Starting /dee2/code/volunteer_pipeline.sh SRR12919325 current disk space = 3051184758784 free memory = 1580380468 SRR12919325 SRAfilesize e152902e37a7e39648fc04041c8ffff9 SRR12919325.sra SRR12919325.sra file validated SRR12919325 is paired end SRR12919325 is conventional basespace SRR12919325 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919325_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5715 37.0 37.0 37.0 37.0 37.0 2 36.2535 37.0 37.0 37.0 37.0 37.0 3 36.5705 37.0 37.0 37.0 37.0 37.0 4 36.658 37.0 37.0 37.0 37.0 37.0 5 36.697 37.0 37.0 37.0 37.0 37.0 6 36.64 37.0 37.0 37.0 37.0 37.0 7 36.6035 37.0 37.0 37.0 37.0 37.0 8 36.768 37.0 37.0 37.0 37.0 37.0 9 36.705 37.0 37.0 37.0 37.0 37.0 10-14 36.675 37.0 37.0 37.0 37.0 37.0 15-19 36.6917 37.0 37.0 37.0 37.0 37.0 20-24 36.626200000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.619099999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.5284 37.0 37.0 37.0 37.0 37.0 35-39 36.522 37.0 37.0 37.0 37.0 37.0 40-44 36.521 37.0 37.0 37.0 37.0 37.0 45-49 36.5034 37.0 37.0 37.0 37.0 37.0 50-54 36.5087 37.0 37.0 37.0 37.0 37.0 55-59 36.4945 37.0 37.0 37.0 37.0 37.0 60-64 36.453799999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.41760000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.38 37.0 37.0 37.0 37.0 37.0 75-79 36.3675 37.0 37.0 37.0 37.0 37.0 80-84 36.4157 37.0 37.0 37.0 37.0 37.0 85-89 36.2961 37.0 37.0 37.0 37.0 37.0 90-94 36.2722 37.0 37.0 37.0 37.0 37.0 95-99 36.222500000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.2128 37.0 37.0 37.0 37.0 37.0 105-109 36.2149 37.0 37.0 37.0 37.0 37.0 110-114 36.15490000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.106700000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.0817 37.0 37.0 37.0 37.0 37.0 125-129 36.0157 37.0 37.0 37.0 37.0 37.0 130-134 35.950199999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.9634 37.0 37.0 37.0 37.0 37.0 140-144 35.774899999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.78159999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.6225 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 2.0 25 1.0 26 4.0 27 6.0 28 6.0 29 11.0 30 24.0 31 28.0 32 41.0 33 64.0 34 112.0 35 301.0 36 2951.0 37 444.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.975 13.925 6.25 38.85 2 18.756294058408862 13.595166163141995 36.80765357502518 30.840886203423967 3 17.45 17.025000000000002 28.825 36.7 4 20.95 25.650000000000002 24.8 28.599999999999998 5 21.775 31.225 25.0 22.0 6 20.9 34.525 23.75 20.825 7 14.674999999999999 27.775 41.425 16.125 8 18.175 26.775 31.724999999999998 23.325000000000003 9 17.775 23.9 34.75 23.575 10-14 19.59 30.654999999999998 27.24 22.515 15-19 19.755 28.48 28.015 23.75 20-24 19.865 28.720000000000002 28.015 23.400000000000002 25-29 19.5 28.904999999999998 28.000000000000004 23.595 30-34 20.035 28.825 27.975 23.165 35-39 20.11 28.895 27.41 23.585 40-44 20.349999999999998 29.075 27.250000000000004 23.325000000000003 45-49 19.994999999999997 28.685 27.715 23.605 50-54 20.095 29.005 27.169999999999998 23.73 55-59 20.19 28.62 27.224999999999998 