Starting /dee2/code/volunteer_pipeline.sh SRR12919322 current disk space = 3051193376768 free memory = 1578613304 SRR12919322 SRAfilesize d13d33071a29ae78976652bae248e27d SRR12919322.sra SRR12919322.sra file validated SRR12919322 is paired end SRR12919322 is conventional basespace SRR12919322 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919322_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4945 37.0 37.0 37.0 37.0 37.0 2 36.11425 37.0 37.0 37.0 37.0 37.0 3 36.578 37.0 37.0 37.0 37.0 37.0 4 36.5835 37.0 37.0 37.0 37.0 37.0 5 36.636 37.0 37.0 37.0 37.0 37.0 6 36.6335 37.0 37.0 37.0 37.0 37.0 7 36.5445 37.0 37.0 37.0 37.0 37.0 8 36.6955 37.0 37.0 37.0 37.0 37.0 9 36.6505 37.0 37.0 37.0 37.0 37.0 10-14 36.6372 37.0 37.0 37.0 37.0 37.0 15-19 36.610200000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.59160000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.53920000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.515499999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.4524 37.0 37.0 37.0 37.0 37.0 40-44 36.4187 37.0 37.0 37.0 37.0 37.0 45-49 36.4225 37.0 37.0 37.0 37.0 37.0 50-54 36.4345 37.0 37.0 37.0 37.0 37.0 55-59 36.41330000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.354699999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.3481 37.0 37.0 37.0 37.0 37.0 70-74 36.3245 37.0 37.0 37.0 37.0 37.0 75-79 36.272999999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.28580000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.196600000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.1357 37.0 37.0 37.0 37.0 37.0 95-99 36.1732 37.0 37.0 37.0 37.0 37.0 100-104 36.099599999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.104600000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.0507 37.0 37.0 37.0 37.0 37.0 115-119 36.039100000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.966 37.0 37.0 37.0 37.0 37.0 125-129 35.9488 37.0 37.0 37.0 37.0 37.0 130-134 35.9259 37.0 37.0 37.0 37.0 37.0 135-139 35.8337 37.0 37.0 37.0 37.0 37.0 140-144 35.7122 37.0 37.0 37.0 37.0 37.0 145-149 35.6565 37.0 37.0 37.0 37.0 37.0 150-151 35.3925 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 5.0 24 2.0 25 4.0 26 2.0 27 8.0 28 9.0 29 21.0 30 18.0 31 28.0 32 43.0 33 68.0 34 128.0 35 341.0 36 2965.0 37 355.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.650000000000006 12.875 8.450000000000001 45.025 2 18.90597428787497 12.78043861860348 37.03050163851777 31.28308545500378 3 17.4 16.400000000000002 29.2 37.0 4 20.525 25.35 24.725 29.4 5 21.175 30.099999999999998 26.35 22.375 6 19.900000000000002 34.150000000000006 24.65 21.3 7 14.399999999999999 26.224999999999998 42.175000000000004 17.2 8 16.8 25.374999999999996 32.800000000000004 25.025 9 17.5 23.375 36.25 22.875 10-14 18.91 30.154999999999998 27.725 23.21 15-19 19.314999999999998 27.839999999999996 27.83 25.014999999999997 20-24 18.98 28.785 28.12 24.115000000000002 25-29 19.62 28.744999999999997 28.38 23.255 30-34 19.275000000000002 29.160000000000004 27.68 23.885 35-39 19.875 28.689999999999998 27.955000000000002 23.48 40-44 19.53 28.665000000000003 28.384999999999998 23.419999999999998 45-49 19.845 28.765 27.85 23.54 50-54 19.85 28.884999999999998 27.439999999999998 23.825 55-59 19.915 28.735 27.965 23.385 60-64 19.805 29.160000000000004 27.375 23.66 65-69 20.175 28.444999999999997 28.335 23.044999999999998 70-74 19.195 28.044999999999998 28.744999999999997 24.015 75-79 19.580000000000002 28.48 27.939999999999998 24.0 80-84 19.79 28.09 28.000000000000004 24.12 85-89 19.945 28.884999999999998 27.87 23.3 90-94 19.689999999999998 29.005 28.134999999999998 23.169999999999998 95-99 20.150000000000002 28.48 27.544999999999998 23.825 100-104 19.615 29.03 27.48 23.875 105-109 19.97 28.235 28.04 23.755000000000003 110-114 20.335 28.535 27.694999999999997 23.435 115-119 19.835 28.04 28.38 23.745 120-124 20.200000000000003 28.599999999999998 27.215 23.985 125-129 20.36 28.785 27.375 23.48 130-134 20.085 28.015 27.845 24.055 135-139 20.235 28.48 27.305 23.98 140-144 20.69 27.894999999999996 27.875 23.54 145-149 20.605 28.37 27.389999999999997 23.635 150-151 19.725 28.512500000000003 27.775 23.