Starting /dee2/code/volunteer_pipeline.sh SRR12919324 current disk space = 3051428003840 free memory = 1483610412 SRR12919324 SRAfilesize 88f42b48843b930ae62b7733507a7e64 SRR12919324.sra SRR12919324.sra file validated SRR12919324 is paired end SRR12919324 is conventional basespace SRR12919324 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919324_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.415 37.0 37.0 37.0 37.0 37.0 2 36.136 37.0 37.0 37.0 37.0 37.0 3 36.4945 37.0 37.0 37.0 37.0 37.0 4 36.5835 37.0 37.0 37.0 37.0 37.0 5 36.6465 37.0 37.0 37.0 37.0 37.0 6 36.5915 37.0 37.0 37.0 37.0 37.0 7 36.613 37.0 37.0 37.0 37.0 37.0 8 36.625 37.0 37.0 37.0 37.0 37.0 9 36.616 37.0 37.0 37.0 37.0 37.0 10-14 36.599399999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.6244 37.0 37.0 37.0 37.0 37.0 20-24 36.5784 37.0 37.0 37.0 37.0 37.0 25-29 36.5401 37.0 37.0 37.0 37.0 37.0 30-34 36.52910000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.4867 37.0 37.0 37.0 37.0 37.0 40-44 36.473699999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.504000000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.4469 37.0 37.0 37.0 37.0 37.0 55-59 36.462199999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.3682 37.0 37.0 37.0 37.0 37.0 65-69 36.3309 37.0 37.0 37.0 37.0 37.0 70-74 36.32809999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.3058 37.0 37.0 37.0 37.0 37.0 80-84 36.257400000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1462 37.0 37.0 37.0 37.0 37.0 90-94 36.187799999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.1511 37.0 37.0 37.0 37.0 37.0 100-104 36.1125 37.0 37.0 37.0 37.0 37.0 105-109 36.0777 37.0 37.0 37.0 37.0 37.0 110-114 36.02759999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.0086 37.0 37.0 37.0 37.0 37.0 120-124 35.979 37.0 37.0 37.0 37.0 37.0 125-129 35.911899999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.82299999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.722899999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.666399999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.678 37.0 37.0 37.0 37.0 37.0 150-151 35.489999999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.0 24 1.0 25 2.0 26 5.0 27 6.0 28 7.0 29 23.0 30 21.0 31 29.0 32 55.0 33 74.0 34 127.0 35 386.0 36 2886.0 37 375.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.0 13.575000000000001 5.0 39.425 2 18.015075376884422 14.49748743718593 38.768844221105525 28.71859296482412 3 17.275 17.8 29.125 35.8 4 20.775 25.624999999999996 24.375 29.225 5 22.05 31.574999999999996 26.174999999999997 20.200000000000003 6 20.474999999999998 34.625 24.224999999999998 20.674999999999997 7 14.174999999999999 27.975 40.875 16.975 8 17.5 25.224999999999998 33.324999999999996 23.95 9 17.45 23.200000000000003 34.25 25.1 10-14 20.19 29.865000000000002 27.650000000000002 22.295 15-19 19.59 28.255000000000003 27.860000000000003 24.295 20-24 19.66 28.605000000000004 27.639999999999997 24.095 25-29 19.955000000000002 28.76 27.405 23.880000000000003 30-34 19.705000000000002 28.68 27.474999999999998 24.14 35-39 19.665 28.555000000000003 28.09 23.69 40-44 19.71 28.12 28.09 24.08 45-49 19.314999999999998 28.065 28.785 23.835 50-54 19.52 28.105000000000004 28.24 24.135 55-59 19.650000000000002 28.99 27.279999999999998 24.08 60-64 19.744999999999997 28.46 27.689999999999998 24.104999999999997 65-69 20.305 28.139999999999997 28.315 23.24 70-74 20.015 28.93 27.644999999999996 23.41 75-79 20.285 28.005000000000003 28.194999999999997 23.515 80-84 20.145 28.825 27.685 23.345 85-89 20.135 29.01 27.189999999999998 23.665 