23.965 60-64 20.064999999999998 29.01 27.58 23.345 65-69 20.175 28.52 27.815 23.49 70-74 20.315 28.884999999999998 27.435 23.365 75-79 20.424999999999997 28.68 27.51 23.385 80-84 20.135 28.62 27.605 23.64 85-89 20.080000000000002 29.060000000000002 27.675 23.185 90-94 19.86 28.875 27.83 23.435 95-99 20.06 28.610000000000003 27.88 23.45 100-104 20.51 28.775000000000002 27.529999999999998 23.185 105-109 20.560000000000002 28.749999999999996 27.145000000000003 23.544999999999998 110-114 20.78 28.775000000000002 26.974999999999998 23.47 115-119 20.785 28.384999999999998 27.250000000000004 23.580000000000002 120-124 20.34 28.499999999999996 27.265 23.895 125-129 20.755000000000003 28.084999999999997 27.27 23.89 130-134 21.04 28.615000000000002 26.825 23.52 135-139 21.37 28.59 26.705000000000002 23.335 140-144 20.65 28.849999999999998 26.905 23.595 145-149 20.46 28.605000000000004 26.484999999999996 24.45 150-151 20.8625 28.4375 26.724999999999998 23.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 1.0 23 1.5 24 2.5 25 3.5 26 5.5 27 6.5 28 8.0 29 14.5 30 19.0 31 31.0 32 40.0 33 45.0 34 48.5 35 67.0 36 97.5 37 109.5 38 139.5 39 161.0 40 174.0 41 230.0 42 258.5 43 264.5 44 276.0 45 269.0 46 270.0 47 257.5 48 228.0 49 197.5 50 168.0 51 144.5 52 117.0 53 82.0 54 64.5 55 56.5 56 40.5 57 27.5 58 21.0 59 16.0 60 9.5 61 8.0 62 5.5 63 4.0 64 2.5 65 0.5 66 0.5 67 0.5 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.7000000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.97682119205298 82.425 2 7.891832229580574 14.299999999999999 3 0.9381898454746136 2.55 4 0.16556291390728478 0.6 5 0.02759381898454746 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTACATACAAAATGACGGCAAGAGATTGAGCCAGATAATAAAAGTGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.11249999999999999 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.1124999999999998 0.0 0.0 0.0 0.0 100-101 1.3625 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.2125 0.0 0.0 0.0 0.0 108-109 2.4375 0.0 0.0 0.0 0.0 110-111 2.625 0.0 0.0 0.0 0.0 112-113 2.9 0.0 0.0 0.0 0.0 114-115 3.2875 0.0 0.0 0.0 0.0 116-117 3.55 0.0 0.0 0.0 0.0 118-119 3.9375 0.0 0.0 0.0 0.0 120-121 4.3 0.0 0.0 0.0 0.0 122-123 4.6875 0.0 0.0 0.0 0.0 124-125 5.1 0.0 0.0 0.0 0.0 126-127 5.8375 0.0 0.0 0.0 0.0 128-129 6.5625 0.0 0.0 0.0 0.0 130-131 6.9875 0.0 0.0 0.0 0.0 132-133 7.4375 0.0 0.0 0.0 0.0 134-135 7.862500000000001 0.0 0.0 0.0 0.0 136-137 8.5125 0.0 0.0 0.0 0.0 138-139 8.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATATTT 10 0.006830828 145.0 3 >>END_MODULE SRR12919325 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919325_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.245 37.0 37.0 37.0 37.0 37.0 2 36.196 37.0 37.0 37.0 37.0 37.0 3 36.3415 37.0 37.0 37.0 37.0 37.0 4 36.2445 37.0 37.0 37.0 37.0 37.0 5 36.372 37.0 37.0 37.0 37.0 37.0 6 36.378 37.0 37.0 37.0 37.0 37.0 7 36.3545 37.0 37.0 37.0 37.0 37.0 8 36.4545 37.0 37.0 37.0 37.0 37.0 9 36.2885 37.0 37.0 37.0 37.0 37.0 10-14 36.3614 37.0 37.0 37.0 37.0 37.0 15-19 36.298199999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.3425 