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 0.0 23 0.5 24 3.0 25 3.0 26 4.0 27 9.5 28 12.5 29 14.0 30 17.5 31 25.5 32 31.0 33 38.0 34 58.0 35 74.5 36 103.0 37 127.5 38 133.0 39 154.5 40 196.5 41 226.5 42 245.5 43 282.0 44 290.0 45 285.0 46 279.5 47 247.5 48 218.0 49 184.0 50 164.0 51 146.0 52 109.0 53 81.0 54 58.0 55 42.0 56 29.0 57 23.0 58 23.5 59 19.0 60 11.5 61 8.0 62 6.5 63 3.5 64 3.5 65 2.0 66 0.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.8250000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.05 #Duplication Level Percentage of deduplicated Percentage of total 1 92.20532319391636 84.875 2 7.0342205323193925 12.950000000000001 3 0.6789788158609452 1.875 4 0.08147745790331341 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.8374999999999999 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.2000000000000002 0.0 0.0 0.0 0.0 114-115 1.35 0.0 0.0 0.0 0.0 116-117 1.5875 0.0 0.0 0.0 0.0 118-119 1.8375 0.0 0.0 0.0 0.0 120-121 1.9375 0.0 0.0 0.0 0.0 122-123 2.2249999999999996 0.0 0.0 0.0 0.0 124-125 2.5375 0.0 0.0 0.0 0.0 126-127 2.825 0.0 0.0 0.0 0.0 128-129 3.1125 0.0 0.0 0.0 0.0 130-131 3.4000000000000004 0.0 0.0 0.0 0.0 132-133 3.6625 0.0 0.0 0.0 0.0 134-135 3.9625000000000004 0.0 0.0 0.0 0.0 136-137 4.525 0.0 0.0 0.0 0.0 138-139 4.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTTTG 10 0.006830828 145.0 1 AAAAAAT 10 0.006830828 145.0 9 TTTTTTT 25 4.977651E-4 29.0 50-54 >>END_MODULE SRR12919322 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919322_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.243 37.0 37.0 37.0 37.0 37.0 2 36.242 37.0 37.0 37.0 37.0 37.0 3 36.325 37.0 37.0 37.0 37.0 37.0 4 36.231 37.0 37.0 37.0 37.0 37.0 5 36.4065 37.0 37.0 37.0 37.0 37.0 6 36.367 37.0 37.0 37.0 37.0 37.0 7 36.2825 37.0 37.0 37.0 37.0 37.0 8 36.357 37.0 37.0 37.0 37.0 37.0 9 36.3455 37.0 37.0 37.0 37.0 37.0 10-14 36.3382 37.0 37.0 37.0 37.0 37.0 15-19 36.343399999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.3043 37.0 37.0 37.0 37.0 37.0 25-29 36.2551 37.0 37.0 37.0 37.0 37.0 30-34 36.2414 37.0 37.0 37.0 37.0 37.0 35-39 36.2417 37.0 37.0 37.0 37.0 37.0 40-44 36.1751 37.0 37.0 37.0 37.0 37.0 45-49 36.1602 37.0 37.0 37.0 37.0 37.0 50-54 36.1697 37.0 37.0 37.0 37.0 37.0 55-59 36.0577 37.0 37.0 37.0 37.0 37.0 60-64 36.098099999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.0447 37.0 37.0 37.0 37.0 37.0 70-74 36.0392 37.0 37.0 37.0 37.0 37.0 75-79 36.008199999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.933699999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.9445 37.0 37.0 37.0 37.0 37.0 90-94 35.9148 37.0 37.0 37.0 37.0 37.0 95-99 35.937799999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.8368 37.0 37.0 37.0 37.0 37.0 105-109 35.821600000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.8091 37.0 37.0 37.0 37.0 37.0 115-119 35.7497 37.0 37.0 37.0 37.0 37.0 120-124 35.6466 37.0 37.0 37.0 37.0 37.0 125-129 35.7018 37.0 37.0 37.0 37.0 37.0 130-134 35.5473 37.0 37.0 37.0 37.0 37.0 135-139 35.4735 37.0 37.0 37.0 37.0 37.0 140-144 35.3806 37.0 37.0 37.0 37.0 37.0 145-149 35.28 37.0 37.0 37.0 32.2 37.0 150-151 35.14075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 4.0 14 0.0 15 1.0 16 0.0 17 2.0 18 1.0 19 0.0 20 1.0 21 2.0 22 3.0 23 5.0 24 4.0 25 7.0 26 10.0 27 13.0 28 13.0 29 17.0 30 23.0 31 22.0 32 50.0 33 101.0 34 218.0 35 559.0 36 2631.0 37 311.