5 31 24.5 32 27.5 33 47.5 34 65.0 35 75.5 36 89.0 37 103.5 38 128.5 39 152.5 40 185.0 41 220.0 42 233.0 43 268.0 44 284.0 45 272.5 46 276.0 47 262.5 48 229.0 49 206.5 50 173.5 51 142.5 52 125.0 53 90.5 54 62.5 55 52.5 56 40.5 57 22.5 58 21.0 59 21.0 60 13.0 61 8.5 62 5.5 63 4.5 64 4.5 65 2.5 66 3.0 67 3.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.0 #Duplication Level Percentage of deduplicated Percentage of total 1 91.48351648351648 83.25 2 7.335164835164836 13.350000000000001 3 1.0164835164835164 2.775 4 0.13736263736263737 0.5 5 0.027472527472527472 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGTGTCCTCCTGATTCATTGTCCGAATCCGCCATAATAATATTAGTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.36250000000000004 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.7875000000000001 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.2000000000000002 0.0 0.0 0.0 0.0 100-101 1.325 0.0 0.0 0.0 0.0 102-103 1.5125000000000002 0.0 0.0 0.0 0.0 104-105 1.7375 0.0 0.0 0.0 0.0 106-107 1.9874999999999998 0.0 0.0 0.0 0.0 108-109 2.2125 0.0 0.0 0.0 0.0 110-111 2.425 0.0 0.0 0.0 0.0 112-113 2.85 0.0 0.0 0.0 0.0 114-115 3.0250000000000004 0.0 0.0 0.0 0.0 116-117 3.2375 0.0 0.0 0.0 0.0 118-119 3.7 0.0 0.0 0.0 0.0 120-121 4.1 0.0 0.0 0.0 0.0 122-123 4.512499999999999 0.0 0.0 0.0 0.0 124-125 4.9875 0.0 0.0 0.0 0.0 126-127 5.425000000000001 0.0 0.0 0.0 0.0 128-129 5.9125 0.0 0.0 0.0 0.0 130-131 6.3875 0.0 0.0 0.0 0.0 132-133 6.9875 0.0 0.0 0.0 0.0 134-135 7.5625 0.0 0.0 0.0 0.0 136-137 7.9875 0.0 0.0 0.0 0.0 138-139 8.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAGTC 20 0.00593511 29.0 140-144 TGAACTC 30 0.0014437955 24.166668 135-139 >>END_MODULE SRR12919320 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919320_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1605 37.0 37.0 37.0 37.0 37.0 2 36.137 37.0 37.0 37.0 37.0 37.0 3 36.223 37.0 37.0 37.0 37.0 37.0 4 36.124 37.0 37.0 37.0 37.0 37.0 5 36.3475 37.0 37.0 37.0 37.0 37.0 6 36.302 37.0 37.0 37.0 37.0 37.0 7 36.2125 37.0 37.0 37.0 37.0 37.0 8 36.314 37.0 37.0 37.0 37.0 37.0 9 36.26 37.0 37.0 37.0 37.0 37.0 10-14 36.314699999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.288 37.0 37.0 37.0 37.0 37.0 20-24 36.278499999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.20250000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.131299999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.1353 37.0 37.0 37.0 37.0 37.0 40-44 36.0843 37.0 37.0 37.0 37.0 37.0 45-49 36.0786 37.0 37.0 37.0 37.0 37.0 50-54 36.0165 37.0 37.0 37.0 37.0 37.0 55-59 35.9989 37.0 37.0 37.0 37.0 37.0 60-64 35.9696 37.0 37.0 37.0 37.0 37.0 65-69 36.0173 37.0 37.0 37.0 37.0 37.0 70-74 35.9519 37.0 37.0 37.0 37.0 37.0 75-79 35.9311 37.0 37.0 37.0 37.0 37.0 80-84 35.9288 37.0 37.0 37.0 37.0 37.0 85-89 35.8757 37.0 37.0 37.0 37.0 37.0 90-94 35.8123 37.0 37.0 37.0 37.0 37.0 95-99 35.833 37.0 37.0 37.0 37.0 37.0 100-104 35.7734 37.0 37.0 37.0 37.0 37.0 105-109 35.7127 37.0 37.0 37.0 37.0 37.0 110-114 35.7615 37.0 37.0 37.0 37.0 37.0 115-119 35.709500000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.59160000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.57189999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.47520000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.23369999999999 37.0 37.0 37.0 32.2 37.0 140-144 35.2397 37.0 37.0 37.0 29.8 37.0 145-149 35.117599999999996 37.0 37.0 37.0 29.8 37.0 150-151 34.94425 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 1.0 15 6.0 16 4.0 17 0.0 18 0.0 19 1.0 20 2.0 21 5.0 22 6.0 23 3.0 24 6.0 25 9.0 26 3.0 27 8.0 28 15.0 29 17.0 30 29.0 31 44.0 32 60.0 33 94.0 34 224.0 35 554.0 36 2632.0 37 274.