37.0 37.0 37.0 37.0 37.0 25-29 36.2161 37.0 37.0 37.0 37.0 37.0 30-34 36.2624 37.0 37.0 37.0 37.0 37.0 35-39 36.2002 37.0 37.0 37.0 37.0 37.0 40-44 36.2101 37.0 37.0 37.0 37.0 37.0 45-49 36.159200000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.1944 37.0 37.0 37.0 37.0 37.0 55-59 36.1103 37.0 37.0 37.0 37.0 37.0 60-64 36.1059 37.0 37.0 37.0 37.0 37.0 65-69 36.051 37.0 37.0 37.0 37.0 37.0 70-74 36.0363 37.0 37.0 37.0 37.0 37.0 75-79 35.961 37.0 37.0 37.0 37.0 37.0 80-84 35.9499 37.0 37.0 37.0 37.0 37.0 85-89 35.9613 37.0 37.0 37.0 37.0 37.0 90-94 35.85600000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.9112 37.0 37.0 37.0 37.0 37.0 100-104 35.9273 37.0 37.0 37.0 37.0 37.0 105-109 35.7863 37.0 37.0 37.0 37.0 37.0 110-114 35.7928 37.0 37.0 37.0 37.0 37.0 115-119 35.7398 37.0 37.0 37.0 37.0 37.0 120-124 35.690200000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.677200000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.4705 37.0 37.0 37.0 37.0 37.0 135-139 35.3855 37.0 37.0 37.0 34.6 37.0 140-144 35.3601 37.0 37.0 37.0 32.2 37.0 145-149 35.1722 37.0 37.0 37.0 27.4 37.0 150-151 35.0515 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 2.0 16 0.0 17 2.0 18 1.0 19 0.0 20 2.0 21 2.0 22 4.0 23 3.0 24 5.0 25 4.0 26 7.0 27 4.0 28 11.0 29 22.0 30 25.0 31 40.0 32 63.0 33 108.0 34 221.0 35 528.0 36 2657.0 37 286.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.75 24.675 9.5 27.075 2 26.625 26.275 31.125000000000004 15.975 3 19.075 28.549999999999997 32.725 19.650000000000002 4 21.975 35.225 24.025 18.775 5 24.099999999999998 34.975 23.075000000000003 17.849999999999998 6 20.875 38.1 23.5 17.525 7 20.8 22.775000000000002 37.7 18.725 8 20.625 25.474999999999998 27.825 26.075 9 21.525 24.675 29.849999999999998 23.95 10-14 23.115 29.349999999999998 26.395000000000003 21.14 15-19 23.425 28.165000000000003 27.584999999999997 20.825 20-24 22.57 27.615000000000002 28.58 21.235 25-29 23.5 28.215 27.605 20.68 30-34 22.915 28.255000000000003 28.32 20.51 35-39 22.89 27.805000000000003 27.860000000000003 21.445 40-44 23.305 27.87 28.12 20.705000000000002 45-49 23.145 27.98 28.425 20.45 50-54 23.425 27.694999999999997 27.860000000000003 21.02 55-59 22.900000000000002 27.915 28.175 21.01 60-64 22.825 27.805000000000003 28.015 21.355 65-69 23.155 27.47 28.810000000000002 20.565 70-74 23.605 27.755000000000003 27.825 20.815 75-79 23.815 27.810000000000002 27.74 20.635 80-84 23.02 28.000000000000004 28.360000000000003 20.62 85-89 23.62 27.744999999999997 27.83 20.805 90-94 23.57 28.54 28.225 19.665 95-99 23.93 28.175 27.26 20.635 100-104 24.27 27.650000000000002 27.505000000000003 20.575 105-109 24.21 28.325 27.355 20.11 110-114 24.62 27.639999999999997 27.3 20.44 115-119 24.315 27.77 27.54 20.375 120-124 24.16 28.144999999999996 27.525 20.169999999999998 125-129 24.11 28.634999999999998 27.265 19.99 130-134 24.725 28.335 27.229999999999997 19.71 135-139 25.124999999999996 27.644999999999996 27.16 20.07 140-144 25.885 28.04 26.889999999999997 19.185 145-149 25.674999999999997 28.26 26.295 19.77 150-151 26.424999999999997 28.325 26.825 18.