Starting /dee2/code/volunteer_pipeline.sh SRR12919327 current disk space = 3051401506816 free memory = 990567684 SRR12919327 SRAfilesize 1c5070fd3e3f36259465576ee2d1d319 SRR12919327.sra SRR12919327.sra file validated SRR12919327 is paired end SRR12919327 is conventional basespace SRR12919327 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919327_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6775 37.0 37.0 37.0 37.0 37.0 2 36.23225 37.0 37.0 37.0 37.0 37.0 3 36.586 37.0 37.0 37.0 37.0 37.0 4 36.6995 37.0 37.0 37.0 37.0 37.0 5 36.62 37.0 37.0 37.0 37.0 37.0 6 36.7165 37.0 37.0 37.0 37.0 37.0 7 36.6535 37.0 37.0 37.0 37.0 37.0 8 36.7265 37.0 37.0 37.0 37.0 37.0 9 36.6945 37.0 37.0 37.0 37.0 37.0 10-14 36.69070000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.623900000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.6346 37.0 37.0 37.0 37.0 37.0 25-29 36.5285 37.0 37.0 37.0 37.0 37.0 30-34 36.5498 37.0 37.0 37.0 37.0 37.0 35-39 36.5358 37.0 37.0 37.0 37.0 37.0 40-44 36.531099999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.522000000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.5207 37.0 37.0 37.0 37.0 37.0 55-59 36.4869 37.0 37.0 37.0 37.0 37.0 60-64 36.4206 37.0 37.0 37.0 37.0 37.0 65-69 36.3895 37.0 37.0 37.0 37.0 37.0 70-74 36.4119 37.0 37.0 37.0 37.0 37.0 75-79 36.3892 37.0 37.0 37.0 37.0 37.0 80-84 36.404999999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.2995 37.0 37.0 37.0 37.0 37.0 90-94 36.2435 37.0 37.0 37.0 37.0 37.0 95-99 36.2688 37.0 37.0 37.0 37.0 37.0 100-104 36.2427 37.0 37.0 37.0 37.0 37.0 105-109 36.1988 37.0 37.0 37.0 37.0 37.0 110-114 36.143499999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.142 37.0 37.0 37.0 37.0 37.0 120-124 36.1368 37.0 37.0 37.0 37.0 37.0 125-129 36.0194 37.0 37.0 37.0 37.0 37.0 130-134 35.9859 37.0 37.0 37.0 37.0 37.0 135-139 35.8547 37.0 37.0 37.0 37.0 37.0 140-144 35.6965 37.0 37.0 37.0 37.0 37.0 145-149 35.603300000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.303250000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 2.0 26 3.0 27 8.0 28 8.0 29 16.0 30 23.0 31 33.0 32 45.0 33 62.0 34 107.0 35 320.0 36 2958.0 37 414.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.75 13.55 4.8500000000000005 40.849999999999994 2 18.635104507680687 13.397129186602871 37.32057416267943 30.647192143037017 3 16.75 17.0 29.099999999999998 37.15 4 20.325 23.974999999999998 26.0 29.7 5 22.375 29.849999999999998 25.324999999999996 22.45 6 20.175 33.625 25.05 21.15 7 15.275 27.125 39.925 17.675 8 17.424999999999997 25.775 32.9 23.9 9 16.775000000000002 23.35 36.475 23.400000000000002 10-14 19.3 29.69 27.73 23.28 15-19 19.71 28.084999999999997 28.005000000000003 24.2 20-24 19.400000000000002 29.110000000000003 28.13 23.36 25-29 19.67 28.754999999999995 28.035 23.54 30-34 19.314999999999998 29.29 27.555000000000003 23.84 35-39 19.265 28.62 28.075 24.04 40-44 19.475 29.04 27.85 23.635 45-49 19.6 28.73 27.77 23.9 50-54 19.625 29.404999999999998 27.025 23.945 55-59 20.23 28.325 27.88 23.565 60-64 19.650000000000002 28.025 28.535 23.79 65-69 20.225 28.994999999999997 27.450000000000003 23.330000000000002 