Starting /dee2/code/volunteer_pipeline.sh SRR12919323 current disk space = 3051340107776 free memory = 1450135460 SRR12919323 SRAfilesize 493f893a8a7c8b21977d482606e6b831 SRR12919323.sra SRR12919323.sra file validated SRR12919323 is paired end SRR12919323 is conventional basespace SRR12919323 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919323_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5285 37.0 37.0 37.0 37.0 37.0 2 36.30675 37.0 37.0 37.0 37.0 37.0 3 36.5195 37.0 37.0 37.0 37.0 37.0 4 36.6495 37.0 37.0 37.0 37.0 37.0 5 36.6445 37.0 37.0 37.0 37.0 37.0 6 36.6035 37.0 37.0 37.0 37.0 37.0 7 36.616 37.0 37.0 37.0 37.0 37.0 8 36.665 37.0 37.0 37.0 37.0 37.0 9 36.665 37.0 37.0 37.0 37.0 37.0 10-14 36.6519 37.0 37.0 37.0 37.0 37.0 15-19 36.6612 37.0 37.0 37.0 37.0 37.0 20-24 36.5893 37.0 37.0 37.0 37.0 37.0 25-29 36.5941 37.0 37.0 37.0 37.0 37.0 30-34 36.5423 37.0 37.0 37.0 37.0 37.0 35-39 36.524499999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.5218 37.0 37.0 37.0 37.0 37.0 45-49 36.5146 37.0 37.0 37.0 37.0 37.0 50-54 36.4904 37.0 37.0 37.0 37.0 37.0 55-59 36.4837 37.0 37.0 37.0 37.0 37.0 60-64 36.4513 37.0 37.0 37.0 37.0 37.0 65-69 36.428700000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.4138 37.0 37.0 37.0 37.0 37.0 75-79 36.3907 37.0 37.0 37.0 37.0 37.0 80-84 36.374900000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.313599999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.274800000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.2384 37.0 37.0 37.0 37.0 37.0 100-104 36.2427 37.0 37.0 37.0 37.0 37.0 105-109 36.1741 37.0 37.0 37.0 37.0 37.0 110-114 36.1395 37.0 37.0 37.0 37.0 37.0 115-119 36.072799999999994 37.0 37.0 37.0 37.0 37.0 120-124 36.0793 37.0 37.0 37.0 37.0 37.0 125-129 36.013400000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.9572 37.0 37.0 37.0 37.0 37.0 135-139 35.8624 37.0 37.0 37.0 37.0 37.0 140-144 35.8092 37.0 37.0 37.0 37.0 37.0 145-149 35.7829 37.0 37.0 37.0 37.0 37.0 150-151 35.62975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 0.0 26 4.0 27 7.0 28 6.0 29 14.0 30 13.0 31 31.0 32 43.0 33 73.0 34 111.0 35 342.0 36 2954.0 37 399.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.975 12.775 4.8 36.449999999999996 2 17.960311479527757 12.484300427028385 38.48279326802311 31.072594825420747 3 17.0 19.775000000000002 28.599999999999998 34.625 4 21.15 26.025 26.400000000000002 26.424999999999997 5 22.5 32.65 24.125 20.724999999999998 6 20.75 35.175 24.025 20.05 7 15.275 27.425 40.8 16.5 8 16.8 26.525 31.825 24.85 9 17.525 24.55 33.775 24.15 10-14 20.205000000000002 30.125 27.02 22.650000000000002 15-19 19.29 28.285 27.845 24.58 20-24 19.465 29.005 27.93 23.599999999999998 25-29 19.830000000000002 28.68 27.700000000000003 23.79 30-34 19.57 28.585 27.985 23.86 35-39 19.67 29.349999999999998 27.1 23.880000000000003 40-44 19.74 28.64 27.689999999999998 23.93 45-49 20.04 28.845 27.315 23.799999999999997 50-54 19.685 28.315 28.465 23.535 55-59 19.28 28.4 28.4 23.919999999999998 60-64 19.935 28.765 27.43 23.87 65-69 19.825 28.78 27.560000000000002 23.835 70-74 19.625 28.325 28.64 23.41 75-79 20.4 28.249999999999996 27.83 23.52 80-84 19.965 28.675 27.675 23.685000000000002 85-89 20.535 28.71 27.26 23.494999999999997 90-94 20.01 28.895 27.205000000000002 23.89 95-99 19.765 28.95 27.41 23.875 100-104 20.380000000000003 29.015 27.21 23.395 105-109 19.59 28.854999999999997 27.744999999999997 23.810000000000002 110-114 20.16 29.044999999999998 27.13 23.665 115-119 20.794999999999998 28.33 27.85 23.025000000000002 120-124 20.09 28.970000000000002 27.465 23.474999999999998 125-129 20.18 28.205000000000002 27.455000000000002 24.16 130-134 20.68 28.37 27.32 23.630000000000003 135-139 20.575 28.299999999999997 26.834999999999997 24.29 140-144 21.029999999999998 28.199999999999996 26.955000000000002 23.815 145-149 20.7 28.59 26.889999999999997 23.82 150-151 20.0 28.975 26.387500000000003 24.