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.975 28.549999999999997 6.525 22.95 2 26.724999999999998 27.950000000000003 30.175 15.15 3 18.775 28.000000000000004 34.825 18.4 4 23.9 33.425 23.9 18.775 5 26.174999999999997 36.05 20.8 16.975 6 20.5 39.65 22.275 17.575 7 22.475 23.175 36.275 18.075 8 21.475 25.324999999999996 28.075 25.124999999999996 9 22.375 24.825 30.65 22.15 10-14 24.08 28.804999999999996 26.3 20.815 15-19 23.275000000000002 28.194999999999997 27.805000000000003 20.724999999999998 20-24 23.76 27.884999999999998 27.800000000000004 20.555 25-29 23.445 27.894999999999996 27.575 21.085 30-34 23.665 27.87 28.095 20.369999999999997 35-39 23.855 28.18 27.279999999999998 20.685000000000002 40-44 23.044999999999998 28.449999999999996 27.705000000000002 20.8 45-49 23.5 28.044999999999998 27.925 20.53 50-54 23.635 28.794999999999998 27.474999999999998 20.095 55-59 23.474999999999998 29.285 27.384999999999998 19.855 60-64 23.49 28.925 27.750000000000004 19.835 65-69 23.47 28.52 27.534999999999997 20.474999999999998 70-74 23.674999999999997 27.755000000000003 27.54 21.029999999999998 75-79 22.825 28.155 28.444999999999997 20.575 80-84 23.405 28.095 27.944999999999997 20.555 85-89 24.224999999999998 27.83 27.24 20.705000000000002 90-94 24.169999999999998 28.415000000000003 27.12 20.294999999999998 95-99 24.099999999999998 27.839999999999996 27.57 20.49 100-104 23.87 28.134999999999998 27.939999999999998 20.055 105-109 24.375 27.99 27.534999999999997 20.1 110-114 24.415 27.295 28.04 20.25 115-119 24.575 27.900000000000002 27.625 19.900000000000002 120-124 24.560000000000002 28.025 27.345000000000002 20.07 125-129 24.46 27.800000000000004 27.12 20.62 130-134 24.81 28.060000000000002 27.295 19.835 135-139 25.074999999999996 27.62 27.82 19.485 140-144 25.94 28.03 26.484999999999996 19.545 145-149 26.075 27.465 27.315 19.145 150-151 26.737499999999997 27.075 27.437499999999996 18.75 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.0 20 1.5 21 2.5 22 2.0 23 2.5 24 4.0 25 2.0 26 2.5 27 6.5 28 9.5 29 11.5 30 14.0 31 17.0 32 26.0 33 38.5 34 47.5 35 54.5 36 88.0 37 115.0 38 134.0 39 164.5 40 193.5 41 222.5 42 244.5 43 272.0 44 298.0 45 295.5 46 278.5 47 252.0 48 223.5 49 208.5 50 163.0 51 113.0 52 98.0 53 90.0 54 70.0 55 53.0 56 47.0 57 35.5 58 20.5 59 18.0 60 14.5 61 7.5 62 4.0 63 3.5 64 4.0 65 2.0 66 0.0 67 0.0 68 1.0 69 1.5 70 0.5 71 0.5 72 1.5 73 1.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.5 94 1.5 95 1.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.025 #Duplication Level Percentage of deduplicated Percentage of total 1 91.51332051634166 83.3 2 7.3606152156001095 13.4 3 0.9612743751716563 2.625 4 0.10985992859104642 0.4 5 0.027464982147761604 0.125 6 0.027464982147761604 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CTCCAATTTCCCGGTTAATCCTCTGGGTTTCCTAATTTGCCCCTCCTCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.36250000000000004 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.5874999999999999 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.1125 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.75 0.0 0.0 0.0 0.0 106-107 2.0125 0.0 0.0 0.0 0.0 108-109 2.275 0.0 0.0 0.0 0.0 110-111 2.5 0.0 0.0 0.0 0.0 112-113 2.925 0.0 0.0 0.0 0.0 114-115 3.0999999999999996 0.0 0.0 0.0 0.0 116-117 3.3125 0.0 0.0 0.0 0.0 118-119 3.7750000000000004 0.0 0.0 0.0 0.0 120-121 4.175000000000001 0.0 0.0 0.0 0.0 122-123 4.5875 0.0 0.0 0.0 0.0 124-125 5.0625 0.0 0.0 0.0 0.0 126-127 5.5 0.0 0.0 0.0 0.0 128-129 5.9875 0.0 0.0 0.0 0.0 130-131 6.4625 0.0 0.0 0.0 0.0 132-133 7.0625 0.0 0.0 0.0 0.0 134-135 7.637499999999999 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138-139 8.