Starting /dee2/code/volunteer_pipeline.sh SRR12919321 current disk space = 3051343142912 free memory = 1469204916 SRR12919321 SRAfilesize 14ee18d7b3869b9685a0845729f6d611 SRR12919321.sra SRR12919321.sra file validated SRR12919321 is paired end SRR12919321 is conventional basespace SRR12919321 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919321_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.424 37.0 37.0 37.0 37.0 37.0 2 36.25525 37.0 37.0 37.0 37.0 37.0 3 36.6295 37.0 37.0 37.0 37.0 37.0 4 36.6175 37.0 37.0 37.0 37.0 37.0 5 36.57 37.0 37.0 37.0 37.0 37.0 6 36.662 37.0 37.0 37.0 37.0 37.0 7 36.5795 37.0 37.0 37.0 37.0 37.0 8 36.69 37.0 37.0 37.0 37.0 37.0 9 36.591 37.0 37.0 37.0 37.0 37.0 10-14 36.659800000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.62370000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.593 37.0 37.0 37.0 37.0 37.0 25-29 36.5548 37.0 37.0 37.0 37.0 37.0 30-34 36.5399 37.0 37.0 37.0 37.0 37.0 35-39 36.4807 37.0 37.0 37.0 37.0 37.0 40-44 36.5119 37.0 37.0 37.0 37.0 37.0 45-49 36.4624 37.0 37.0 37.0 37.0 37.0 50-54 36.4429 37.0 37.0 37.0 37.0 37.0 55-59 36.4151 37.0 37.0 37.0 37.0 37.0 60-64 36.392 37.0 37.0 37.0 37.0 37.0 65-69 36.3497 37.0 37.0 37.0 37.0 37.0 70-74 36.282000000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.2859 37.0 37.0 37.0 37.0 37.0 80-84 36.3063 37.0 37.0 37.0 37.0 37.0 85-89 36.2069 37.0 37.0 37.0 37.0 37.0 90-94 36.2216 37.0 37.0 37.0 37.0 37.0 95-99 36.215799999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.1967 37.0 37.0 37.0 37.0 37.0 105-109 36.1139 37.0 37.0 37.0 37.0 37.0 110-114 36.0698 37.0 37.0 37.0 37.0 37.0 115-119 36.0406 37.0 37.0 37.0 37.0 37.0 120-124 36.058299999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.951800000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.8996 37.0 37.0 37.0 37.0 37.0 135-139 35.8524 37.0 37.0 37.0 37.0 37.0 140-144 35.7081 37.0 37.0 37.0 37.0 37.0 145-149 35.8152 37.0 37.0 37.0 37.0 37.0 150-151 35.598 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 9.0 27 8.0 28 15.0 29 17.0 30 26.0 31 34.0 32 44.0 33 72.0 34 122.0 35 301.0 36 2964.0 37 388.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.65 12.925 5.1 44.324999999999996 2 18.33039979884335 12.144832788534071 39.225546894644204 30.299220517978377 3 17.299999999999997 17.325 27.250000000000004 38.125 4 19.950000000000003 23.5 24.75 31.8 5 21.099999999999998 30.95 24.2 23.75 6 19.900000000000002 34.825 23.9 21.375 7 16.05 26.174999999999997 40.125 17.65 8 17.549999999999997 26.525 31.525 24.4 9 16.575 24.875 36.625 21.925 10-14 19.46 29.375 28.194999999999997 22.97 15-19 19.215 27.994999999999997 28.22 24.57 20-24 18.98 28.610000000000003 28.299999999999997 24.11 25-29 19.13 28.294999999999998 28.560000000000002 24.015 30-34 19.825 28.165000000000003 27.82 24.19 35-39 19.685 28.92 27.650000000000002 23.745 40-44 19.885 28.435 28.050000000000004 23.630000000000003 45-49 19.99 28.144999999999996 27.400000000000002 24.465 50-54 19.865 28.355000000000004 28.055000000000003 23.724999999999998 55-59 20.035 27.96 27.83 24.175 60-64 19.965 27.805000000000003 28.015 24.215 65-69 20.485 28.375 27.474999999999998 23.665 70-74 19.830000000000002 28.67 27.744999999999997 23.755000000000003 75-79 20.22 27.865000000000002 27.975 23.94 80-84 19.98 28.535 27.605 23.880000000000003 85-89 20.205000000000002 28.24 28.03 23.525 90-94 20.064999999999998 28.299999999999997 27.565 24.07 95-99 20.485 28.360000000000003 27.884999999999998 23.27 100-104 20.265 28.499999999999996 27.38 23.855 105-109 20.18 28.194999999999997 28.125 23.5 110-114 20.445 28.299999999999997 27.689999999999998 23.565 115-119 20.39 28.325 28.065 23.22 120-124 20.424999999999997 28.115000000000002 27.125 24.335 125-129 20.1 28.46 27.46 23.98 130-134 20.8 27.83 27.595 23.775 135-139 21.255 28.055000000000003 27.18 23.51 140-144 20.185 27.96 27.955000000000002 23.9 145-149 20.465 27.91 28.105000000000004 23.52 150-151 20.1125 27.987499999999997 27.6 24.