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 2.0 18 1.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 4.5 25 5.0 26 4.0 27 7.0 28 6.5 29 10.0 30 19.5 31 27.0 32 37.5 33 50.5 34 61.5 35 68.5 36 86.5 37 108.0 38 130.0 39 157.5 40 180.5 41 201.0 42 236.5 43 289.0 44 293.5 45 276.5 46 283.5 47 266.0 48 220.5 49 185.0 50 173.0 51 145.5 52 112.0 53 89.5 54 68.5 55 53.0 56 31.5 57 24.0 58 24.0 59 17.0 60 14.5 61 9.5 62 5.5 63 3.5 64 1.0 65 2.5 66 2.0 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.475 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.375 #Duplication Level Percentage of deduplicated Percentage of total 1 91.62790697674419 83.72500000000001 2 7.387140902872777 13.5 3 0.9302325581395349 2.55 4 0.027359781121751026 0.1 5 0.027359781121751026 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCATAACCTGGCGGCCTCCTTGCAACCCACACACTTCTTATAACACCGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.5750000000000002 0.0 0.0 0.0 0.0 108-109 1.8250000000000002 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.45 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 3.0 0.0 0.0 0.0 0.0 120-121 3.4375 0.0 0.0 0.0 0.0 122-123 3.8 0.0 0.0 0.0 0.0 124-125 4.1125 0.0 0.0 0.0 0.0 126-127 4.4625 0.0 0.0 0.0 0.0 128-129 4.825 0.0 0.0 0.0 0.0 130-131 5.175000000000001 0.0 0.0 0.0 0.0 132-133 5.5375 0.0 0.0 0.0 0.0 134-135 5.85 0.0 0.0 0.0 0.0 136-137 6.2875 0.0 0.0 0.0 0.0 138-139 6.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919323 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919323_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.315 37.0 37.0 37.0 37.0 37.0 2 36.3425 37.0 37.0 37.0 37.0 37.0 3 36.389 37.0 37.0 37.0 37.0 37.0 4 36.2685 37.0 37.0 37.0 37.0 37.0 5 36.4645 37.0 37.0 37.0 37.0 37.0 6 36.4475 37.0 37.0 37.0 37.0 37.0 7 36.3305 37.0 37.0 37.0 37.0 37.0 8 36.385 37.0 37.0 37.0 37.0 37.0 9 36.4975 37.0 37.0 37.0 37.0 37.0 10-14 36.3862 37.0 37.0 37.0 37.0 37.0 15-19 36.365899999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.4125 37.0 37.0 37.0 37.0 37.0 25-29 36.3019 37.0 37.0 37.0 37.0 37.0 30-34 36.30329999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.2687 37.0 37.0 37.0 37.0 37.0 40-44 36.279300000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.189499999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.1815 37.0 37.0 37.0 37.0 37.0 55-59 36.1625 37.0 37.0 37.0 37.0 37.0 60-64 36.15069999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.140100000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.1032 37.0 37.0 37.0 37.0 37.0 75-79 36.095299999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.0427 37.0 37.0 37.0 37.0 37.0 85-89 36.0354 37.0 37.0 37.0 37.0 37.0 90-94 35.9608 37.0 37.0 37.0 37.0 37.0 95-99 35.976600000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.9274 37.0 37.0 37.0 37.0 37.0 105-109 35.9525 37.0 37.0 37.0 37.0 37.0 110-114 35.9119 37.0 37.0 37.0 37.0 37.0 115-119 35.8398 37.0 37.0 37.0 37.0 37.0 120-124 35.83030000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.7471 37.0 37.0 37.0 37.0 37.0 130-134 35.6295 37.0 37.0 37.0 37.0 37.0 135-139 35.5269 37.0 37.0 37.0 37.0 37.0 140-144 35.507400000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.2842 37.0 37.0 37.0 34.6 37.0 150-151 35.1485 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 2.0 21 4.0 22 4.0 23 3.0 24 11.0 25 6.0 26 6.0 27 9.0 28 7.0 29 12.0 30 20.0 31 27.0 32 48.0 33 84.0 34 178.0 35 501.0 36 2739.0 37 329.