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCTGCA 10 0.006830828 145.0 9 TTCTATG 10 0.006830828 145.0 9 TAGGGAA 20 0.00593511 29.0 135-139 AAAGAGT 20 0.00593511 29.0 140-144 >>END_MODULE Read 992346 spots for SRR12919320.sra Written 992346 spots for SRR12919320.sra Read 992346 spots for SRR12919320.sra Written 992346 spots for SRR12919320.sra Read 992346 spots for SRR12919320.sra Written 992346 spots for SRR12919320.sra Read 992346 spots for SRR12919320.sra Written 992346 spots for SRR12919320.sra Read 992346 spots for SRR12919320.sra Written 992346 spots for SRR12919320.sra Read 992346 spots for SRR12919320.sra Written 992346 spots for SRR12919320.sra Read 992349 spots for SRR12919320.sra Written 992349 spots for SRR12919320.sra Read 992346 spots for SRR12919320.sra Written 992346 spots for SRR12919320.sra Read 992346 spots for SRR12919320.sra Written 992346 spots for SRR12919320.sra Read 992346 spots for SRR12919320.sra Written 992346 spots for SRR12919320.sra Read 992346 spots for SRR12919320.sra Written 992346 spots for SRR12919320.sra Read 992346 spots for SRR12919320.sra Written 992346 spots for SRR12919320.sra Read 992346 spots for SRR12919320.sra Written 992346 spots for SRR12919320.sra Read 992346 spots for SRR12919320.sra Written 992346 spots for SRR12919320.sra Read 992346 spots for SRR12919320.sra Written 992346 spots for SRR12919320.sra Read 992346 spots for SRR12919320.sra Written 992346 spots for SRR12919320.sra Read 992346 spots for SRR12919320.sra Written 992346 spots for SRR12919320.sra Read 992346 spots for SRR12919320.sra Written 992346 spots for SRR12919320.sra Read 992346 spots for SRR12919320.sra Written 992346 spots for SRR12919320.sra Read 992346 spots for SRR12919320.sra Written 992346 spots for SRR12919320.sra SRR ids: ['SRR12919320.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zts_08kj SRR12919320.sra spots: 19846923 blocks: [[1, 992346], [992347, 1984692], [1984693, 2977038], [2977039, 3969384], [3969385, 4961730], [4961731, 5954076], [5954077, 6946422], [6946423, 7938768], [7938769, 8931114], [8931115, 9923460], [9923461, 10915806], [10915807, 11908152], [11908153, 12900498], [12900499, 13892844], [13892845, 14885190], [14885191, 15877536], [15877537, 16869882], [16869883, 17862228], [17862229, 18854574], [18854575, 19846923]] SRR12919320 file size 6723152 SRR12919320 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919320 SRR12919320_1.fastq SRR12919320_2.fastq Input file: SRR12919320_1.fastq Paired file: SRR12919320_2.fastq trimmed: SRR12919320-trimmed-pair1.fastq, SRR12919320-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:50:35 2025 >> started Wed Feb 12 18:50:58 2025 >> done (22.453s) 19846923 read pairs processed; of these: 32 ( 0.00%) short read pairs filtered out after trimming by size control 371 ( 0.00%) empty read pairs filtered out after trimming by size control 19846520 (100.00%) read pairs available; of these: 2308957 (11.63%) trimmed read pairs available after processing 17537563 (88.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 3 0.00% 21 3 0.00% 22 7 0.00% 23 6 0.00% 24 11 0.00% 25 4 0.00% 26 10 0.00% 27 7 0.00% 28 14 0.00% 29 10 0.00% 30 17 0.00% 31 18 0.00% 32 5 0.00% 33 17 0.00% 34 26 0.00% 35 22 0.00% 36 20 0.00% 37 29 0.00% 38 20 0.00% 39 28 0.00% 40 33 0.00% 41 43 0.00% 42 41 0.00% 43 41 0.00% 44 40 0.00% 45 44 0.00% 46 46 0.00% 47 73 0.00% 48 78 0.00% 49 95 0.00% 50 91 0.00% 51 107 0.00% 52 117 0.00% 53 142 0.00% 54 148 0.00% 55 191 0.00% 56 192 0.00% 57 194 0.00% 58 238 0.00% 59 274 0.00% 60 315 0.00% 61 439 0.00% 62 447 0.00% 63 528 0.00% 64 518 0.00% 65 610 0.00% 66 625 0.00% 67 716 0.00% 68 815 0.00% 69 911 0.00% 70 1081 0.01% 71 1276 0.01% 72 1534 0.01% 73 1783 0.01% 74 1907 0.01% 75 2009 0.01% 76 2385 0.01% 77 2522 0.01% 78 2720 0.01% 79 3042 0.02% 80 3558 0.02% 81 4016 0.02% 82 4813 0.02% 83 5176 0.03% 84 5700 0.03% 85 6353 0.03% 86 6751 0.03% 87 7017 0.04% 88 7548 0.04% 89 8215 0.04% 90 8950 0.05% 91 9856 0.05% 