Starting /dee2/code/volunteer_pipeline.sh SRR12919328 current disk space = 3051270631424 free memory = 1495524880 SRR12919328 SRAfilesize dd0e09bc42212e5c622e582c233bd4c7 SRR12919328.sra SRR12919328.sra file validated SRR12919328 is paired end SRR12919328 is conventional basespace SRR12919328 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919328_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5755 37.0 37.0 37.0 37.0 37.0 2 36.31 37.0 37.0 37.0 37.0 37.0 3 36.6095 37.0 37.0 37.0 37.0 37.0 4 36.6035 37.0 37.0 37.0 37.0 37.0 5 36.6495 37.0 37.0 37.0 37.0 37.0 6 36.625 37.0 37.0 37.0 37.0 37.0 7 36.539 37.0 37.0 37.0 37.0 37.0 8 36.6525 37.0 37.0 37.0 37.0 37.0 9 36.69 37.0 37.0 37.0 37.0 37.0 10-14 36.635000000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.604 37.0 37.0 37.0 37.0 37.0 20-24 36.59589999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.544599999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.5407 37.0 37.0 37.0 37.0 37.0 35-39 36.51989999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.4914 37.0 37.0 37.0 37.0 37.0 45-49 36.476099999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.4713 37.0 37.0 37.0 37.0 37.0 55-59 36.4439 37.0 37.0 37.0 37.0 37.0 60-64 36.425200000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.4137 37.0 37.0 37.0 37.0 37.0 70-74 36.3888 37.0 37.0 37.0 37.0 37.0 75-79 36.351099999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.342600000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.248 37.0 37.0 37.0 37.0 37.0 90-94 36.2198 37.0 37.0 37.0 37.0 37.0 95-99 36.267399999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.221 37.0 37.0 37.0 37.0 37.0 105-109 36.199 37.0 37.0 37.0 37.0 37.0 110-114 36.1009 37.0 37.0 37.0 37.0 37.0 115-119 36.0335 37.0 37.0 37.0 37.0 37.0 120-124 36.0727 37.0 37.0 37.0 37.0 37.0 125-129 35.9593 37.0 37.0 37.0 37.0 37.0 130-134 35.9173 37.0 37.0 37.0 37.0 37.0 135-139 35.816700000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.729 37.0 37.0 37.0 37.0 37.0 145-149 35.6892 37.0 37.0 37.0 37.0 37.0 150-151 35.40425 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 0.0 25 4.0 26 4.0 27 5.0 28 13.0 29 13.0 30 21.0 31 38.0 32 40.0 33 85.0 34 129.0 35 284.0 36 2963.0 37 399.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.6 11.200000000000001 5.925 41.275 2 19.487694625816175 12.481165243596184 36.087393269713715 31.943746860873933 3 17.150000000000002 16.650000000000002 27.650000000000002 38.550000000000004 4 21.45 24.65 25.3 28.599999999999998 5 23.3 30.5 24.675 21.525 6 20.724999999999998 34.699999999999996 23.7 20.875 7 14.625 28.95 39.825 16.6 8 18.25 25.25 32.425 24.075 9 17.75 24.224999999999998 34.949999999999996 23.075000000000003 10-14 19.040000000000003 29.575000000000003 28.7 22.685 15-19 19.355 27.894999999999996 28.194999999999997 24.555 20-24 19.31 29.299999999999997 27.21 24.18 25-29 20.28 28.26 27.900000000000002 23.56 30-34 20.07 28.849999999999998 27.615000000000002 23.465 35-39 20.45 27.98 28.055000000000003 23.515 40-44 19.875 29.020000000000003 27.955000000000002 23.150000000000002 45-49 19.82 28.53 27.675 23.974999999999998 50-54 19.634999999999998 29.365000000000002 27.765 23.235 55-59 19.725 28.754999999999995 27.345000000000002 24.175 60-64 20.28 28.49 27.500000000000004 23.73 65-69 20.085 28.52 27.794999999999998 23.599999999999998 70-74 20.0 28.449999999999996 27.700000000000003 23.849999999999998 75-79 20.810000000000002 28.000000000000004 27.450000000000003 23.74 80-84 19.975 28.525 27.88 23.62 85-89 19.605 28.67 27.485 24.240000000000002 90-94 20.455000000000002 