90-94 20.544999999999998 28.575 27.700000000000003 23.18 95-99 20.044999999999998 28.060000000000002 28.28 23.615 100-104 20.4 28.854999999999997 27.595 23.150000000000002 105-109 20.325 28.4 27.57 23.705000000000002 110-114 20.544999999999998 27.985 27.79 23.68 115-119 20.27 28.605000000000004 27.98 23.145 120-124 20.195 28.43 27.845 23.53 125-129 20.5 28.555000000000003 26.995 23.95 130-134 20.235 28.515 27.534999999999997 23.715 135-139 20.665 28.255000000000003 27.655 23.425 140-144 20.794999999999998 28.26 27.169999999999998 23.775 145-149 21.15 28.84 26.55 23.46 150-151 20.9375 28.625 27.3375 23.1 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.0 24 1.5 25 5.5 26 7.5 27 5.5 28 8.5 29 15.5 30 21.0 31 28.5 32 33.0 33 40.0 34 65.0 35 90.5 36 101.0 37 99.5 38 119.0 39 151.0 40 189.0 41 233.0 42 231.5 43 239.5 44 271.5 45 281.5 46 278.0 47 256.5 48 233.5 49 200.0 50 169.5 51 137.0 52 110.0 53 95.0 54 62.5 55 46.5 56 43.0 57 31.5 58 25.5 59 26.5 60 16.5 61 5.5 62 4.0 63 4.0 64 4.0 65 4.0 66 1.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.05 #Duplication Level Percentage of deduplicated Percentage of total 1 92.1781640412819 84.85000000000001 2 7.142857142857142 13.15 3 0.5431830526887561 1.5 4 0.13579576317218903 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.175 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.675 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.5125 0.0 0.0 0.0 0.0 122-123 2.7625 0.0 0.0 0.0 0.0 124-125 3.05 0.0 0.0 0.0 0.0 126-127 3.3625 0.0 0.0 0.0 0.0 128-129 3.625 0.0 0.0 0.0 0.0 130-131 4.075 0.0 0.0 0.0 0.0 132-133 4.324999999999999 0.0 0.0 0.0 0.0 134-135 4.725 0.0 0.0 0.0 0.0 136-137 5.199999999999999 0.0 0.0 0.0 0.0 138-139 5.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919324 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919324_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1565 37.0 37.0 37.0 37.0 37.0 2 36.2235 37.0 37.0 37.0 37.0 37.0 3 36.203 37.0 37.0 37.0 37.0 37.0 4 36.194 37.0 37.0 37.0 37.0 37.0 5 36.2915 37.0 37.0 37.0 37.0 37.0 6 36.2945 37.0 37.0 37.0 37.0 37.0 7 36.337 37.0 37.0 37.0 37.0 37.0 8 36.338 37.0 37.0 37.0 37.0 37.0 9 36.3335 37.0 37.0 37.0 37.0 37.0 10-14 36.3073 37.0 37.0 37.0 37.0 37.0 15-19 36.29459999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.2923 37.0 37.0 37.0 37.0 37.0 25-29 36.2513 37.0 37.0 37.0 37.0 37.0 30-34 36.1768 37.0 37.0 37.0 37.0 37.0 35-39 36.1776 37.0 37.0 37.0 37.0 37.0 40-44 36.1332 37.0 37.0 37.0 37.0 37.0 45-49 36.1199 37.0 37.0 37.0 37.0 37.0 50-54 36.0312 37.0 37.0 37.0 37.0 37.0 55-59 36.0475 37.0 37.0 37.0 37.0 37.0 60-64 35.9979 37.0 37.0 37.0 37.0 37.0 65-69 36.0095 37.0 37.0 37.0 37.0 37.0 70-74 35.917199999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.9387 37.0 37.0 37.0 37.0 37.0 80-84 35.8965 37.0 37.0 37.0 37.0 37.0 85-89 35.8307 37.0 37.0 37.0 37.0 37.0 90-94 35.79350000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.78830000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.7621 37.0 37.0 37.0 37.0 37.0 105-109 35.6937 37.0 37.0 37.0 37.0 37.0 110-114 35.705600000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.685199999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.583000000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.63290000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.5382 37.0 37.0 37.0 37.0 37.0 135-139 35.444399999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.353300000000004 37.0 37.0 37.0 29.8 37.0 145-149 35.2585 37.0 37.0 37.0 29.8 37.0 150-151 35.105000000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 1.0 16 4.0 17 1.0 18 1.0 19 1.0 20 2.0 21 5.0 22 4.0 23 4.0 24 7.0 25 5.0 26 6.0 27 13.0 28 12.0 29 16.0 30 19.0 31 42.0 32 71.0 33 125.0 34 200.0 35 541.0 36 2651.0 37 266.