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 3.5 23 3.0 24 2.0 25 3.5 26 3.5 27 5.0 28 12.0 29 17.0 30 13.5 31 22.0 32 30.5 33 31.0 34 41.5 35 54.5 36 79.0 37 101.0 38 154.5 39 203.5 40 198.5 41 230.0 42 269.5 43 271.0 44 266.0 45 255.0 46 254.5 47 251.0 48 224.0 49 195.0 50 174.5 51 143.0 52 112.0 53 88.0 54 60.5 55 46.0 56 46.0 57 34.5 58 17.5 59 18.5 60 16.5 61 9.0 62 6.0 63 5.0 64 4.0 65 3.0 66 2.0 67 3.0 68 2.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.03200883002206 82.475 2 7.836644591611479 14.2 3 0.9105960264900662 2.475 4 0.16556291390728478 0.6 5 0.05518763796909492 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCTTGTTTGCATCCTTCAGGATCATGCTTGCGTTGTATTCTTTACAAG 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.11249999999999999 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.6875 0.0 0.0 0.0 0.0 104-105 1.925 0.0 0.0 0.0 0.0 106-107 2.2875 0.0 0.0 0.0 0.0 108-109 2.5125 0.0 0.0 0.0 0.0 110-111 2.7 0.0 0.0 0.0 0.0 112-113 2.975 0.0 0.0 0.0 0.0 114-115 3.3625 0.0 0.0 0.0 0.0 116-117 3.6500000000000004 0.0 0.0 0.0 0.0 118-119 4.050000000000001 0.0 0.0 0.0 0.0 120-121 4.425 0.0 0.0 0.0 0.0 122-123 4.8375 0.0 0.0 0.0 0.0 124-125 5.25 0.0 0.0 0.0 0.0 126-127 5.975 0.0 0.0 0.0 0.0 128-129 6.6875 0.0 0.0 0.0 0.0 130-131 7.125 0.0 0.0 0.0 0.0 132-133 7.5875 0.0 0.0 0.0 0.0 134-135 8.05 0.0 0.0 0.0 0.0 136-137 8.7125 0.0 0.0 0.0 0.0 138-139 9.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTTTG 10 0.006830828 145.0 4 GTTGTGG 10 0.006830828 145.0 145 GTTTGTT 25 8.7132835E-4 87.0 1 >>END_MODULE Read 909705 spots for SRR12919325.sra Written 909705 spots for SRR12919325.sra Read 909705 spots for SRR12919325.sra Written 909705 spots for SRR12919325.sra Read 909705 spots for SRR12919325.sra Written 909705 spots for SRR12919325.sra Read 909705 spots for SRR12919325.sra Written 909705 spots for SRR12919325.sra Read 909705 spots for SRR12919325.sra Written 909705 spots for SRR12919325.sra Read 909705 spots for SRR12919325.sra Written 909705 spots for SRR12919325.sra Read 909705 spots for SRR12919325.sra Written 909705 spots for SRR12919325.sra Read 909705 spots for SRR12919325.sra Written 909705 spots for SRR12919325.sra Read 909705 spots for SRR12919325.sra Written 909705 spots for SRR12919325.sra Read 909705 spots for SRR12919325.sra Written 909705 spots for SRR12919325.sra Read 909705 spots for SRR12919325.sra Written 909705 spots for SRR12919325.sra Read 909705 spots for SRR12919325.sra Written 909705 spots for SRR12919325.sra Read 909705 spots for SRR12919325.sra Written 909705 spots for SRR12919325.sra Read 909722 spots for SRR12919325.sra Written 909722 spots for SRR12919325.sra Read 909705 spots for SRR12919325.sra Written 909705 spots for SRR12919325.sra Read 909705 spots for SRR12919325.sra Written 909705 spots for SRR12919325.sra Read 909705 spots for SRR12919325.sra Written 909705 spots for SRR12919325.sra Read 909705 spots for SRR12919325.sra Written 909705 spots for SRR12919325.sra Read 909705 spots for SRR12919325.sra Written 909705 spots for SRR12919325.sra Read 909705 spots for SRR12919325.sra Written 909705 spots for SRR12919325.sra SRR ids: ['SRR12919325.