28.49 27.860000000000003 23.195 95-99 20.45 28.685 27.534999999999997 23.330000000000002 100-104 20.419999999999998 27.98 27.894999999999996 23.705000000000002 105-109 20.599999999999998 28.095 27.700000000000003 23.605 110-114 20.175 28.525 27.515 23.785 115-119 20.165 28.494999999999997 27.744999999999997 23.595 120-124 20.415 28.95 26.97 23.665 125-129 20.75 28.410000000000004 27.325 23.515 130-134 21.16 28.585 26.895000000000003 23.36 135-139 20.965 28.48 26.215 24.34 140-144 21.145 28.599999999999998 26.215 24.04 145-149 20.855 28.71 26.179999999999996 24.255 150-151 21.2375 29.012500000000003 26.087500000000002 23.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 1.0 23 1.0 24 3.0 25 5.5 26 4.5 27 5.5 28 6.5 29 12.5 30 15.0 31 27.0 32 35.0 33 34.0 34 46.5 35 64.0 36 90.0 37 114.5 38 127.5 39 157.5 40 183.5 41 217.0 42 265.0 43 268.0 44 260.5 45 288.0 46 287.0 47 248.0 48 218.0 49 205.0 50 174.0 51 135.5 52 116.0 53 99.5 54 82.5 55 55.0 56 36.5 57 28.0 58 21.5 59 15.5 60 12.5 61 8.0 62 5.5 63 3.5 64 1.5 65 1.0 66 1.5 67 2.0 68 1.5 69 1.0 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.975 #Duplication Level Percentage of deduplicated Percentage of total 1 90.87661445452048 82.675 2 8.408903544929926 15.299999999999999 3 0.6320417697169552 1.725 4 0.08244023083264633 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.5125 0.0 0.0 0.0 0.0 106-107 1.7875 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.425 0.0 0.0 0.0 0.0 112-113 2.8125 0.0 0.0 0.0 0.0 114-115 3.0625 0.0 0.0 0.0 0.0 116-117 3.375 0.0 0.0 0.0 0.0 118-119 3.6125 0.0 0.0 0.0 0.0 120-121 3.9875000000000003 0.0 0.0 0.0 0.0 122-123 4.375 0.0 0.0 0.0 0.0 124-125 4.925000000000001 0.0 0.0 0.0 0.0 126-127 5.6125 0.0 0.0 0.0 0.0 128-129 6.0625 0.0 0.0 0.0 0.0 130-131 6.6375 0.0 0.0 0.0 0.0 132-133 7.325 0.0 0.0 0.0 0.0 134-135 7.975 0.0 0.0 0.0 0.0 136-137 8.4125 0.0 0.0 0.0 0.0 138-139 8.837499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGCAT 10 0.006830828 145.0 6 >>END_MODULE SRR12919328 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919328_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.263 37.0 37.0 37.0 37.0 37.0 2 36.022 37.0 37.0 37.0 37.0 37.0 3 36.1175 37.0 37.0 37.0 37.0 37.0 4 36.277 37.0 37.0 37.0 37.0 37.0 5 36.312 37.0 37.0 37.0 37.0 37.0 6 36.1175 37.0 37.0 37.0 37.0 37.0 7 36.239 37.0 37.0 37.0 37.0 37.0 8 36.2775 37.0 37.0 37.0 37.0 37.0 9 36.373 37.0 37.0 37.0 37.0 37.0 10-14 36.359300000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.2743 37.0 37.0 37.0 37.0 37.0 20-24 36.244099999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.198800000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.177899999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.1808 37.0 37.0 37.0 37.0 37.0 40-44 36.115 37.0 37.0 37.0 37.0 37.0 45-49 36.084700000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.0775 37.0 37.0 37.0 37.0 37.0 55-59 36.0771 37.0 37.0 37.0 37.0 37.0 60-64 36.0676 37.0 37.0 37.0 37.0 37.0 65-69 36.0802 37.0 37.0 37.0 37.0 37.0 70-74 35.984700000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.9268 37.0 37.0 37.0 37.0 37.0 80-84 35.94199999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.8572 37.0 37.0 37.0 37.0 37.0 90-94 35.8173 37.0 37.0 37.0 37.0 37.0 95-99 35.8783 37.0 37.0 37.0 37.0 37.0 100-104 35.7767 37.0 37.0 37.0 37.0 37.0 105-109 35.7981 37.0 37.0 37.0 37.0 37.0 110-114 35.863299999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.7309 37.0 37.0 37.0 37.0 37.0 120-124 35.7972 37.0 37.0 37.0 37.0 37.0 125-129 35.6794 37.0 37.0 37.0 37.0 37.0 130-134 35.5212 37.0 37.0 37.0 37.0 37.0 135-139 35.41930000000001 37.0 37.0 37.0 34.6 37.0 140-144 35.3793 37.0 37.0 37.0 37.0 37.0 145-149 35.2903 37.0 37.0 37.0 32.2 37.0 150-151 35.05025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 1.0 20 2.0 21 2.0 22 7.0 23 3.0 24 5.0 25 6.0 26 10.0 27 11.0 28 10.0 29 18.0 30 27.0 31 36.0 32 56.0 33 97.0 34 197.0 35 561.0 36 2663.0 37 279.