Starting /dee2/code/volunteer_pipeline.sh SRR12919326 current disk space = 3051384512512 free memory = 1426390728 SRR12919326 SRAfilesize ffa88dc109912a2883c0b4230c937726 SRR12919326.sra SRR12919326.sra file validated SRR12919326 is paired end SRR12919326 is conventional basespace SRR12919326 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919326_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.483 37.0 37.0 37.0 37.0 37.0 2 36.2395 37.0 37.0 37.0 37.0 37.0 3 36.5535 37.0 37.0 37.0 37.0 37.0 4 36.602 37.0 37.0 37.0 37.0 37.0 5 36.6525 37.0 37.0 37.0 37.0 37.0 6 36.634 37.0 37.0 37.0 37.0 37.0 7 36.5245 37.0 37.0 37.0 37.0 37.0 8 36.604 37.0 37.0 37.0 37.0 37.0 9 36.6255 37.0 37.0 37.0 37.0 37.0 10-14 36.6099 37.0 37.0 37.0 37.0 37.0 15-19 36.57039999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.60530000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.538199999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.5047 37.0 37.0 37.0 37.0 37.0 35-39 36.4764 37.0 37.0 37.0 37.0 37.0 40-44 36.479200000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.4591 37.0 37.0 37.0 37.0 37.0 50-54 36.4475 37.0 37.0 37.0 37.0 37.0 55-59 36.3889 37.0 37.0 37.0 37.0 37.0 60-64 36.3552 37.0 37.0 37.0 37.0 37.0 65-69 36.3533 37.0 37.0 37.0 37.0 37.0 70-74 36.32019999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.253499999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.289 37.0 37.0 37.0 37.0 37.0 85-89 36.1804 37.0 37.0 37.0 37.0 37.0 90-94 36.159000000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.1754 37.0 37.0 37.0 37.0 37.0 100-104 36.11900000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.084500000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.9904 37.0 37.0 37.0 37.0 37.0 115-119 36.0445 37.0 37.0 37.0 37.0 37.0 120-124 35.9979 37.0 37.0 37.0 37.0 37.0 125-129 35.884899999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.81420000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.7892 37.0 37.0 37.0 37.0 37.0 140-144 35.697900000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.69970000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.417249999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 1.0 23 1.0 24 5.0 25 4.0 26 4.0 27 9.0 28 12.0 29 16.0 30 29.0 31 41.0 32 49.0 33 56.0 34 117.0 35 331.0 36 2972.0 37 352.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.75 13.15 5.35 40.75 2 18.45806127574083 13.862380713209443 38.473129080863885 29.206428930185837 3 16.075 17.275 29.925 36.725 4 21.7 24.9 24.474999999999998 28.925 5 22.475 31.674999999999997 24.875 20.974999999999998 6 20.424999999999997 33.2 23.825 22.55 7 15.775 26.924999999999997 41.6 15.7 8 16.125 26.3 33.125 24.45 9 17.25 23.200000000000003 35.05 24.5 10-14 20.175 29.599999999999998 28.005000000000003 22.220000000000002 15-19 19.555 28.27 28.43 23.745 20-24 19.785 28.625 28.105000000000004 23.485 25-29 19.869999999999997 28.585 27.755000000000003 23.79 30-34 19.509999999999998 28.92 27.505000000000003 24.065 35-39 19.925 28.17 28.28 23.625 40-44 19.975 28.939999999999998 27.715 23.369999999999997 45-49 20.275000000000002 27.860000000000003 28.244999999999997 23.62 50-54 19.925 28.455000000000002 27.939999999999998 23.68 55-59 19.98 28.634999999999998 28.03 23.355 60-64 19.455 28.410000000000004 27.725 24.41 65-69 19.8 28.560000000000002 27.615000000000002 24.025 70-74 20.225 28.439999999999998 27.465 23.87 75-79 19.915 28.375 28.349999999999998 23.36 80-84 19.939999999999998 28.82 27.744999999999997 23.494999999999997 85-89 19.935 28.625 28.16 23.28 90-94 19.97 28.449999999999996 27.825 23.755000000000003 95-99 20.215 28.505000000000003 27.85 23.43 100-104 20.79 28.560000000000002 27.87 22.78 105-109 20.48 28.134999999999998 27.884999999999998 23.5 110-114 20.385 28.605000000000004 27.195000000000004 23.815 115-119 20.01 28.055000000000003 28.315 23.62 120-124 20.75 28.439999999999998 27.245 23.565 125-129 19.97 28.435 27.860000000000003 23.735 130-134 21.065 28.349999999999998 26.935 23.65 135-139 20.145 28.58 27.73 23.544999999999998 140-144 20.765 27.655 28.12 23.46 145-149 20.53 27.08 28.199999999999996 24.19 150-151 20.1 28.050000000000004 27.8875 23.