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.0 23 2.0 24 3.0 25 3.5 26 5.5 27 6.0 28 9.0 29 16.0 30 20.5 31 22.5 32 28.0 33 40.0 34 47.0 35 56.5 36 80.0 37 97.5 38 121.5 39 167.0 40 193.0 41 218.5 42 256.0 43 270.0 44 276.0 45 265.0 46 255.0 47 266.0 48 238.5 49 205.5 50 180.0 51 146.0 52 121.5 53 94.0 54 72.0 55 47.5 56 39.5 57 35.0 58 24.0 59 21.5 60 15.0 61 10.5 62 8.0 63 3.5 64 2.5 65 2.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.85 #Duplication Level Percentage of deduplicated Percentage of total 1 92.21556886227546 84.7 2 6.88622754491018 12.65 3 0.7621121393576483 2.1 4 0.10887316276537834 0.4 5 0.0 0.0 6 0.027218290691344585 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTAGCAACATACCCACCTCCATCATTCCTCTGGTAATGCGAGCTTTGCAT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.5375 0.0 0.0 0.0 0.0 108-109 0.65 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.9625 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.675 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.1125 0.0 0.0 0.0 0.0 124-125 2.4125 0.0 0.0 0.0 0.0 126-127 2.6500000000000004 0.0 0.0 0.0 0.0 128-129 2.8875 0.0 0.0 0.0 0.0 130-131 3.2874999999999996 0.0 0.0 0.0 0.0 132-133 3.6375 0.0 0.0 0.0 0.0 134-135 3.925 0.0 0.0 0.0 0.0 136-137 4.175 0.0 0.0 0.0 0.0 138-139 4.612500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGTAA 10 0.006830828 145.0 1 >>END_MODULE SRR12919321 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919321_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0905 37.0 37.0 37.0 37.0 37.0 2 36.122 37.0 37.0 37.0 37.0 37.0 3 36.0895 37.0 37.0 37.0 37.0 37.0 4 36.1325 37.0 37.0 37.0 37.0 37.0 5 36.159 37.0 37.0 37.0 37.0 37.0 6 36.1225 37.0 37.0 37.0 37.0 37.0 7 36.2035 37.0 37.0 37.0 37.0 37.0 8 36.196 37.0 37.0 37.0 37.0 37.0 9 36.0945 37.0 37.0 37.0 37.0 37.0 10-14 36.238600000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.20119999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.1437 37.0 37.0 37.0 37.0 37.0 25-29 36.1007 37.0 37.0 37.0 37.0 37.0 30-34 36.0856 37.0 37.0 37.0 37.0 37.0 35-39 36.0502 37.0 37.0 37.0 37.0 37.0 40-44 35.9741 37.0 37.0 37.0 37.0 37.0 45-49 36.0101 37.0 37.0 37.0 37.0 37.0 50-54 35.935199999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.923700000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.9161 37.0 37.0 37.0 37.0 37.0 65-69 35.8377 37.0 37.0 37.0 37.0 37.0 70-74 35.83990000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.8053 37.0 37.0 37.0 37.0 37.0 80-84 35.7564 37.0 37.0 37.0 37.0 37.0 85-89 35.7824 37.0 37.0 37.0 37.0 37.0 90-94 35.6768 37.0 37.0 37.0 37.0 37.0 95-99 35.704600000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.617399999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.5944 37.0 37.0 37.0 37.0 37.0 110-114 35.564800000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.571600000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.49249999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.4435 37.0 37.0 37.0 37.0 37.0 130-134 35.438 37.0 37.0 37.0 37.0 37.0 135-139 35.34669999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.3267 37.0 37.0 37.0 32.2 37.0 145-149 35.199200000000005 37.0 37.0 37.0 27.4 37.0 150-151 35.093 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 0.0 17 1.0 18 0.0 19 2.0 20 2.0 21 0.0 22 5.0 23 3.0 24 11.0 25 7.0 26 11.0 27 16.0 28 22.0 29 29.0 30 38.0 31 47.0 32 78.0 33 88.0 34 234.0 35 617.0 36 2547.0 37 239.