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__o51nlp0 SRR12919325.sra spots: 18194117 blocks: [[1, 909705], [909706, 1819410], [1819411, 2729115], [2729116, 3638820], [3638821, 4548525], [4548526, 5458230], [5458231, 6367935], [6367936, 7277640], [7277641, 8187345], [8187346, 9097050], [9097051, 10006755], [10006756, 10916460], [10916461, 11826165], [11826166, 12735870], [12735871, 13645575], [13645576, 14555280], [14555281, 15464985], [15464986, 16374690], [16374691, 17284395], [17284396, 18194117]] SRR12919325 file size 6161456 SRR12919325 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919325 SRR12919325_1.fastq SRR12919325_2.fastq Input file: SRR12919325_1.fastq Paired file: SRR12919325_2.fastq trimmed: SRR12919325-trimmed-pair1.fastq, SRR12919325-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:00:35 2025 >> started Wed Feb 12 19:00:55 2025 >> done (19.730s) 18194117 read pairs processed; of these: 30 ( 0.00%) short read pairs filtered out after trimming by size control 3311 ( 0.02%) empty read pairs filtered out after trimming by size control 18190776 (99.98%) read pairs available; of these: 2451710 (13.48%) trimmed read pairs available after processing 15739066 (86.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 2 0.00% 22 5 0.00% 23 8 0.00% 24 5 0.00% 25 5 0.00% 26 13 0.00% 27 8 0.00% 28 16 0.00% 29 12 0.00% 30 10 0.00% 31 14 0.00% 32 19 0.00% 33 13 0.00% 34 12 0.00% 35 14 0.00% 36 16 0.00% 37 14 0.00% 38 27 0.00% 39 27 0.00% 40 33 0.00% 41 42 0.00% 42 24 0.00% 43 37 0.00% 44 49 0.00% 45 48 0.00% 46 51 0.00% 47 65 0.00% 48 88 0.00% 49 73 0.00% 50 112 0.00% 51 103 0.00% 52 121 0.00% 53 127 0.00% 54 162 0.00% 55 186 0.00% 56 188 0.00% 57 232 0.00% 58 225 0.00% 59 294 0.00% 60 340 0.00% 61 388 0.00% 62 503 0.00% 63 517 0.00% 64 610 0.00% 65 675 0.00% 66 695 0.00% 67 807 0.00% 68 914 0.01% 69 1048 0.01% 70 1236 0.01% 71 1510 0.01% 72 1729 0.01% 73 2038 0.01% 74 2318 0.01% 75 2463 0.01% 76 2715 0.01% 77 2970 0.02% 78 3301 0.02% 79 3551 0.02% 80 4060 0.02% 81 4760 0.03% 82 5473 0.03% 83 6107 0.03% 84 6822 0.04% 85 7419 0.04% 86 7697 0.04% 87 8164 0.04% 88 9056 0.05% 89 9493 0.05% 90 10177 0.06% 91 11277 0.06% 92 12545 0.07% 93 13960 0.08% 94 14922 0.08% 95 16019 0.09% 96 16530 0.09% 97 17276 0.09% 98 17514 0.10% 99 18679 0.10% 100 19410 0.11% 101 20177 0.11% 102 21801 0.12% 103 23222 0.13% 104 24698 0.14% 105 25855 0.14% 106 26871 0.15% 107 27522 0.15% 108 27490 0.15% 109 28178 0.15% 110 28624 0.16% 111 30353 0.17% 112 31618 0.17% 113 32682 0.18% 114 33930 0.19% 115 35651 0.20% 116 36488 0.20% 117 37304 0.21% 118 37727 0.21% 119 38359 0.21% 120 38411 0.21% 121 39410 0.22% 122 40448 0.22% 123 42003 0.23% 124 43757 0.24% 125 45047 0.25% 126 46770 0.26% 127 46890 0.26% 128 46870 0.26% 129 46969 0.26% 130 47678 0.26% 131 48159 0.26% 132 49661 0.27% 133 50706 0.28% 134 51238 0.28% 135 52865 0.29% 136 54237 0.30% 137 54840 0.30% 138 55288 0.30% 139 55952 0.31% 140 55477 0.30% 141 55757 0.31% 142 56637 0.31% 143 57333 0.32% 