70-74 20.080000000000002 28.065 27.765 24.09 75-79 19.785 29.01 27.755000000000003 23.45 80-84 20.035 28.439999999999998 27.860000000000003 23.665 85-89 20.03 28.32 27.575 24.075 90-94 20.53 29.39 26.655 23.425 95-99 20.365 28.53 27.33 23.775 100-104 20.225 28.655 27.515 23.605 105-109 20.4 28.87 26.695 24.035 110-114 19.985 28.505000000000003 27.875 23.635 115-119 21.18 28.285 27.224999999999998 23.31 120-124 20.150000000000002 27.939999999999998 27.55 24.36 125-129 20.86 28.46 26.435 24.245 130-134 20.71 28.1 26.72 24.47 135-139 20.630000000000003 28.185 26.740000000000002 24.445 140-144 20.365 28.77 27.02 23.845 145-149 21.07 27.705000000000002 26.945000000000004 24.279999999999998 150-151 21.3 27.9125 26.1625 24.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 2.5 25 2.5 26 1.5 27 8.0 28 12.0 29 13.0 30 17.0 31 26.0 32 38.0 33 47.0 34 50.5 35 64.0 36 91.5 37 120.5 38 149.5 39 177.5 40 195.5 41 195.5 42 225.0 43 262.5 44 286.0 45 290.5 46 268.5 47 249.0 48 212.5 49 186.5 50 178.0 51 148.0 52 115.0 53 101.0 54 77.0 55 47.0 56 36.5 57 28.5 58 19.0 59 11.5 60 7.5 61 6.5 62 9.0 63 8.0 64 2.5 65 2.5 66 2.5 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.7250000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.7 #Duplication Level Percentage of deduplicated Percentage of total 1 90.73869900771776 82.3 2 8.517089305402425 15.45 3 0.5512679162072767 1.5 4 0.16538037486218302 0.6 5 0.0 0.0 6 0.027563395810363836 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGTGTTGTAGTTATTTGCTCGTATACGAGGCAAAACATTATCAGCAAAT 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.725 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.5 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 2.0625 0.0 0.0 0.0 0.0 104-105 2.375 0.0 0.0 0.0 0.0 106-107 2.6125 0.0 0.0 0.0 0.0 108-109 3.05 0.0 0.0 0.0 0.0 110-111 3.4625 0.0 0.0 0.0 0.0 112-113 3.8499999999999996 0.0 0.0 0.0 0.0 114-115 4.3375 0.0 0.0 0.0 0.0 116-117 4.862500000000001 0.0 0.0 0.0 0.0 118-119 5.3125 0.0 0.0 0.0 0.0 120-121 5.5875 0.0 0.0 0.0 0.0 122-123 6.1 0.0 0.0 0.0 0.0 124-125 6.55 0.0 0.0 0.0 0.0 126-127 7.0875 0.0 0.0 0.0 0.0 128-129 7.7125 0.0 0.0 0.0 0.0 130-131 8.3625 0.0 0.0 0.0 0.0 132-133 8.8125 0.0 0.0 0.0 0.0 134-135 9.462499999999999 0.0 0.0 0.0 0.0 136-137 9.9875 0.0 0.0 0.0 0.0 138-139 10.662500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTGAGC 10 0.006830828 145.0 6 ATCTCCG 10 0.006830828 145.0 145 TAAGCAC 10 0.006830828 145.0 9 >>END_MODULE SRR12919327 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919327_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3615 37.0 37.0 37.0 37.0 37.0 2 36.227 37.0 37.0 37.0 37.0 37.0 3 36.204 37.0 37.0 37.0 37.0 37.0 4 36.357 37.0 37.0 37.0 37.0 37.0 5 36.3355 37.0 37.0 37.0 37.0 37.0 6 36.277 37.0 37.0 37.0 37.0 37.0 7 36.2465 37.0 37.0 37.0 37.0 37.0 8 36.3655 37.0 37.0 37.0 37.0 37.0 9 36.472 37.0 37.0 37.0 37.0 37.0 10-14 36.37060000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.405899999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.31759999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.2484 37.0 37.0 37.0 37.0 37.0 30-34 