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.65 24.85 7.425 23.075000000000003 2 26.724999999999998 25.624999999999996 32.05 15.6 3 19.55 28.125 32.85 19.475 4 23.3 35.35 23.150000000000002 18.2 5 25.05 36.4 22.05 16.5 6 21.925 39.2 22.25 16.625 7 20.674999999999997 21.95 38.550000000000004 18.825 8 20.599999999999998 26.1 29.125 24.175 9 22.650000000000002 23.75 30.375000000000004 23.225 10-14 23.48 29.215000000000003 26.52 20.785 15-19 23.14 28.439999999999998 27.41 21.01 20-24 22.650000000000002 28.64 27.665 21.044999999999998 25-29 23.375 27.975 27.779999999999998 20.87 30-34 23.435 28.435 27.900000000000002 20.23 35-39 23.05 28.065 27.775 21.11 40-44 23.04 28.875 27.584999999999997 20.5 45-49 23.48 28.07 28.48 19.97 50-54 23.0 28.375 27.88 20.745 55-59 22.884999999999998 28.65 27.775 20.69 60-64 23.095 28.875 27.88 20.150000000000002 65-69 23.29 28.4 28.43 19.88 70-74 22.8 28.535 27.755000000000003 20.91 75-79 24.215 28.125 27.855 19.805 80-84 23.13 28.439999999999998 28.27 20.16 85-89 23.525 28.470000000000002 27.41 20.595 90-94 23.39 28.315 27.91 20.385 95-99 23.96 27.700000000000003 28.395 19.945 100-104 23.57 27.994999999999997 28.235 20.200000000000003 105-109 23.7 28.29 27.955000000000002 20.055 110-114 23.64 28.139999999999997 28.13 20.09 115-119 24.285 27.985 27.839999999999996 19.89 120-124 24.375 27.894999999999996 27.82 19.91 125-129 24.19 28.17 28.01 19.63 130-134 24.215 28.249999999999996 27.445000000000004 20.09 135-139 25.259999999999998 27.725 27.865000000000002 19.15 140-144 24.785 28.025 27.29 19.900000000000002 145-149 25.66 28.244999999999997 27.0 19.095000000000002 150-151 25.1875 28.4 27.5875 18.825 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 1.0 17 2.0 18 1.5 19 0.5 20 0.0 21 0.0 22 1.5 23 4.5 24 5.0 25 3.0 26 3.5 27 7.0 28 8.0 29 11.0 30 16.5 31 18.5 32 29.5 33 44.5 34 51.5 35 66.5 36 84.5 37 104.0 38 129.0 39 166.0 40 211.5 41 256.5 42 278.0 43 275.0 44 278.0 45 286.5 46 267.5 47 247.0 48 216.0 49 176.5 50 165.0 51 149.0 52 116.0 53 76.5 54 50.5 55 42.5 56 37.5 57 26.0 58 18.5 59 14.5 60 12.5 61 7.5 62 7.5 63 6.0 64 1.5 65 0.5 66 0.5 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.64612434949329 83.65 2 7.285675157491098 13.3 3 0.9860312243221034 2.7 4 0.027389756231169543 0.1 5 0.054779512462339086 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAAAACAGAGCGACTAGGGTTTCTCTCTACAAAGTTCTACAGATATAAT 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.7250000000000001 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.2374999999999998 0.0 0.0 0.0 0.0 104-105 1.4500000000000002 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.175 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.55 0.0 0.0 0.0 0.0 116-117 2.9 0.0 0.0 0.0 0.0 118-119 3.175 0.0 0.0 0.0 0.0 120-121 3.5875000000000004 0.0 0.0 0.0 0.0 122-123 3.95 0.0 0.0 0.0 0.0 124-125 4.2625 0.0 0.0 0.0 0.0 126-127 4.612500000000001 0.0 0.0 0.0 0.0 128-129 4.975 0.0 0.0 0.0 0.0 130-131 5.324999999999999 0.0 0.0 0.0 0.0 132-133 5.6875 0.0 0.0 0.0 0.0 134-135 6.0375 0.0 0.0 0.0 0.0 136-137 6.487500000000001 0.0 0.0 0.0 0.0 138-139 6.887499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGGTT 10 0.006830828 145.0 2 AGAAATT 10 0.006830828 145.0 145 >>END_MODULE Read 940701 spots for SRR12919323.sra Written 940701 spots for SRR12919323.sra Read 940701 spots for SRR12919323.sra Written 940701 spots for SRR12919323.sra Read 940701 spots for SRR12919323.sra Written 940701 spots for SRR12919323.sra Read 940701 spots for SRR12919323.sra Written 940701 spots for SRR12919323.sra Read 940701 spots for SRR12919323.sra Written 940701 spots for SRR12919323.sra Read 940701 spots for SRR12919323.sra