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.675000000000004 26.85 8.75 28.725 2 26.3 26.85 31.3 15.55 3 19.55 28.65 31.874999999999996 19.925 4 22.35 33.75 25.05 18.85 5 24.349999999999998 36.875 21.325 17.45 6 19.775000000000002 39.050000000000004 22.1 19.075 7 21.075 22.55 39.25 17.125 8 20.474999999999998 25.874999999999996 30.075000000000003 23.575 9 22.650000000000002 25.0 30.349999999999998 22.0 10-14 23.51 29.630000000000003 26.045 20.815 15-19 22.634999999999998 28.455000000000002 27.755000000000003 21.154999999999998 20-24 22.755 28.449999999999996 28.02 20.775 25-29 23.235 27.900000000000002 28.035 20.830000000000002 30-34 23.155 27.894999999999996 28.175 20.775 35-39 23.02 28.765 27.96 20.255000000000003 40-44 22.96 28.244999999999997 28.09 20.705000000000002 45-49 23.415 27.944999999999997 28.365000000000002 20.275000000000002 50-54 23.275000000000002 28.255000000000003 27.87 20.599999999999998 55-59 23.474999999999998 27.71 27.98 20.835 60-64 23.06 27.465 28.735 20.74 65-69 23.62 27.334999999999997 28.084999999999997 20.96 70-74 23.07 28.435 27.96 20.535 75-79 23.54 27.63 28.455000000000002 20.375 80-84 23.57 28.29 27.595 20.544999999999998 85-89 23.54 27.55 28.09 20.82 90-94 23.94 28.34 27.41 20.31 95-99 23.305 27.98 27.875 20.84 100-104 24.740000000000002 27.49 27.205000000000002 20.565 105-109 23.535 27.88 27.685 20.9 110-114 23.830000000000002 28.17 27.88 20.119999999999997 115-119 24.035 27.71 27.625 20.630000000000003 120-124 24.095 29.205 27.04 19.66 125-129 24.654999999999998 27.944999999999997 27.21 20.19 130-134 24.84 28.08 27.01 20.07 135-139 24.755 27.47 27.965 19.81 140-144 24.529999999999998 28.275 27.42 19.775000000000002 145-149 24.82 27.98 27.18 20.02 150-151 24.5375 28.075 27.55 19.8375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 1.5 21 1.0 22 1.0 23 2.5 24 3.0 25 3.5 26 4.0 27 7.0 28 12.0 29 15.0 30 19.0 31 22.5 32 24.0 33 37.0 34 57.5 35 66.0 36 78.5 37 97.0 38 128.5 39 167.5 40 217.0 41 250.0 42 259.0 43 267.5 44 269.0 45 276.5 46 273.5 47 249.5 48 222.0 49 201.5 50 167.5 51 128.0 52 108.0 53 89.5 54 69.5 55 53.5 56 35.5 57 25.0 58 20.5 59 15.5 60 8.5 61 9.0 62 8.5 63 5.5 64 4.0 65 3.0 66 2.5 67 1.0 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.375 #Duplication Level Percentage of deduplicated Percentage of total 1 92.6657645466847 85.6 2 6.549391069012178 12.1 3 0.7036535859269283 1.95 4 0.05412719891745603 0.2 5 0.0 0.0 6 0.027063599458728015 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTCTTTTCGGAGTTTGGAGAGATTGAAGAAGGACCATTAGGGCTTGAT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0125 0.0 106-107 0.5625 0.0 0.0 0.025 0.0 108-109 0.675 0.0 0.0 0.025 0.0 110-111 0.7875 0.0 0.0 0.025 0.0 112-113 0.9875 0.0 0.0 0.025 0.0 114-115 1.225 0.0 0.0 0.025 0.0 116-117 1.4125 0.0 0.0 0.025 0.0 118-119 1.7 0.0 0.0 0.025 0.0 120-121 1.95 0.0 0.0 0.025 0.0 122-123 2.1375 0.0 0.0 0.025 0.0 124-125 2.4375 0.0 0.0 0.025 0.0 126-127 2.675 0.0 0.0 0.025 0.0 128-129 2.9124999999999996 0.0 0.0 0.025 0.0 130-131 3.3125 0.0 0.0 0.025 0.0 132-133 3.6625 0.0 0.0 0.025 0.0 134-135 3.95 0.0 0.0 0.025 0.0 136-137 4.2 0.0 0.0 0.025 0.0 138-139 4.637499999999999 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 917581 spots for SRR12919321.sra Written 917581 spots for SRR12919321.sra Read 917581 spots for SRR12919321.sra Written 917581 spots for SRR12919321.sra Read 917581 spots for SRR12919321.sra Written 917581 spots for SRR12919321.sra Read 917581 spots for SRR12919321.sra Written 917581 spots for SRR12919321.sra