36.237199999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.1757 37.0 37.0 37.0 37.0 37.0 40-44 36.1668 37.0 37.0 37.0 37.0 37.0 45-49 36.150999999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.153 37.0 37.0 37.0 37.0 37.0 55-59 36.1086 37.0 37.0 37.0 37.0 37.0 60-64 36.09910000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.0999 37.0 37.0 37.0 37.0 37.0 70-74 35.985699999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.995799999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.9994 37.0 37.0 37.0 37.0 37.0 85-89 35.9483 37.0 37.0 37.0 37.0 37.0 90-94 35.8877 37.0 37.0 37.0 37.0 37.0 95-99 35.9413 37.0 37.0 37.0 37.0 37.0 100-104 35.8099 37.0 37.0 37.0 37.0 37.0 105-109 35.8193 37.0 37.0 37.0 37.0 37.0 110-114 35.770300000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.711499999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.7213 37.0 37.0 37.0 37.0 37.0 125-129 35.5875 37.0 37.0 37.0 37.0 37.0 130-134 35.4798 37.0 37.0 37.0 37.0 37.0 135-139 35.3337 37.0 37.0 37.0 34.6 37.0 140-144 35.2408 37.0 37.0 37.0 29.8 37.0 145-149 34.9568 37.0 37.0 37.0 27.4 37.0 150-151 34.864000000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 2.0 15 2.0 16 1.0 17 2.0 18 1.0 19 0.0 20 0.0 21 3.0 22 2.0 23 4.0 24 6.0 25 7.0 26 5.0 27 9.0 28 10.0 29 17.0 30 24.0 31 30.0 32 66.0 33 109.0 34 224.0 35 547.0 36 2651.0 37 273.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.25 26.025 8.825 25.900000000000002 2 27.450000000000003 26.55 31.225 14.774999999999999 3 20.625 28.125 33.074999999999996 18.175 4 23.3 33.7 24.025 18.975 5 23.9 37.425000000000004 22.25 16.425 6 21.725 38.4 23.7 16.175 7 20.849999999999998 21.775 38.4 18.975 8 22.475 25.55 28.975 23.0 9 22.85 24.725 30.975 21.45 10-14 23.205000000000002 29.160000000000004 26.724999999999998 20.91 15-19 23.075000000000003 27.51 28.01 21.404999999999998 20-24 23.365 28.095 27.750000000000004 20.79 25-29 22.745 28.58 28.09 20.585 30-34 23.085 27.815 28.42 20.68 35-39 22.919999999999998 28.43 27.675 20.974999999999998 40-44 23.45 28.000000000000004 27.845 20.705000000000002 45-49 23.345 27.975 27.955000000000002 20.724999999999998 50-54 23.669999999999998 28.544999999999998 27.634999999999998 20.150000000000002 55-59 23.29 27.76 28.22 20.73 60-64 23.380000000000003 27.865000000000002 28.050000000000004 20.705000000000002 65-69 22.905 28.37 27.935 20.79 70-74 23.805 28.07 27.73 20.395 75-79 23.380000000000003 27.46 28.384999999999998 20.775 80-84 22.79 27.975 28.375 20.86 85-89 23.785 27.675 28.42 20.119999999999997 90-94 23.47 28.044999999999998 28.29 20.195 95-99 23.799999999999997 28.139999999999997 28.18 19.88 100-104 23.86 27.48 28.134999999999998 20.525 105-109 23.59 27.865000000000002 28.205000000000002 20.34 110-114 23.745 28.075 27.91 20.27 115-119 24.81 27.725 27.595 19.869999999999997 120-124 25.44 28.17 27.04 19.35 125-129 24.955 27.88 27.26 19.905 130-134 24.98 27.900000000000002 27.115000000000002 20.005 135-139 25.685000000000002 27.400000000000002 27.185 19.73 140-144 25.96 27.595 26.950000000000003 19.495 145-149 26.52 27.68 26.805 18.995 150-151 27.700000000000003 27.9125 25.974999999999998 18.