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 0.5 16 0.0 17 0.5 18 2.5 19 2.0 20 0.0 21 0.5 22 2.0 23 1.5 24 1.5 25 3.5 26 6.5 27 7.0 28 6.5 29 13.0 30 21.0 31 24.0 32 32.5 33 43.5 34 51.0 35 70.0 36 91.5 37 116.0 38 140.0 39 158.0 40 175.5 41 218.5 42 248.0 43 254.5 44 293.5 45 301.0 46 274.5 47 254.0 48 213.5 49 185.0 50 159.5 51 133.5 52 124.5 53 96.0 54 64.0 55 50.0 56 40.5 57 28.0 58 24.0 59 23.5 60 13.0 61 5.0 62 5.5 63 5.0 64 3.5 65 1.5 66 1.0 67 1.0 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.875 #Duplication Level Percentage of deduplicated Percentage of total 1 91.3617606602476 83.025 2 7.482806052269601 13.600000000000001 3 0.9628610729023385 2.625 4 0.16506189821182946 0.6 5 0.0 0.0 6 0.027510316368638238 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCATTATCAACGGTCTTCACAAGATCTCCAAGCTCTTCAGTGCATTCAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.11249999999999999 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.2125 0.0 0.0 0.0 0.0 114-115 2.55 0.0 0.0 0.0 0.0 116-117 2.8625 0.0 0.0 0.0 0.0 118-119 3.125 0.0 0.0 0.0 0.0 120-121 3.35 0.0 0.0 0.0 0.0 122-123 3.5875000000000004 0.0 0.0 0.0 0.0 124-125 3.975 0.0 0.0 0.0 0.0 126-127 4.2 0.0 0.0 0.0 0.0 128-129 4.525 0.0 0.0 0.0 0.0 130-131 4.9625 0.0 0.0 0.0 0.0 132-133 5.3625 0.0 0.0 0.0 0.0 134-135 5.9125 0.0 0.0 0.0 0.0 136-137 6.425000000000001 0.0 0.0 0.0 0.0 138-139 6.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919326 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919326_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2795 37.0 37.0 37.0 37.0 37.0 2 36.269 37.0 37.0 37.0 37.0 37.0 3 36.3385 37.0 37.0 37.0 37.0 37.0 4 36.3145 37.0 37.0 37.0 37.0 37.0 5 36.386 37.0 37.0 37.0 37.0 37.0 6 36.323 37.0 37.0 37.0 37.0 37.0 7 36.257 37.0 37.0 37.0 37.0 37.0 8 36.3325 37.0 37.0 37.0 37.0 37.0 9 36.392 37.0 37.0 37.0 37.0 37.0 10-14 36.392700000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.3384 37.0 37.0 37.0 37.0 37.0 20-24 36.35209999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.2678 37.0 37.0 37.0 37.0 37.0 30-34 36.237399999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.2806 37.0 37.0 37.0 37.0 37.0 40-44 36.182100000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.193 37.0 37.0 37.0 37.0 37.0 50-54 36.1946 37.0 37.0 37.0 37.0 37.0 55-59 36.15559999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.1049 37.0 37.0 37.0 37.0 37.0 65-69 36.0972 37.0 37.0 37.0 37.0 37.0 70-74 36.045 37.0 37.0 37.0 37.0 37.0 75-79 36.0153 37.0 37.0 37.0 37.0 37.0 80-84 36.02310000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.972500000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.9174 37.0 37.0 37.0 37.0 37.0 95-99 35.9037 37.0 37.0 37.0 37.0 37.0 100-104 35.9005 37.0 37.0 37.0 37.0 37.0 105-109 35.8557 37.0 37.0 37.0 37.0 37.0 110-114 35.82619999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.7715 37.0 37.0 37.0 37.0 37.0 120-124 35.7386 37.0 37.0 37.0 37.0 37.0 125-129 35.6601 37.0 37.0 37.0 37.0 37.0 130-134 35.536100000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.3839 37.0 37.0 37.0 37.0 37.0 140-144 35.2967 37.0 37.0 37.0 34.6 37.0 145-149 35.1894 37.0 37.0 37.0 29.8 37.0 150-151 35.00425 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 0.0 15 1.0 16 3.0 17 2.0 18 0.0 19 1.0 20 1.0 21 2.0 22 1.0 23 4.0 24 14.0 25 6.0 26 4.0 27 11.0 28 22.0 29 17.0 30 24.0 31 33.0 32 49.0 33 112.0 34 176.0 35 467.0 36 2696.0 37 350.