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.45 26.6 8.95 25.0 2 27.125 27.55 29.725 15.6 3 19.5 28.7 33.050000000000004 18.75 4 21.625 34.875 24.25 19.25 5 24.4 37.724999999999994 21.099999999999998 16.775000000000002 6 20.525 40.425 22.875 16.175 7 20.875 22.975 37.875 18.275 8 20.8 26.674999999999997 28.075 24.45 9 20.65 24.775 31.6 22.975 10-14 22.875 29.64 26.31 21.175 15-19 23.415 28.244999999999997 27.16 21.18 20-24 22.439999999999998 28.71 27.82 21.029999999999998 25-29 22.89 28.415000000000003 27.775 20.919999999999998 30-34 22.305 27.950000000000003 28.505000000000003 21.240000000000002 35-39 22.645 27.93 28.42 21.005 40-44 23.0 28.21 28.110000000000003 20.68 45-49 22.5 28.299999999999997 28.595 20.605 50-54 22.725 28.475 27.939999999999998 20.86 55-59 22.400000000000002 28.1 28.485 21.015 60-64 22.869999999999997 27.195000000000004 28.77 21.165 65-69 22.525000000000002 28.16 28.439999999999998 20.875 70-74 23.515 27.68 27.445000000000004 21.36 75-79 23.425 27.755000000000003 28.125 20.695 80-84 22.825 28.315 28.23 20.630000000000003 85-89 23.69 27.529999999999998 28.000000000000004 20.78 90-94 23.494999999999997 27.62 28.155 20.73 95-99 22.884999999999998 27.91 28.435 20.77 100-104 24.310000000000002 27.73 27.715 20.244999999999997 105-109 23.380000000000003 27.634999999999998 28.605000000000004 20.380000000000003 110-114 23.655 28.43 27.779999999999998 20.135 115-119 24.135 27.665 28.105000000000004 20.095 120-124 24.58 27.61 27.395000000000003 20.415 125-129 24.055 28.255000000000003 27.61 20.080000000000002 130-134 24.505 28.58 27.195000000000004 19.72 135-139 24.455 28.92 26.924999999999997 19.7 140-144 24.69 28.310000000000002 27.279999999999998 19.72 145-149 24.685000000000002 28.04 27.16 20.115 150-151 24.875 28.425 25.75 20.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 1.5 16 1.5 17 0.0 18 0.5 19 1.0 20 2.5 21 2.5 22 0.5 23 0.5 24 0.5 25 3.0 26 3.5 27 1.5 28 8.0 29 16.0 30 15.5 31 17.5 32 28.5 33 43.5 34 60.0 35 80.5 36 94.5 37 112.0 38 149.5 39 183.0 40 202.0 41 223.5 42 246.0 43 283.5 44 308.5 45 293.0 46 260.0 47 227.5 48 207.5 49 184.0 50 154.0 51 119.5 52 99.0 53 81.0 54 56.0 55 45.5 56 42.5 57 36.0 58 24.5 59 19.0 60 14.5 61 10.0 62 7.0 63 4.0 64 5.0 65 3.5 66 2.5 67 1.5 68 0.0 69 0.0 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 1.0 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.2 #Duplication Level Percentage of deduplicated Percentage of total 1 92.353579175705 85.15 2 6.968546637744034 12.85 3 0.5422993492407809 1.5 4 0.13557483731019523 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.7124999999999999 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.3625 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.7 0.0 0.0 0.0 0.0 114-115 1.925 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.3375 0.0 0.0 0.0 0.0 120-121 2.5375 0.0 0.0 0.0 0.0 122-123 2.7875 0.0 0.0 0.0 0.0 124-125 3.075 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.6500000000000004 0.0 0.0 0.0 0.0 130-131 4.1 0.0 0.0 0.0 0.0 132-133 4.3625 0.0 0.0 0.0 0.0 134-135 4.775 0.0 0.0 0.0 0.0 136-137 5.25 0.0 0.0 0.0 0.0 138-139 5.637499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGAGA 10 0.006830828 145.0 6 >>END_MODULE Read 890371 spots for SRR12919324.sra Written 890371 spots for SRR12919324.sra Read 890371 spots for SRR12919324.sra Written 890371 spots for SRR12919324.sra Read 890371 spots for SRR12919324.sra Written 