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 2.0 24 2.5 25 3.0 26 3.5 27 5.0 28 5.5 29 7.0 30 14.5 31 24.0 32 32.0 33 48.5 34 56.5 35 70.0 36 93.0 37 109.5 38 146.0 39 167.0 40 194.5 41 232.5 42 256.5 43 271.5 44 282.5 45 292.5 46 284.5 47 263.5 48 221.0 49 185.5 50 157.0 51 120.5 52 97.5 53 82.0 54 64.0 55 46.5 56 34.5 57 30.0 58 24.0 59 16.5 60 10.5 61 7.5 62 7.5 63 4.5 64 2.5 65 2.5 66 1.5 67 1.5 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 1.0 90 0.5 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.05 #Duplication Level Percentage of deduplicated Percentage of total 1 91.21361889071939 83.05 2 8.072487644151565 14.7 3 0.4667764964305327 1.275 4 0.19220208676551345 0.7000000000000001 5 0.027457440966501923 0.125 6 0.027457440966501923 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATATAGAATGAAAAGATATGTAGATCAGAAAAAGCTCATTGAAAGATA 6 0.15 No Hit AGCAGTTGCATTTATCTAAAGTATTCTCACTTTACTTAACACTTGAGCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.725 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.5 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 2.0625 0.0 0.0 0.0 0.0 104-105 2.375 0.0 0.0 0.0 0.0 106-107 2.6125 0.0 0.0 0.0 0.0 108-109 3.05 0.0 0.0 0.0 0.0 110-111 3.4875 0.0 0.0 0.0 0.0 112-113 3.875 0.0 0.0 0.0 0.0 114-115 4.387499999999999 0.0 0.0 0.0 0.0 116-117 4.9125 0.0 0.0 0.0 0.0 118-119 5.375 0.0 0.0 0.0 0.0 120-121 5.6875 0.0 0.0 0.0 0.0 122-123 6.2 0.0 0.0 0.0 0.0 124-125 6.65 0.0 0.0 0.0 0.0 126-127 7.2125 0.0 0.0 0.0 0.0 128-129 7.8374999999999995 0.0 0.0 0.0 0.0 130-131 8.5125 0.0 0.0 0.0 0.0 132-133 8.975 0.0 0.0 0.0 0.0 134-135 9.6375 0.0 0.0 0.0 0.0 136-137 10.1625 0.0 0.0 0.0 0.0 138-139 10.837499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 989000 spots for SRR12919327.sra Written 989000 spots for SRR12919327.sra Read 989000 spots for SRR12919327.sra Written 989000 spots for SRR12919327.sra Read 989000 spots for SRR12919327.sra Written 989000 spots for SRR12919327.sra Read 989000 spots for SRR12919327.sra Written 989000 spots for SRR12919327.sra Read 989000 spots for SRR12919327.sra Written 989000 spots for SRR12919327.sra Read 989000 spots for SRR12919327.sra Written 989000 spots for SRR12919327.sra Read 989000 spots for SRR12919327.sra Written 989000 spots for SRR12919327.sra Read 989000 spots for SRR12919327.sra Written 989000 spots for SRR12919327.sra Read 989000 spots for SRR12919327.sra Written 989000 spots for SRR12919327.sra Read 989000 spots for SRR12919327.sra Written 989000 spots for SRR12919327.sra Read 989012 spots for SRR12919327.sra Written 989012 spots for SRR12919327.sra Read 989000 spots for SRR12919327.sra Written 989000 spots for SRR12919327.sra Read 989000 spots for SRR12919327.sra Written 989000 spots for SRR12919327.sra Read 989000 spots for SRR12919327.sra Written 989000 spots for SRR12919327.sra Read 989000 spots for SRR12919327.sra Written 989000 spots for SRR12919327.sra Read 989000 spots for SRR12919327.sra Written 989000 spots for SRR12919327.sra Read 989000 spots for SRR12919327.sra Written 989000 spots for SRR12919327.sra Read 989000 spots for SRR12919327.sra Written 989000 spots for SRR12919327.sra Read 989000 spots for SRR12919327.sra Written 989000 spots for SRR12919327.sra Read 989000 spots for SRR12919327.sra Written 989000 spots for SRR12919327.sra SRR ids: ['SRR12919327.