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.074999999999996 26.35 7.575 27.0 2 26.400000000000002 26.900000000000002 31.75 14.95 3 18.9 28.275 34.125 18.7 4 23.549999999999997 33.550000000000004 24.224999999999998 18.675 5 23.724999999999998 38.85 21.05 16.375 6 20.05 39.800000000000004 22.925 17.224999999999998 7 20.7 23.05 36.9 19.35 8 21.224999999999998 27.224999999999998 27.875 23.674999999999997 9 22.2 24.875 31.1 21.825 10-14 23.43 29.34 26.66 20.57 15-19 23.21 28.194999999999997 27.794999999999998 20.8 20-24 23.145 28.76 27.38 20.715 25-29 23.34 27.915 28.194999999999997 20.549999999999997 30-34 22.575 28.544999999999998 28.12 20.76 35-39 22.040000000000003 28.360000000000003 28.810000000000002 20.79 40-44 23.11 28.57 27.79 20.53 45-49 23.66 27.48 28.23 20.630000000000003 50-54 23.315 28.055000000000003 28.265 20.365 55-59 22.725 28.605000000000004 27.935 20.735 60-64 23.07 28.78 28.165000000000003 19.985 65-69 23.16 28.825 27.68 20.335 70-74 23.28 28.82 27.939999999999998 19.96 75-79 23.365 28.42 28.305000000000003 19.91 80-84 22.935 28.845 27.96 20.26 85-89 23.845 28.33 27.46 20.365 90-94 23.74 27.939999999999998 28.175 20.145 95-99 23.244999999999997 28.43 28.03 20.294999999999998 100-104 23.455000000000002 28.854999999999997 27.55 20.14 105-109 23.985 28.044999999999998 27.860000000000003 20.11 110-114 24.115000000000002 28.63 27.345000000000002 19.91 115-119 24.145 28.449999999999996 27.145000000000003 20.26 120-124 23.925 28.555000000000003 27.634999999999998 19.885 125-129 24.240000000000002 28.105000000000004 27.775 19.88 130-134 24.555 28.825 26.790000000000003 19.830000000000002 135-139 24.69 28.62 27.310000000000002 19.38 140-144 25.115 27.875 27.939999999999998 19.07 145-149 25.495 27.544999999999998 27.01 19.950000000000003 150-151 26.1125 26.937499999999996 27.85 19.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 1.5 16 1.5 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 2.0 25 4.0 26 7.5 27 7.5 28 8.0 29 14.0 30 21.0 31 28.5 32 33.0 33 40.0 34 52.0 35 77.0 36 87.0 37 103.0 38 139.5 39 170.5 40 215.0 41 252.0 42 268.0 43 286.0 44 285.0 45 261.5 46 270.5 47 268.0 48 226.5 49 183.5 50 152.0 51 128.0 52 97.5 53 72.0 54 54.0 55 42.0 56 31.5 57 22.0 58 20.5 59 16.5 60 10.0 61 7.0 62 6.5 63 4.5 64 2.5 65 1.5 66 1.0 67 1.5 68 0.5 69 0.0 70 0.5 71 0.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.07499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.57287949492176 83.39999999999999 2 7.301674444139445 13.3 3 0.9332967334614328 2.55 4 0.16469942355201758 0.6 5 0.0 0.0 6 0.02744990392533626 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTAGAGACTGCCAGCGCAATTTATAGAAATCGAATCAGTCCAGATCCTA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.7 0.0 0.0 0.0 0.0 110-111 1.95 0.0 0.0 0.0 0.0 112-113 2.2875 0.0 0.0 0.0 0.0 114-115 2.625 0.0 0.0 0.0 0.0 116-117 2.9375 0.0 0.0 0.0 0.0 118-119 3.2125 0.0 0.0 0.0 0.0 120-121 3.45 0.0 0.0 0.0 0.0 122-123 3.6875 0.0 0.0 0.0 0.0 124-125 4.05 0.0 0.0 0.0 0.0 126-127 4.275 0.0 0.0 0.0 0.0 128-129 4.625 0.0 0.0 0.0 0.0 130-131 5.075 0.0 0.0 0.0 0.0 132-133 5.4625 0.0 0.0 0.0 0.0 134-135 6.012499999999999 0.0 0.0 0.0 0.0 136-137 6.525 0.0 0.0 0.0 0.0 138-139 6.