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.325 25.55 11.55 27.575 2 28.199999999999996 25.775 30.475 15.55 3 19.075 28.425 32.875 19.625 4 22.900000000000002 33.650000000000006 24.675 18.775 5 25.0 35.6 22.85 16.55 6 19.775000000000002 39.825 22.775000000000002 17.625 7 20.150000000000002 22.05 40.325 17.474999999999998 8 21.224999999999998 24.9 29.599999999999998 24.275 9 22.25 24.85 30.825000000000003 22.075 10-14 22.91 29.49 26.815 20.785 15-19 23.27 28.854999999999997 27.810000000000002 20.064999999999998 20-24 23.035 28.475 27.505000000000003 20.985 25-29 23.135 28.815 27.68 20.369999999999997 30-34 22.81 28.565 27.900000000000002 20.724999999999998 35-39 22.765 28.345 28.360000000000003 20.53 40-44 23.23 27.744999999999997 28.67 20.355 45-49 23.085 28.155 28.395 20.365 50-54 22.5 28.854999999999997 27.735 20.91 55-59 22.95 28.13 28.655 20.265 60-64 23.369999999999997 27.57 28.444999999999997 20.615 65-69 22.400000000000002 27.47 29.015 21.115000000000002 70-74 23.23 27.91 28.62 20.24 75-79 23.535 28.075 28.08 20.31 80-84 23.73 27.529999999999998 28.355000000000004 20.385 85-89 23.400000000000002 27.935 27.955000000000002 20.71 90-94 23.28 27.794999999999998 28.16 20.765 95-99 23.7 28.055000000000003 27.99 20.255000000000003 100-104 23.715 27.650000000000002 28.244999999999997 20.39 105-109 23.79 28.26 28.09 19.86 110-114 23.56 28.49 27.785 20.165 115-119 23.365 28.439999999999998 28.02 20.175 120-124 24.735 27.845 27.975 19.445 125-129 24.98 28.37 27.389999999999997 19.259999999999998 130-134 24.310000000000002 28.115000000000002 27.51 20.064999999999998 135-139 24.990000000000002 27.46 27.450000000000003 20.1 140-144 24.455 28.110000000000003 27.83 19.605 145-149 25.424999999999997 28.189999999999998 26.900000000000002 19.485 150-151 25.162499999999998 28.1375 27.250000000000004 19.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.0 22 2.5 23 2.5 24 2.5 25 3.0 26 3.5 27 6.0 28 6.5 29 10.5 30 22.5 31 30.0 32 31.0 33 40.0 34 60.5 35 76.0 36 94.5 37 114.5 38 139.5 39 172.0 40 216.5 41 254.5 42 267.0 43 264.5 44 282.0 45 297.0 46 260.0 47 228.0 48 210.5 49 167.5 50 151.5 51 138.0 52 106.5 53 85.5 54 61.5 55 45.0 56 34.5 57 24.5 58 16.5 59 14.5 60 9.0 61 8.0 62 8.0 63 4.5 64 2.0 65 3.0 66 3.0 67 2.0 68 3.0 69 2.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.475 #Duplication Level Percentage of deduplicated Percentage of total 1 92.48445525817789 85.52499999999999 2 6.920789402541228 12.8 3 0.5677210056772101 1.575 4 0.027034333603676672 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.0750000000000002 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.4249999999999998 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.9625 0.0 0.0 0.0 0.0 120-121 2.0625 0.0 0.0 0.0 0.0 122-123 2.3499999999999996 0.0 0.0 0.0 0.0 124-125 2.6625 0.0 0.0 0.0 0.0 126-127 2.95 0.0 0.0 0.0 0.0 128-129 3.2375 0.0 0.0 0.0 0.0 130-131 3.5250000000000004 0.0 0.0 0.0 0.0 132-133 3.7875 0.0 0.0 0.0 0.0 134-135 4.1125 0.0 0.0 0.0 0.0 136-137 4.675 0.0 0.0 0.0 0.0 138-139 5.