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y8rd6iye SRR12919327.sra spots: 19780012 blocks: [[1, 989000], [989001, 1978000], [1978001, 2967000], [2967001, 3956000], [3956001, 4945000], [4945001, 5934000], [5934001, 6923000], [6923001, 7912000], [7912001, 8901000], [8901001, 9890000], [9890001, 10879000], [10879001, 11868000], [11868001, 12857000], [12857001, 13846000], [13846001, 14835000], [14835001, 15824000], [15824001, 16813000], [16813001, 17802000], [17802001, 18791000], [18791001, 19780012]] SRR12919327 file size 6700413 SRR12919327 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919327 SRR12919327_1.fastq SRR12919327_2.fastq Input file: SRR12919327_1.fastq Paired file: SRR12919327_2.fastq trimmed: SRR12919327-trimmed-pair1.fastq, SRR12919327-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:20:04 2025 >> started Wed Feb 12 18:20:30 2025 >> done (25.636s) 19780012 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 270 ( 0.00%) empty read pairs filtered out after trimming by size control 19779721 (100.00%) read pairs available; of these: 3163719 (15.99%) trimmed read pairs available after processing 16616002 (84.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 4 0.00% 21 1 0.00% 22 4 0.00% 23 5 0.00% 24 1 0.00% 25 7 0.00% 26 7 0.00% 27 8 0.00% 28 10 0.00% 29 5 0.00% 30 7 0.00% 31 15 0.00% 32 11 0.00% 33 18 0.00% 34 16 0.00% 35 17 0.00% 36 17 0.00% 37 14 0.00% 38 12 0.00% 39 31 0.00% 40 17 0.00% 41 23 0.00% 42 23 0.00% 43 31 0.00% 44 24 0.00% 45 28 0.00% 46 24 0.00% 47 32 0.00% 48 50 0.00% 49 53 0.00% 50 57 0.00% 51 86 0.00% 52 86 0.00% 53 92 0.00% 54 99 0.00% 55 103 0.00% 56 125 0.00% 57 130 0.00% 58 163 0.00% 59 205 0.00% 60 283 0.00% 61 277 0.00% 62 364 0.00% 63 379 0.00% 64 409 0.00% 65 525 0.00% 66 547 0.00% 67 635 0.00% 68 732 0.00% 69 822 0.00% 70 1087 0.01% 71 1105 0.01% 72 1468 0.01% 73 1783 0.01% 74 1978 0.01% 75 2175 0.01% 76 2487 0.01% 77 2548 0.01% 78 2908 0.01% 79 3448 0.02% 80 3938 0.02% 81 4396 0.02% 82 5427 0.03% 83 5988 0.03% 84 6697 0.03% 85 7613 0.04% 86 8227 0.04% 87 8802 0.04% 88 9516 0.05% 89 10344 0.05% 90 11348 0.06% 91 12801 0.06% 92 14206 0.07% 93 15435 0.08% 94 17100 0.09% 95 18491 0.09% 96 19428 0.10% 97 20815 0.11% 98 21411 0.11% 99 22658 0.11% 100 24223 0.12% 101 25445 0.13% 102 27254 0.14% 103 29645 0.15% 104 31288 0.16% 105 32873 0.17% 106 34970 0.18% 107 36275 0.18% 108 36565 0.18% 109 38247 0.19% 110 38728 0.20% 111 39879 0.20% 112 42337 0.21% 113 43487 0.22% 114 45485 0.23% 115 47863 0.24% 116 49115 0.25% 117 50245 0.25% 118 51683 0.26% 119 51881 0.26% 120 52289 0.26% 121 53722 0.27% 122 54727 0.28% 123 56044 0.28% 124 58756 0.30% 125 60059 0.30% 126 61270 0.31% 127 62826 0.32% 128 63414 0.32% 129 63816 0.32% 130 64540 0.33% 131 64922 0.33% 132 65454 0.33% 133 67298 0.34% 134 68145 0.34% 135 70003 0.35% 136 70768 0.36% 137 71949 0.36% 138 72496 0.37% 139 72157 0.36% 140 72567 0.37% 141 73204 0.37% 142 74656 0.38% 143 74586 0.38% 144 76105 0.38% 145 76800 