Written 940701 spots for SRR12919323.sra Read 940701 spots for SRR12919323.sra Written 940701 spots for SRR12919323.sra Read 940701 spots for SRR12919323.sra Written 940701 spots for SRR12919323.sra Read 940701 spots for SRR12919323.sra Written 940701 spots for SRR12919323.sra Read 940701 spots for SRR12919323.sra Written 940701 spots for SRR12919323.sra Read 940701 spots for SRR12919323.sra Written 940701 spots for SRR12919323.sra Read 940701 spots for SRR12919323.sra Written 940701 spots for SRR12919323.sra Read 940701 spots for SRR12919323.sra Written 940701 spots for SRR12919323.sra Read 940701 spots for SRR12919323.sra Written 940701 spots for SRR12919323.sra Read 940701 spots for SRR12919323.sra Written 940701 spots for SRR12919323.sra Read 940701 spots for SRR12919323.sra Written 940701 spots for SRR12919323.sra Read 940701 spots for SRR12919323.sra Written 940701 spots for SRR12919323.sra Read 940719 spots for SRR12919323.sra Written 940719 spots for SRR12919323.sra Read 940701 spots for SRR12919323.sra Written 940701 spots for SRR12919323.sra Read 940701 spots for SRR12919323.sra Written 940701 spots for SRR12919323.sra SRR ids: ['SRR12919323.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cu_qut8c SRR12919323.sra spots: 18814038 blocks: [[1, 940701], [940702, 1881402], [1881403, 2822103], [2822104, 3762804], [3762805, 4703505], [4703506, 5644206], [5644207, 6584907], [6584908, 7525608], [7525609, 8466309], [8466310, 9407010], [9407011, 10347711], [10347712, 11288412], [11288413, 12229113], [12229114, 13169814], [13169815, 14110515], [14110516, 15051216], [15051217, 15991917], [15991918, 16932618], [16932619, 17873319], [17873320, 18814038]] SRR12919323 file size 6372132 SRR12919323 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919323 SRR12919323_1.fastq SRR12919323_2.fastq Input file: SRR12919323_1.fastq Paired file: SRR12919323_2.fastq trimmed: SRR12919323-trimmed-pair1.fastq, SRR12919323-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:22:06 2025 >> started Wed Feb 12 18:22:27 2025 >> done (20.292s) 18814038 read pairs processed; of these: 39 ( 0.00%) short read pairs filtered out after trimming by size control 267 ( 0.00%) empty read pairs filtered out after trimming by size control 18813732 (100.00%) read pairs available; of these: 1988115 (10.57%) trimmed read pairs available after processing 16825617 (89.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 3 0.00% 21 4 0.00% 22 9 0.00% 23 8 0.00% 24 15 0.00% 25 5 0.00% 26 8 0.00% 27 4 0.00% 28 5 0.00% 29 13 0.00% 30 7 0.00% 31 14 0.00% 32 17 0.00% 33 9 0.00% 34 19 0.00% 35 10 0.00% 36 11 0.00% 37 20 0.00% 38 23 0.00% 39 20 0.00% 40 24 0.00% 41 26 0.00% 42 34 0.00% 43 29 0.00% 44 37 0.00% 45 47 0.00% 46 42 0.00% 47 30 0.00% 48 59 0.00% 49 46 0.00% 50 93 0.00% 51 81 0.00% 52 79 0.00% 53 102 0.00% 54 96 0.00% 55 94 0.00% 56 102 0.00% 57 132 0.00% 58 154 0.00% 59 200 0.00% 60 192 0.00% 61 262 0.00% 62 275 0.00% 63 337 0.00% 64 356 0.00% 65 383 0.00% 66 444 0.00% 67 499 0.00% 68 551 0.00% 69 662 0.00% 70 839 0.00% 71 949 0.01% 72 1053 0.01% 73 1237 0.01% 74 1381 0.01% 75 1503 0.01% 76 1589 0.01% 77 1772 0.01% 78 1963 0.01% 79 2299 0.01% 80 2477 0.01% 81 2968 0.02% 82 3463 0.02% 83 4045 0.02% 84 4401 0.02% 85 4820 0.03% 86 5041 0.03% 87 5487 0.03% 88 5936 0.03% 89 6278 0.03% 90 6965 0.04% 91 7948 0.04% 92 8778 0.05% 93 9835 0.05% 94 10554 0.06% 95 11261 0.06% 96 11973 0.06% 97 12539 0.07% 98 12887 0.07% 99 13777 0.07% 100 14742 0.08% 101 15202 0.08% 102 16704 0.09% 103 18161 0.10% 104 18850 0.10% 105 19924 0.11% 106 20892 0.11% 107 21199 0.11% 108 21792 0.12% 109 22301 0.12% 110 22508 0.12% 111 24044 0.13% 112 24928 0.13% 113 25976 