92 10891 0.05% 93 12404 0.06% 94 13353 0.07% 95 14311 0.07% 96 14864 0.07% 97 15346 0.08% 98 15952 0.08% 99 16555 0.08% 100 17554 0.09% 101 18627 0.09% 102 19994 0.10% 103 21522 0.11% 104 23257 0.12% 105 23925 0.12% 106 24717 0.12% 107 25690 0.13% 108 25958 0.13% 109 26343 0.13% 110 26884 0.14% 111 28108 0.14% 112 29624 0.15% 113 31007 0.16% 114 32605 0.16% 115 33675 0.17% 116 34369 0.17% 117 35133 0.18% 118 35176 0.18% 119 35628 0.18% 120 36137 0.18% 121 37028 0.19% 122 38047 0.19% 123 39769 0.20% 124 41479 0.21% 125 42546 0.21% 126 43993 0.22% 127 44452 0.22% 128 44470 0.22% 129 44580 0.22% 130 45443 0.23% 131 45689 0.23% 132 46554 0.23% 133 48744 0.25% 134 49648 0.25% 135 51644 0.26% 136 51541 0.26% 137 51991 0.26% 138 52434 0.26% 139 52575 0.26% 140 52835 0.27% 141 53773 0.27% 142 54493 0.27% 143 55065 0.28% 144 57678 0.29% 145 58068 0.29% 146 58967 0.30% 147 59603 0.30% 148 59710 0.30% 149 59746 0.30% 150 60136 0.30% 151 17537563 88.37% 19846520 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=8.83 fanout-score-rank=16 prefix-density=0.32 prefix-fanout=4.5 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=230.92 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=27.7 sequence=TCATCTTCATCA criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=19.69 fanout-score-rank=13 prefix-density=0.32 prefix-fanout=8.6 sequence=TTTGACAAGAAGCAGTTTCTTACACAGATTAAGAAATTTATCAAGAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=436.61 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=32.6 sequence=AAGAAGAAGAAG SRR12919320 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:51:43 Started mapping on | Feb 12 18:51:43 Finished on | Feb 12 18:54:25 Mapping speed, Million of reads per hour | 441.03 Number of input reads | 19846520 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 18085722 Uniquely mapped reads % | 91.13% Average mapped length | 294.71 Number of splices: Total | 17571287 Number of splices: Annotated (sjdb) | 17171183 Number of splices: GT/AG | 17246913 Number of splices: GC/AG | 252637 Number of splices: AT/AC | 18763 Number of splices: Non-canonical | 52974 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 3.01 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 512327 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 84753 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.68% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1248471 1248471 1248471 N_multimapping 512327 512327 512327 N_noFeature 619320 17878117 713516 N_ambiguous 224020 1227 109789 UnstrandedReadsAssigned:17242382 PositiveStrandReadsAssigned:206378 NegativeStrandReadsAssigned:17262417 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919320 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919320-trimmed-pair1.fastq SRR12919320-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,846,520 reads, 17,403,907 reads pseudoaligned [quant] estimated average fragment length: 258.558 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52401 SRR12919320.ke.tsv 34699 SRR12919320.se.tsv 87100 total ==> SRR12919320.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.44 1039 34.4977 Potri.005G024800.1.v4.1 1035 777.442 303 22.7809 Potri.004G059700.1.v4.1 961 703.612 42 3.48909 Potri.007G009000.2.v4.1 1416 1158.44 1 0.0504571 Potri.003G141000.2.v4.1 2943 2685.44 586.687 12.7699 Potri.016G087400.1.v4.1 270 87.5448 2026 1352.71 Potri.015G069301.1.v4.1 564 321.939 0 0 Potri.010G195200.1.v4.1 1773 1515.44 147.7 5.69688 Potri.012G127500.1.v4.1 977 719.553 10656 865.622 ==> SRR12919320.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 174 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 371 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 70 SRR12919320 completed mapping pipeline successfully