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.6 23.724999999999998 10.15 25.525 2 26.025 26.625 31.075000000000003 16.275000000000002 3 20.875 27.05 33.2 18.875 4 23.25 33.550000000000004 23.275000000000002 19.925 5 25.424999999999997 35.949999999999996 23.474999999999998 15.15 6 22.025 37.7 22.675 17.599999999999998 7 19.950000000000003 21.925 38.4 19.725 8 19.875 25.624999999999996 30.2 24.3 9 21.224999999999998 26.55 29.875 22.35 10-14 24.19 29.145 26.224999999999998 20.44 15-19 23.22 27.875 28.46 20.445 20-24 23.075000000000003 28.21 27.415 21.3 25-29 23.075000000000003 28.744999999999997 27.715 20.465 30-34 23.035 28.53 27.96 20.474999999999998 35-39 23.255 28.415000000000003 27.595 20.735 40-44 22.425 28.835 28.28 20.46 45-49 23.425 28.225 27.575 20.775 50-54 23.669999999999998 28.389999999999997 28.09 19.85 55-59 23.655 28.33 27.675 20.34 60-64 23.44 28.175 27.694999999999997 20.69 65-69 23.23 28.46 28.01 20.3 70-74 23.990000000000002 28.255000000000003 27.775 19.98 75-79 23.46 28.439999999999998 28.215 19.885 80-84 23.549999999999997 28.825 27.785 19.84 85-89 23.974999999999998 28.265 27.735 20.025000000000002 90-94 23.835 28.16 28.37 19.634999999999998 95-99 23.64 27.965 28.185 20.21 100-104 23.895 28.57 27.445000000000004 20.09 105-109 24.895 28.03 27.12 19.955000000000002 110-114 24.315 28.655 26.474999999999998 20.555 115-119 24.505 28.485 27.169999999999998 19.84 120-124 24.72 28.884999999999998 26.68 19.715 125-129 24.635 28.155 27.38 19.830000000000002 130-134 25.235000000000003 28.505000000000003 26.435 19.825 135-139 25.15 28.87 26.325 19.655 140-144 25.46 28.1 27.05 19.39 145-149 25.840000000000003 27.944999999999997 26.85 19.365 150-151 26.6625 28.499999999999996 26.187500000000004 18.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.5 11 1.5 12 1.5 13 1.0 14 0.0 15 1.0 16 1.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 2.5 23 3.0 24 2.0 25 2.5 26 4.5 27 8.5 28 12.5 29 12.0 30 16.5 31 24.0 32 27.5 33 35.0 34 49.0 35 72.5 36 90.0 37 117.5 38 148.5 39 169.0 40 201.5 41 238.5 42 263.5 43 253.5 44 279.0 45 288.5 46 257.0 47 252.5 48 221.0 49 190.0 50 159.0 51 122.0 52 102.0 53 86.0 54 71.0 55 53.0 56 41.0 57 33.0 58 22.5 59 15.5 60 10.5 61 8.5 62 8.0 63 5.0 64 2.0 65 1.5 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.925 #Duplication Level Percentage of deduplicated Percentage of total 1 90.76161671707452 82.525 2 8.551003574374484 15.55 3 0.6323893318669233 1.725 4 0.05499037668408029 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.5125 0.0 0.0 0.0 0.0 106-107 1.8125 0.0 0.0 0.0 0.0 108-109 2.0875 0.0 0.0 0.0 0.0 110-111 2.45 0.0 0.0 0.0 0.0 112-113 2.8375 0.0 0.0 0.0 0.0 114-115 3.0875 0.0 0.0 0.0 0.0 116-117 3.4 0.0 0.0 0.0 0.0 118-119 3.6375 0.0 0.0 0.0 0.0 120-121 4.0125 0.0 0.0 0.0 0.0 122-123 4.4 0.0 0.0 0.0 0.0 124-125 4.9625 0.0 0.0 0.0 0.0 126-127 5.6875 0.0 0.0 0.0 0.0 128-129 6.1375 0.0 0.0 0.0 0.0 130-131 6.75 0.0 0.0 0.0 0.0 132-133 7.45 0.0 0.0 0.0 0.0 134-135 8.087499999999999 0.0 0.0 0.0 0.0 136-137 8.5125 0.0 0.0 0.0 0.0 138-139 8.