890371 spots for SRR12919324.sra Read 890386 spots for SRR12919324.sra Written 890386 spots for SRR12919324.sra Read 890371 spots for SRR12919324.sra Written 890371 spots for SRR12919324.sra Read 890371 spots for SRR12919324.sra Written 890371 spots for SRR12919324.sra Read 890371 spots for SRR12919324.sra Written 890371 spots for SRR12919324.sra Read 890371 spots for SRR12919324.sra Written 890371 spots for SRR12919324.sra Read 890371 spots for SRR12919324.sra Written 890371 spots for SRR12919324.sra Read 890371 spots for SRR12919324.sra Written 890371 spots for SRR12919324.sra Read 890371 spots for SRR12919324.sra Written 890371 spots for SRR12919324.sra Read 890371 spots for SRR12919324.sra Read 890371 spots for SRR12919324.sra Written 890371 spots for SRR12919324.sra Written 890371 spots for SRR12919324.sra Read 890371 spots for SRR12919324.sra Written 890371 spots for SRR12919324.sra Read 890371 spots for SRR12919324.sra Written 890371 spots for SRR12919324.sra Read 890371 spots for SRR12919324.sra Written 890371 spots for SRR12919324.sra Read 890371 spots for SRR12919324.sra Written 890371 spots for SRR12919324.sra Read 890371 spots for SRR12919324.sra Written 890371 spots for SRR12919324.sra Read 890371 spots for SRR12919324.sra Written 890371 spots for SRR12919324.sra Read 890371 spots for SRR12919324.sra Written 890371 spots for SRR12919324.sra SRR ids: ['SRR12919324.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g3zjkijd SRR12919324.sra spots: 17807435 blocks: [[1, 890371], [890372, 1780742], [1780743, 2671113], [2671114, 3561484], [3561485, 4451855], [4451856, 5342226], [5342227, 6232597], [6232598, 7122968], [7122969, 8013339], [8013340, 8903710], [8903711, 9794081], [9794082, 10684452], [10684453, 11574823], [11574824, 12465194], [12465195, 13355565], [13355566, 14245936], [14245937, 15136307], [15136308, 16026678], [16026679, 16917049], [16917050, 17807435]] SRR12919324 file size 6030045 SRR12919324 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919324 SRR12919324_1.fastq SRR12919324_2.fastq Input file: SRR12919324_1.fastq Paired file: SRR12919324_2.fastq trimmed: SRR12919324-trimmed-pair1.fastq, SRR12919324-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:12:07 2025 >> started Wed Feb 12 18:12:27 2025 >> done (20.140s) 17807435 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 209 ( 0.00%) empty read pairs filtered out after trimming by size control 17807199 (100.00%) read pairs available; of these: 1650014 ( 9.27%) trimmed read pairs available after processing 16157185 (90.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 4 0.00% 21 1 0.00% 22 0 0.00% 23 3 0.00% 24 7 0.00% 25 1 0.00% 26 4 0.00% 27 2 0.00% 28 6 0.00% 29 5 0.00% 30 6 0.00% 31 5 0.00% 32 8 0.00% 33 14 0.00% 34 8 0.00% 35 5 0.00% 36 10 0.00% 37 9 0.00% 38 16 0.00% 39 16 0.00% 40 23 0.00% 41 23 0.00% 42 17 0.00% 43 27 0.00% 44 18 0.00% 45 22 0.00% 46 24 0.00% 47 33 0.00% 48 22 0.00% 49 43 0.00% 50 56 0.00% 51 40 0.00% 52 69 0.00% 53 70 0.00% 54 68 0.00% 55 70 0.00% 56 82 0.00% 57 88 0.00% 58 88 0.00% 59 154 0.00% 60 145 0.00% 61 182 0.00% 62 206 0.00% 63 215 0.00% 64 234 0.00% 65 252 0.00% 66 255 0.00% 67 277 0.00% 68 371 0.00% 69 461 0.00% 70 489 0.00% 71 572 0.00% 72 693 0.00% 73 816 0.00% 74 870 0.00% 75 920 0.01% 76 1122 0.01% 77 1171 0.01% 78 1387 0.01% 79 1472 0.01% 80 1684 0.01% 81 1992 0.01% 82 2353 0.01% 83 2656 0.01% 84 2967 0.02% 85 3202 0.02% 86 3553 0.02% 87 3703 0.02% 88 3976 0.02% 89 4393 0.02% 90 4852 0.03% 91 5387 0.03% 92 6088 0.03% 93 6945 0.04% 94 7566 0.04% 95 7943 0.04% 96 8584 0.05% 97 8913 0.05% 98 9587 0.05% 