0.39% 146 77279 0.39% 147 77877 0.39% 148 78623 0.40% 149 78567 0.40% 150 79046 0.40% 151 16616002 84.01% 19779721 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=38 prefix-density=0.29 prefix-fanout=2.0 sequence=TACAGTCCCCAACAAGTTCTCTCCATTCTCTGGATAATTGAAATCTCCAAATACCAGTTTACCTTTCTCCGATCCGAATTTCTTCCAGTTCCAAACTCCTGTGAAGGCAACAGCCTGCGGCACAGAAACATCACCTGGAACCATTGTTTTCTTATCCAAGCTTCCAGCATTCCCAAAATAGATGACTCCGTGAATGCTGAATCTAACTAGAAGGATTTGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=157.72 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=18.9 sequence=TCCTTCTTCACAAT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=40 prefix-density=0.37 prefix-fanout=1.1 sequence=TGGGGACTGTACAGTATGAGAAAATTAACATGTTCTCTCCAAGTGAAGCGCCCAAGGAAGTTTTCTGGCTTCCCATCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=640.24 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=11.8 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAACTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACA SRR12919327 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:21:21 Started mapping on | Feb 12 18:21:21 Finished on | Feb 12 18:24:08 Mapping speed, Million of reads per hour | 426.39 Number of input reads | 19779721 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 18400498 Uniquely mapped reads % | 93.03% Average mapped length | 292.77 Number of splices: Total | 16809662 Number of splices: Annotated (sjdb) | 16413694 Number of splices: GT/AG | 16501959 Number of splices: GC/AG | 238533 Number of splices: AT/AC | 15678 Number of splices: Non-canonical | 53492 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 515158 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 76874 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.86% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 864065 864065 864065 N_multimapping 515158 515158 515158 N_noFeature 697484 18183322 801297 N_ambiguous 235357 949 121543 UnstrandedReadsAssigned:17467657 PositiveStrandReadsAssigned:216227 NegativeStrandReadsAssigned:17477658 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919327 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919327-trimmed-pair1.fastq SRR12919327-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,779,721 reads, 17,550,161 reads pseudoaligned [quant] estimated average fragment length: 241.665 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52401 SRR12919327.ke.tsv 34699 SRR12919327.se.tsv 87100 total ==> SRR12919327.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.33 674 23.9708 Potri.005G024800.1.v4.1 1035 794.335 269 21.4063 Potri.004G059700.1.v4.1 961 720.447 32 2.80763 Potri.007G009000.2.v4.1 1416 1175.33 0 0 Potri.003G141000.2.v4.1 2943 2702.33 623.81 14.5917 Potri.016G087400.1.v4.1 270 93.2674 1229 832.94 Potri.015G069301.1.v4.1 564 336.122 0 0 Potri.010G195200.1.v4.1 1773 1532.33 154 6.35271 Potri.012G127500.1.v4.1 977 736.4 4507 386.871 ==> SRR12919327.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 180 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 219 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 37 SRR12919327 completed mapping pipeline successfully