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1118509 spots for SRR12919322.sra Written 1118509 spots for SRR12919322.sra Read 1118509 spots for SRR12919322.sra Written 1118509 spots for SRR12919322.sra Read 1118509 spots for SRR12919322.sra Written 1118509 spots for SRR12919322.sra Read 1118509 spots for SRR12919322.sra Written 1118509 spots for SRR12919322.sra Read 1118509 spots for SRR12919322.sra Written 1118509 spots for SRR12919322.sra Read 1118509 spots for SRR12919322.sra Written 1118509 spots for SRR12919322.sra Read 1118509 spots for SRR12919322.sra Written 1118509 spots for SRR12919322.sra Read 1118509 spots for SRR12919322.sra Written 1118509 spots for SRR12919322.sra Read 1118509 spots for SRR12919322.sra Written 1118509 spots for SRR12919322.sra Read 1118509 spots for SRR12919322.sra Written 1118509 spots for SRR12919322.sra Read 1118509 spots for SRR12919322.sra Written 1118509 spots for SRR12919322.sra Read 1118509 spots for SRR12919322.sra Written 1118509 spots for SRR12919322.sra Read 1118509 spots for SRR12919322.sra Written 1118509 spots for SRR12919322.sra Read 1118509 spots for SRR12919322.sra Written 1118509 spots for SRR12919322.sra Read 1118509 spots for SRR12919322.sra Written 1118509 spots for SRR12919322.sra Read 1118509 spots for SRR12919322.sra Written 1118509 spots for SRR12919322.sra Read 1118509 spots for SRR12919322.sra Written 1118509 spots for SRR12919322.sra Read 1118509 spots for SRR12919322.sra Written 1118509 spots for SRR12919322.sra Read 1118510 spots for SRR12919322.sra Written 1118510 spots for SRR12919322.sra Read 1118509 spots for SRR12919322.sra Written 1118509 spots for SRR12919322.sra SRR ids: ['SRR12919322.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j1ptj63i SRR12919322.sra spots: 22370181 blocks: [[1, 1118509], [1118510, 2237018], [2237019, 3355527], [3355528, 4474036], [4474037, 5592545], [5592546, 6711054], [6711055, 7829563], [7829564, 8948072], [8948073, 10066581], [10066582, 11185090], [11185091, 12303599], [12303600, 13422108], [13422109, 14540617], [14540618, 15659126], [15659127, 16777635], [16777636, 17896144], [17896145, 19014653], [19014654, 20133162], [20133163, 21251671], [21251672, 22370181]] SRR12919322 file size 7580665 SRR12919322 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919322 SRR12919322_1.fastq SRR12919322_2.fastq Input file: SRR12919322_1.fastq Paired file: SRR12919322_2.fastq trimmed: SRR12919322-trimmed-pair1.fastq, SRR12919322-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:52:42 2025 >> started Wed Feb 12 18:53:08 2025 >> done (25.531s) 22370181 read pairs processed; of these: 30 ( 0.00%) short read pairs filtered out after trimming by size control 3536 ( 0.02%) empty read pairs filtered out after trimming by size control 22366615 (99.98%) read pairs available; of these: 1837494 ( 8.22%) trimmed read pairs available after processing 20529121 (91.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 8 0.00% 21 10 0.00% 22 5 0.00% 23 3 0.00% 24 3 0.00% 25 11 0.00% 26 6 0.00% 27 4 0.00% 28 12 0.00% 29 8 0.00% 30 10 0.00% 31 12 0.00% 32 22 0.00% 33 18 0.00% 34 13 0.00% 35 11 0.00% 36 14 0.00% 37 11 0.00% 38 13 0.00% 39 19 0.00% 40 22 0.00% 41 34 0.00% 42 19 0.00% 43 23 0.00% 44 13 0.00% 45 39 0.00% 46 27 0.00% 47 38 0.00% 48 29 0.00% 49 50 0.00% 50 48 0.00% 51 63 0.00% 52 67 0.00% 53 69 0.00% 54 70 0.00% 55 83 0.00% 56 77 0.00% 57 99 0.00% 58 92 0.00% 59 111 0.00% 60 132 0.00% 61 131 0.00% 62 192 0.00% 63 210 0.00% 64 223 0.00% 65 224 0.00% 66 274 0.00% 67 302 0.00% 68 357 0.00% 69 396 0.00% 70 493 0.00% 71 592 0.00% 72 613 0.00% 73 848 0.00% 74 905 0.00% 75 981 0.00% 76 1003 0.00% 77 1115 0.00% 78 1249 0.01% 79 1493 0.01% 80 1707 0.01% 81 2006 0.01% 82 2308 0.01% 83 2570 0.01% 84 2838 0.01% 85 3373 0.02% 86 3590 0.02% 87 3914 0.02% 88 4200 0.02% 89 4573 0.02% 90 5106 0.02% 91 5896 0.03% 92 6394 0.03% 93 7279 0.03% 94 8004 0.04% 95 8545 0.04% 96 8885 0.04% 97 9699 0.04% 98 9767 0.04% 99 10630 0.05% 100 11406 