Read 917581 spots for SRR12919321.sra Written 917581 spots for SRR12919321.sra Read 917581 spots for SRR12919321.sra Written 917581 spots for SRR12919321.sra Read 917581 spots for SRR12919321.sra Written 917581 spots for SRR12919321.sra Read 917581 spots for SRR12919321.sra Written 917581 spots for SRR12919321.sra Read 917581 spots for SRR12919321.sra Written 917581 spots for SRR12919321.sra Read 917581 spots for SRR12919321.sra Written 917581 spots for SRR12919321.sra Read 917581 spots for SRR12919321.sra Written 917581 spots for SRR12919321.sra Read 917581 spots for SRR12919321.sra Written 917581 spots for SRR12919321.sra Read 917581 spots for SRR12919321.sra Written 917581 spots for SRR12919321.sra Read 917581 spots for SRR12919321.sra Written 917581 spots for SRR12919321.sra Read 917581 spots for SRR12919321.sra Written 917581 spots for SRR12919321.sra Read 917581 spots for SRR12919321.sra Written 917581 spots for SRR12919321.sra Read 917595 spots for SRR12919321.sra Written 917595 spots for SRR12919321.sra Read 917581 spots for SRR12919321.sra Written 917581 spots for SRR12919321.sra Read 917581 spots for SRR12919321.sra Written 917581 spots for SRR12919321.sra Read 917581 spots for SRR12919321.sra Written 917581 spots for SRR12919321.sra SRR ids: ['SRR12919321.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_07jgwf3c SRR12919321.sra spots: 18351634 blocks: [[1, 917581], [917582, 1835162], [1835163, 2752743], [2752744, 3670324], [3670325, 4587905], [4587906, 5505486], [5505487, 6423067], [6423068, 7340648], [7340649, 8258229], [8258230, 9175810], [9175811, 10093391], [10093392, 11010972], [11010973, 11928553], [11928554, 12846134], [12846135, 13763715], [13763716, 14681296], [14681297, 15598877], [15598878, 16516458], [16516459, 17434039], [17434040, 18351634]] SRR12919321 file size 6214987 SRR12919321 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919321 SRR12919321_1.fastq SRR12919321_2.fastq Input file: SRR12919321_1.fastq Paired file: SRR12919321_2.fastq trimmed: SRR12919321-trimmed-pair1.fastq, SRR12919321-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:18:42 2025 >> started Wed Feb 12 18:19:14 2025 >> done (32.387s) 18351634 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 213 ( 0.00%) empty read pairs filtered out after trimming by size control 18351390 (100.00%) read pairs available; of these: 1519737 ( 8.28%) trimmed read pairs available after processing 16831653 (91.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 4 0.00% 21 3 0.00% 22 4 0.00% 23 2 0.00% 24 2 0.00% 25 5 0.00% 26 1 0.00% 27 8 0.00% 28 8 0.00% 29 10 0.00% 30 7 0.00% 31 10 0.00% 32 10 0.00% 33 8 0.00% 34 15 0.00% 35 17 0.00% 36 8 0.00% 37 16 0.00% 38 10 0.00% 39 12 0.00% 40 19 0.00% 41 17 0.00% 42 21 0.00% 43 22 0.00% 44 16 0.00% 45 22 0.00% 46 20 0.00% 47 35 0.00% 48 21 0.00% 49 25 0.00% 50 53 0.00% 51 40 0.00% 52 45 0.00% 53 41 0.00% 54 44 0.00% 55 42 0.00% 56 60 0.00% 57 56 0.00% 58 66 0.00% 59 96 0.00% 60 110 0.00% 61 101 0.00% 62 115 0.00% 63 157 0.00% 64 162 0.00% 65 177 0.00% 66 183 0.00% 67 198 0.00% 68 266 0.00% 69 274 0.00% 70 379 0.00% 71 410 0.00% 72 502 0.00% 73 527 0.00% 74 638 0.00% 75 684 0.00% 76 746 0.00% 77 860 0.00% 78 969 0.01% 79 1145 0.01% 80 1270 0.01% 81 1443 0.01% 82 1697 0.01% 83 1931 0.01% 84 2177 0.01% 85 2421 0.01% 86 2626 0.01% 87 2965 0.02% 88 3248 0.02% 89 3532 0.02% 90 3951 0.02% 91 4332 0.02% 92 4974 0.03% 93 5467 0.03% 94 6069 0.03% 95 6578 0.04% 96 7263 0.04% 97 7619 0.04% 98 8040 0.04% 99 8716 0.05% 100 8929 0.05% 101 9665 0.05% 102 10567 0.06% 103 11417 0.06% 104 12422 0.07% 105 13112 0.07% 106 13845 0.08% 107 14142 0.08% 108 14960 