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTCTTC 10 0.006830828 145.0 145 >>END_MODULE Read 855359 spots for SRR12919326.sra Written 855359 spots for SRR12919326.sra Read 855359 spots for SRR12919326.sra Written 855359 spots for SRR12919326.sra Read 855359 spots for SRR12919326.sra Written 855359 spots for SRR12919326.sra Read 855359 spots for SRR12919326.sra Written 855359 spots for SRR12919326.sra Read 855359 spots for SRR12919326.sra Written 855359 spots for SRR12919326.sra Read 855359 spots for SRR12919326.sra Written 855359 spots for SRR12919326.sra Read 855359 spots for SRR12919326.sra Written 855359 spots for SRR12919326.sra Read 855359 spots for SRR12919326.sra Written 855359 spots for SRR12919326.sra Read 855359 spots for SRR12919326.sra Written 855359 spots for SRR12919326.sra Read 855359 spots for SRR12919326.sra Written 855359 spots for SRR12919326.sra Read 855359 spots for SRR12919326.sra Written 855359 spots for SRR12919326.sra Read 855359 spots for SRR12919326.sra Written 855359 spots for SRR12919326.sra Read 855359 spots for SRR12919326.sra Written 855359 spots for SRR12919326.sra Read 855359 spots for SRR12919326.sra Written 855359 spots for SRR12919326.sra Read 855359 spots for SRR12919326.sra Written 855359 spots for SRR12919326.sra Read 855359 spots for SRR12919326.sra Written 855359 spots for SRR12919326.sra Read 855359 spots for SRR12919326.sra Written 855359 spots for SRR12919326.sra Read 855372 spots for SRR12919326.sra Written 855372 spots for SRR12919326.sra Read 855359 spots for SRR12919326.sra Written 855359 spots for SRR12919326.sra Read 855359 spots for SRR12919326.sra Written 855359 spots for SRR12919326.sra SRR ids: ['SRR12919326.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k4jqfzk3 SRR12919326.sra spots: 17107193 blocks: [[1, 855359], [855360, 1710718], [1710719, 2566077], [2566078, 3421436], [3421437, 4276795], [4276796, 5132154], [5132155, 5987513], [5987514, 6842872], [6842873, 7698231], [7698232, 8553590], [8553591, 9408949], [9408950, 10264308], [10264309, 11119667], [11119668, 11975026], [11975027, 12830385], [12830386, 13685744], [13685745, 14541103], [14541104, 15396462], [15396463, 16251821], [16251822, 17107193]] SRR12919326 file size 5792072 SRR12919326 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919326 SRR12919326_1.fastq SRR12919326_2.fastq Input file: SRR12919326_1.fastq Paired file: SRR12919326_2.fastq trimmed: SRR12919326-trimmed-pair1.fastq, SRR12919326-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:14:50 2025 >> started Wed Feb 12 18:15:20 2025 >> done (30.012s) 17107193 read pairs processed; of these: 25 ( 0.00%) short read pairs filtered out after trimming by size control 418 ( 0.00%) empty read pairs filtered out after trimming by size control 17106750 (100.00%) read pairs available; of these: 1620731 ( 9.47%) trimmed read pairs available after processing 15486019 (90.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 5 0.00% 23 2 0.00% 24 5 0.00% 25 7 0.00% 26 9 0.00% 27 8 0.00% 28 4 0.00% 29 10 0.00% 30 15 0.00% 31 13 0.00% 32 10 0.00% 33 11 0.00% 34 7 0.00% 35 7 0.00% 36 9 0.00% 37 16 0.00% 38 15 0.00% 39 16 0.00% 40 14 0.00% 41 18 0.00% 42 25 0.00% 43 24 0.00% 44 17 0.00% 45 25 0.00% 46 20 0.00% 47 35 0.00% 48 31 0.00% 49 48 0.00% 50 56 0.00% 51 57 0.00% 52 54 0.00% 53 44 0.00% 54 62 0.00% 55 56 0.00% 56 70 0.00% 57 87 0.00% 58 100 0.00% 59 121 0.00% 60 142 0.00% 61 175 0.00% 62 196 0.00% 63 201 0.00% 64 237 0.00% 65 246 0.00% 66 270 0.00% 67 295 0.00% 68 357 0.00% 69 441 0.00% 70 487 0.00% 71 548 0.00% 72 648 0.00% 73 748 0.00% 74 884 0.01% 75 969 0.01% 76 1067 0.01% 77 1102 0.01% 78 1245 0.01% 79 1423 0.01% 80 1701 0.01% 81 1944 0.01% 82 2175 0.01% 83 2577 0.02% 84 2848 0.02% 85 3181 0.02% 86 3336 0.02% 87 3728 0.02% 88 3862 0.02% 89 4338 0.03% 90 4670 0.03% 91 5306 0.03% 92 5779 0.03% 93 6658 0.04% 94 7126 0.04% 95 7741 0.05% 96 8252 