0.05% 101 12370 0.06% 102 13246 0.06% 103 14280 0.06% 104 15226 0.07% 105 16046 0.07% 106 16980 0.08% 107 17021 0.08% 108 18291 0.08% 109 18601 0.08% 110 19543 0.09% 111 20516 0.09% 112 21558 0.10% 113 22529 0.10% 114 23961 0.11% 115 24857 0.11% 116 25784 0.12% 117 26518 0.12% 118 26970 0.12% 119 27404 0.12% 120 28460 0.13% 121 29156 0.13% 122 30359 0.14% 123 31768 0.14% 124 33411 0.15% 125 34329 0.15% 126 35385 0.16% 127 35984 0.16% 128 36178 0.16% 129 36669 0.16% 130 37445 0.17% 131 38184 0.17% 132 39450 0.18% 133 41134 0.18% 134 41750 0.19% 135 42868 0.19% 136 44166 0.20% 137 44985 0.20% 138 45622 0.20% 139 46121 0.21% 140 46632 0.21% 141 47187 0.21% 142 48567 0.22% 143 49601 0.22% 144 51124 0.23% 145 52075 0.23% 146 53145 0.24% 147 53456 0.24% 148 54525 0.24% 149 55205 0.25% 150 55135 0.25% 151 20529121 91.78% 22366615 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=7.25 fanout-score-rank=14 prefix-density=0.34 prefix-fanout=4.1 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=49.28 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=15.8 sequence=CATCCTTCACAA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=13.32 fanout-score-rank=15 prefix-density=0.31 prefix-fanout=7.0 sequence=TTTGACAAGAAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=17 fanout-score=402.25 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=35.3 sequence=AAGAAGAAGAAA SRR12919322 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:53:51 Started mapping on | Feb 12 18:53:51 Finished on | Feb 12 18:56:34 Mapping speed, Million of reads per hour | 493.99 Number of input reads | 22366615 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 20870195 Uniquely mapped reads % | 93.31% Average mapped length | 296.79 Number of splices: Total | 19667113 Number of splices: Annotated (sjdb) | 19174455 Number of splices: GT/AG | 19295934 Number of splices: GC/AG | 286244 Number of splices: AT/AC | 19919 Number of splices: Non-canonical | 65016 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 2.95 Insertion rate per base | 0.03% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 566582 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 114043 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.49% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 929838 929838 929838 N_multimapping 566582 566582 566582 N_noFeature 867592 20625310 972539 N_ambiguous 284839 1619 143848 UnstrandedReadsAssigned:19717764 PositiveStrandReadsAssigned:243266 NegativeStrandReadsAssigned:19753808 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919322 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919322-trimmed-pair1.fastq SRR12919322-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,366,615 reads, 19,706,841 reads pseudoaligned [quant] estimated average fragment length: 272.037 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52401 SRR12919322.ke.tsv 34699 SRR12919322.se.tsv 87100 total ==> SRR12919322.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.96 654 20.7473 Potri.005G024800.1.v4.1 1035 763.963 298 21.6178 Potri.004G059700.1.v4.1 961 690.103 18 1.44553 Potri.007G009000.2.v4.1 1416 1144.96 0 0 Potri.003G141000.2.v4.1 2943 2671.96 819.368 16.9948 Potri.016G087400.1.v4.1 270 80.5071 1924.84 1325.04 Potri.015G069301.1.v4.1 564 308.75 0 0 Potri.010G195200.1.v4.1 1773 1501.96 141 5.20269 Potri.012G127500.1.v4.1 977 706.052 7590 595.762 ==> SRR12919322.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 181 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 223 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 59 SRR12919322 completed mapping pipeline successfully