0.14% 114 27621 0.15% 115 28814 0.15% 116 29233 0.16% 117 29897 0.16% 118 30456 0.16% 119 30454 0.16% 120 31371 0.17% 121 32109 0.17% 122 32980 0.18% 123 34486 0.18% 124 36141 0.19% 125 36748 0.20% 126 38078 0.20% 127 38756 0.21% 128 38481 0.20% 129 38771 0.21% 130 39784 0.21% 131 40124 0.21% 132 41234 0.22% 133 42297 0.22% 134 43355 0.23% 135 44419 0.24% 136 45958 0.24% 137 45778 0.24% 138 46381 0.25% 139 46689 0.25% 140 46934 0.25% 141 47394 0.25% 142 48200 0.26% 143 48813 0.26% 144 50352 0.27% 145 51995 0.28% 146 52413 0.28% 147 52506 0.28% 148 53168 0.28% 149 53108 0.28% 150 53877 0.29% 151 16825617 89.43% 18813732 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=10.87 fanout-score-rank=10 prefix-density=0.29 prefix-fanout=5.4 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=106.08 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=19.9 sequence=CCTTCTTCACAAT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=32 prefix-density=0.17 prefix-fanout=2.3 sequence=TCACTTTACTTAACACTTGAGCTACATAGAATGTCTACAGTCAATTTGGCAGCACTGCTGTTGCTTGGGCTGCTGCTGGTTATGCCACAGCAGTCCATGCAAGCGAGTTTGATAGACCCCATTGCTGAAATCGAGAGAAGCAACTGCAAAATCGCACACCTTCGCTTAGGGCTTGTTTTTAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=481.03 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=19.3 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAACTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACAATGTGCTGGTTATCAGTGGAGAGAGGAAGCGCGGAGAGGAGAAAGAAGGGGCCAAGTATGTGAGAATGGAAAGGAGGGTTGGTAAGTTTATGAGGAAGTTTGTGTTGCCTGAGAATGCTAA SRR12919323 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:23:10 Started mapping on | Feb 12 18:23:10 Finished on | Feb 12 18:25:04 Mapping speed, Million of reads per hour | 594.12 Number of input reads | 18813732 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17482978 Uniquely mapped reads % | 92.93% Average mapped length | 295.33 Number of splices: Total | 16334461 Number of splices: Annotated (sjdb) | 15948325 Number of splices: GT/AG | 16031553 Number of splices: GC/AG | 238399 Number of splices: AT/AC | 15098 Number of splices: Non-canonical | 49411 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 457444 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 67973 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.15% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 873310 873310 873310 N_multimapping 457444 457444 457444 N_noFeature 680904 17272738 782503 N_ambiguous 223141 1176 113734 UnstrandedReadsAssigned:16578933 PositiveStrandReadsAssigned:209064 NegativeStrandReadsAssigned:16586741 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919323 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919323-trimmed-pair1.fastq SRR12919323-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,813,732 reads, 16,686,080 reads pseudoaligned [quant] estimated average fragment length: 264.793 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR12919323.ke.tsv 34699 SRR12919323.se.tsv 87100 total ==> SRR12919323.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1754.21 688 26.2764 Potri.005G024800.1.v4.1 1035 771.207 210 18.2434 Potri.004G059700.1.v4.1 961 697.365 15 1.44108 Potri.007G009000.2.v4.1 1416 1152.21 0 0 Potri.003G141000.2.v4.1 2943 2679.21 551.177 13.783 Potri.016G087400.1.v4.1 270 85.2835 1184.53 930.553 Potri.015G069301.1.v4.1 564 317.101 0 0 Potri.010G195200.1.v4.1 1773 1509.21 168.699 7.48896 Potri.012G127500.1.v4.1 977 713.308 5368 504.19 ==> SRR12919323.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 56 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 273 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 53 SRR12919323 completed mapping pipeline successfully