99 9821 0.06% 100 10569 0.06% 101 11362 0.06% 102 12378 0.07% 103 13512 0.08% 104 14402 0.08% 105 15335 0.09% 106 15992 0.09% 107 16140 0.09% 108 16737 0.09% 109 17571 0.10% 110 17848 0.10% 111 18959 0.11% 112 19966 0.11% 113 20891 0.12% 114 22545 0.13% 115 23278 0.13% 116 23731 0.13% 117 24249 0.14% 118 24843 0.14% 119 24685 0.14% 120 25949 0.15% 121 26501 0.15% 122 27335 0.15% 123 28906 0.16% 124 30042 0.17% 125 30893 0.17% 126 31545 0.18% 127 32531 0.18% 128 32433 0.18% 129 32664 0.18% 130 33271 0.19% 131 33841 0.19% 132 35034 0.20% 133 36683 0.21% 134 37447 0.21% 135 38747 0.22% 136 39438 0.22% 137 39676 0.22% 138 40578 0.23% 139 40872 0.23% 140 40570 0.23% 141 41298 0.23% 142 42142 0.24% 143 43157 0.24% 144 44470 0.25% 145 45293 0.25% 146 46283 0.26% 147 46576 0.26% 148 46646 0.26% 149 46958 0.26% 150 47794 0.27% 151 16157185 90.73% 17807199 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=10.68 fanout-score-rank=17 prefix-density=0.28 prefix-fanout=4.9 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=17 fanout-score=438.23 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=35.4 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=33 prefix-density=0.17 prefix-fanout=2.4 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=892.09 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=20.6 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAGCTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACA SRR12919324 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:13:16 Started mapping on | Feb 12 18:13:17 Finished on | Feb 12 18:15:34 Mapping speed, Million of reads per hour | 467.93 Number of input reads | 17807199 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16328813 Uniquely mapped reads % | 91.70% Average mapped length | 296.18 Number of splices: Total | 15300046 Number of splices: Annotated (sjdb) | 14949825 Number of splices: GT/AG | 15009939 Number of splices: GC/AG | 226127 Number of splices: AT/AC | 14672 Number of splices: Non-canonical | 49308 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 432473 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 73487 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.31% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1045913 1045913 1045913 N_multimapping 432473 432473 432473 N_noFeature 612263 16132755 690734 N_ambiguous 219497 942 101536 UnstrandedReadsAssigned:15497053 PositiveStrandReadsAssigned:195116 NegativeStrandReadsAssigned:15536543 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919324 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919324-trimmed-pair1.fastq SRR12919324-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,807,199 reads, 15,615,705 reads pseudoaligned [quant] estimated average fragment length: 270.235 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52401 SRR12919324.ke.tsv 34699 SRR12919324.se.tsv 87100 total ==> SRR12919324.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.76 591 23.5372 Potri.005G024800.1.v4.1 1035 765.765 78 7.09411 Potri.004G059700.1.v4.1 961 691.946 86 8.65616 Potri.007G009000.2.v4.1 1416 1146.76 0 0 Potri.003G141000.2.v4.1 2943 2673.76 596.3 15.5325 Potri.016G087400.1.v4.1 270 82.9361 1072.61 900.731 Potri.015G069301.1.v4.1 564 312.323 0 0 Potri.010G195200.1.v4.1 1773 1503.76 100 4.63147 Potri.012G127500.1.v4.1 977 707.87 6690 658.22 ==> SRR12919324.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 261 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 227 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 4 SRR12919324 completed mapping pipeline successfully