0.05% 97 8850 0.05% 98 9120 0.05% 99 9659 0.06% 100 10204 0.06% 101 10838 0.06% 102 11854 0.07% 103 12896 0.08% 104 13806 0.08% 105 14403 0.08% 106 15277 0.09% 107 15713 0.09% 108 16109 0.09% 109 16923 0.10% 110 16984 0.10% 111 18067 0.11% 112 19310 0.11% 113 19869 0.12% 114 20982 0.12% 115 22259 0.13% 116 22604 0.13% 117 23558 0.14% 118 24424 0.14% 119 24442 0.14% 120 25156 0.15% 121 25878 0.15% 122 26692 0.16% 123 27652 0.16% 124 29015 0.17% 125 29879 0.17% 126 31039 0.18% 127 31885 0.19% 128 32192 0.19% 129 32502 0.19% 130 32791 0.19% 131 33899 0.20% 132 34512 0.20% 133 35794 0.21% 134 36377 0.21% 135 38149 0.22% 136 38636 0.23% 137 39263 0.23% 138 40277 0.24% 139 40600 0.24% 140 40394 0.24% 141 41232 0.24% 142 42101 0.25% 143 43154 0.25% 144 44188 0.26% 145 45720 0.27% 146 45714 0.27% 147 46326 0.27% 148 47782 0.28% 149 47382 0.28% 150 48356 0.28% 151 15486019 90.53% 17106750 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=5.83 fanout-score-rank=29 prefix-density=0.22 prefix-fanout=3.4 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=9 fanout-score=401.10 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=34.2 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=31 prefix-density=0.13 prefix-fanout=2.0 sequence=CCAGACCAGCAGAGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=428.89 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=33.0 sequence=AAGAAGAAGAAG SRR12919326 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:16:18 Started mapping on | Feb 12 18:16:18 Finished on | Feb 12 18:19:29 Mapping speed, Million of reads per hour | 322.43 Number of input reads | 17106750 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15815573 Uniquely mapped reads % | 92.45% Average mapped length | 296.15 Number of splices: Total | 15168517 Number of splices: Annotated (sjdb) | 14829974 Number of splices: GT/AG | 14889743 Number of splices: GC/AG | 218398 Number of splices: AT/AC | 14061 Number of splices: Non-canonical | 46315 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.94 Insertion rate per base | 0.03% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 427572 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 50093 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.60% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 863605 863605 863605 N_multimapping 427572 427572 427572 N_noFeature 566941 15632867 652205 N_ambiguous 192910 877 94993 UnstrandedReadsAssigned:15055722 PositiveStrandReadsAssigned:181829 NegativeStrandReadsAssigned:15068375 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919326 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919326-trimmed-pair1.fastq SRR12919326-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,106,750 reads, 15,113,192 reads pseudoaligned [quant] estimated average fragment length: 262.887 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52401 SRR12919326.ke.tsv 34699 SRR12919326.se.tsv 87100 total ==> SRR12919326.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1756.11 535 22.5551 Potri.005G024800.1.v4.1 1035 773.113 199 19.0569 Potri.004G059700.1.v4.1 961 699.326 38 4.02297 Potri.007G009000.2.v4.1 1416 1154.11 0 0 Potri.003G141000.2.v4.1 2943 2681.11 692.555 19.1242 Potri.016G087400.1.v4.1 270 82.076 924.821 834.227 Potri.015G069301.1.v4.1 564 316.817 0 0 Potri.010G195200.1.v4.1 1773 1511.11 105 5.14441 Potri.012G127500.1.v4.1 977 715.243 7371 762.985 ==> SRR12919326.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 224 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 231 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 9 Potri.001G452600.v4.1 28 SRR12919326 completed mapping pipeline successfully