144 59385 0.33% 145 59872 0.33% 146 61716 0.34% 147 62015 0.34% 148 62780 0.35% 149 61742 0.34% 150 63053 0.35% 151 15739066 86.52% 18190776 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=5.26 fanout-score-rank=17 prefix-density=0.25 prefix-fanout=3.3 sequence=TCCTTGTCCTGGATCTTGGCCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=40 fanout-score=23.88 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.8 sequence=AAGTCCACCAGAACAAAAGATAGCAAAGCATTCAAGGATAAAACTAAAACTAATAAAGCTAGCACTTGCACATCAAGGCCAGCTATTGGCACTCTTCAGCACTTGACCTCCTTCAAAGAAGGGGCAAAGTACAAGAATGTTGGATCGGTAGCACCTTCTTTGTAATAAGCAAAGACCAA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=38 prefix-density=0.18 prefix-fanout=2.3 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=680.68 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=13.8 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAGCTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACA SRR12919325 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:01:50 Started mapping on | Feb 12 19:01:50 Finished on | Feb 12 19:03:35 Mapping speed, Million of reads per hour | 623.68 Number of input reads | 18190776 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17094161 Uniquely mapped reads % | 93.97% Average mapped length | 293.62 Number of splices: Total | 15841286 Number of splices: Annotated (sjdb) | 15485285 Number of splices: GT/AG | 15544761 Number of splices: GC/AG | 230001 Number of splices: AT/AC | 14884 Number of splices: Non-canonical | 51640 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.03% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 445210 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 46810 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 651405 651405 651405 N_multimapping 445210 445210 445210 N_noFeature 690740 16867336 795065 N_ambiguous 223568 1092 100410 UnstrandedReadsAssigned:16179853 PositiveStrandReadsAssigned:225733 NegativeStrandReadsAssigned:16198686 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919325 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919325-trimmed-pair1.fastq SRR12919325-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,190,776 reads, 16,233,314 reads pseudoaligned [quant] estimated average fragment length: 247.612 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52401 SRR12919325.ke.tsv 34699 SRR12919325.se.tsv 87100 total ==> SRR12919325.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.39 513 19.88 Potri.005G024800.1.v4.1 1035 788.388 168 14.6279 Potri.004G059700.1.v4.1 961 714.52 54 5.1879 Potri.007G009000.2.v4.1 1416 1169.39 0 0 Potri.003G141000.2.v4.1 2943 2696.39 742.404 18.9004 Potri.016G087400.1.v4.1 270 90.0259 1216 927.21 Potri.015G069301.1.v4.1 564 331.088 0 0 Potri.010G195200.1.v4.1 1773 1526.39 110 4.94698 Potri.012G127500.1.v4.1 977 730.467 10310 968.88 ==> SRR12919325.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 140 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 272 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 19 SRR12919325 completed mapping pipeline successfully