0.08% 109 15402 0.08% 110 15969 0.09% 111 16731 0.09% 112 17751 0.10% 113 18108 0.10% 114 19726 0.11% 115 20596 0.11% 116 21140 0.12% 117 22132 0.12% 118 22625 0.12% 119 23261 0.13% 120 23679 0.13% 121 24393 0.13% 122 24766 0.13% 123 26162 0.14% 124 27542 0.15% 125 27998 0.15% 126 29185 0.16% 127 29999 0.16% 128 30380 0.17% 129 31349 0.17% 130 31806 0.17% 131 31920 0.17% 132 33155 0.18% 133 34278 0.19% 134 34870 0.19% 135 35625 0.19% 136 36720 0.20% 137 37701 0.21% 138 38161 0.21% 139 38900 0.21% 140 38716 0.21% 141 39961 0.22% 142 40352 0.22% 143 40981 0.22% 144 42610 0.23% 145 43566 0.24% 146 43837 0.24% 147 44611 0.24% 148 45509 0.25% 149 45584 0.25% 150 47070 0.26% 151 16831653 91.72% 18351390 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=21.13 fanout-score-rank=14 prefix-density=0.32 prefix-fanout=7.1 sequence=TTTCTCAATTTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=487.35 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=36.2 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=7.95 fanout-score-rank=26 prefix-density=0.27 prefix-fanout=4.7 sequence=AAGTTCAAAGATGACGTTACCAGAGAGCAAATTGAGAAAATCATAAACGACTTCACTCATCTGGTCAATCAAGTTGAACCCTTGAAGAGCTTACACTGGGGCACTAATCTGGGTATTCACGACCTCAATTTCGGATATACTCATGCTTTTGAAACTACCTTTGATGATCTGGAGGGCTTGCAGGAGTATCTTGATTCTTCGGTTGTTGCTAAATTCGCAGAAGGATTCTTGCCAACCATGTCGCAACAATTTGTGAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=401.73 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=33.9 sequence=AAGAAGAAGAAA SRR12919321 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:19:58 Started mapping on | Feb 12 18:19:58 Finished on | Feb 12 18:25:06 Mapping speed, Million of reads per hour | 214.50 Number of input reads | 18351390 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 17055585 Uniquely mapped reads % | 92.94% Average mapped length | 296.82 Number of splices: Total | 16589468 Number of splices: Annotated (sjdb) | 16206522 Number of splices: GT/AG | 16293573 Number of splices: GC/AG | 230286 Number of splices: AT/AC | 17545 Number of splices: Non-canonical | 48064 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 454193 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 59436 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.12% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 841612 841612 841612 N_multimapping 454193 454193 454193 N_noFeature 641216 16864786 736256 N_ambiguous 208492 1396 111760 UnstrandedReadsAssigned:16205877 PositiveStrandReadsAssigned:189403 NegativeStrandReadsAssigned:16207569 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919321 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919321-trimmed-pair1.fastq SRR12919321-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,351,390 reads, 16,278,760 reads pseudoaligned [quant] estimated average fragment length: 273.186 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR12919321.ke.tsv 34699 SRR12919321.se.tsv 87100 total ==> SRR12919321.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.81 906 31.7002 Potri.005G024800.1.v4.1 1035 762.814 550 44.0429 Potri.004G059700.1.v4.1 961 689.043 64 5.67369 Potri.007G009000.2.v4.1 1416 1143.81 0 0 Potri.003G141000.2.v4.1 2943 2670.81 590.374 13.5025 Potri.016G087400.1.v4.1 270 80.5869 1400.07 1061.25 Potri.015G069301.1.v4.1 564 309.391 0 0 Potri.010G195200.1.v4.1 1773 1500.81 84 3.41888 Potri.012G127500.1.v4.1 977 704.938 6058 524.94 ==> SRR12919321.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 297 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 210 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 1 SRR12919321 completed mapping pipeline successfully