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 761879 spots for SRR12919328.sra Written 761879 spots for SRR12919328.sra Read 761879 spots for SRR12919328.sra Written 761879 spots for SRR12919328.sra Read 761879 spots for SRR12919328.sra Written 761879 spots for SRR12919328.sra Read 761879 spots for SRR12919328.sra Written 761879 spots for SRR12919328.sra Read 761879 spots for SRR12919328.sra Written 761879 spots for SRR12919328.sra Read 761879 spots for SRR12919328.sra Written 761879 spots for SRR12919328.sra Read 761879 spots for SRR12919328.sra Written 761879 spots for SRR12919328.sra Read 761879 spots for SRR12919328.sra Written 761879 spots for SRR12919328.sra Read 761879 spots for SRR12919328.sra Written 761879 spots for SRR12919328.sra Read 761879 spots for SRR12919328.sra Written 761879 spots for SRR12919328.sra Read 761879 spots for SRR12919328.sra Written 761879 spots for SRR12919328.sra Read 761879 spots for SRR12919328.sra Written 761879 spots for SRR12919328.sra Read 761879 spots for SRR12919328.sra Written 761879 spots for SRR12919328.sra Read 761892 spots for SRR12919328.sra Written 761892 spots for SRR12919328.sra Read 761879 spots for SRR12919328.sra Written 761879 spots for SRR12919328.sra Read 761879 spots for SRR12919328.sra Written 761879 spots for SRR12919328.sra Read 761879 spots for SRR12919328.sra Written 761879 spots for SRR12919328.sra Read 761879 spots for SRR12919328.sra Written 761879 spots for SRR12919328.sra Read 761879 spots for SRR12919328.sra Written 761879 spots for SRR12919328.sra Read 761879 spots for SRR12919328.sra Written 761879 spots for SRR12919328.sra SRR ids: ['SRR12919328.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_03a_9iit SRR12919328.sra spots: 15237593 blocks: [[1, 761879], [761880, 1523758], [1523759, 2285637], [2285638, 3047516], [3047517, 3809395], [3809396, 4571274], [4571275, 5333153], [5333154, 6095032], [6095033, 6856911], [6856912, 7618790], [7618791, 8380669], [8380670, 9142548], [9142549, 9904427], [9904428, 10666306], [10666307, 11428185], [11428186, 12190064], [12190065, 12951943], [12951944, 13713822], [13713823, 14475701], [14475702, 15237593]] SRR12919328 file size 5156700 SRR12919328 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919328 SRR12919328_1.fastq SRR12919328_2.fastq Input file: SRR12919328_1.fastq Paired file: SRR12919328_2.fastq trimmed: SRR12919328-trimmed-pair1.fastq, SRR12919328-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:36:07 2025 >> started Wed Feb 12 18:36:23 2025 >> done (15.634s) 15237593 read pairs processed; of these: 34 ( 0.00%) short read pairs filtered out after trimming by size control 858 ( 0.01%) empty read pairs filtered out after trimming by size control 15236701 (99.99%) read pairs available; of these: 1974024 (12.96%) trimmed read pairs available after processing 13262677 (87.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 5 0.00% 21 0 0.00% 22 7 0.00% 23 5 0.00% 24 7 0.00% 25 5 0.00% 26 4 0.00% 27 3 0.00% 28 7 0.00% 29 14 0.00% 30 10 0.00% 31 7 0.00% 32 19 0.00% 33 11 0.00% 34 15 0.00% 35 18 0.00% 36 15 0.00% 37 17 0.00% 38 23 0.00% 39 23 0.00% 40 15 0.00% 41 30 0.00% 42 15 0.00% 43 31 0.00% 44 34 0.00% 45 25 0.00% 46 34 0.00% 47 39 0.00% 48 41 0.00% 49 54 0.00% 50 56 0.00% 51 78 0.00% 52 83 0.00% 53 97 0.00% 54 79 0.00% 55 112 0.00% 56 108 0.00% 57 127 0.00% 58 148 0.00% 59 183 0.00% 60 252 0.00% 61 232 0.00% 62 278 0.00% 63 333 0.00% 64 357 0.00% 65 353 0.00% 66 402 0.00% 67 449 0.00% 68 534 0.00% 69 686 0.00% 70 707 0.00% 71 782 0.01% 72 1047 0.01% 73 1204 0.01% 74 1358 0.01% 75 1425 0.01% 76 1641 0.01% 77 1773 0.01% 78 1954 0.01% 79 2255 0.01% 80 2469 0.02% 81 2798 0.02% 82 3304 0.02% 83 3743 0.02% 84 4286 0.03% 85 4558 0.03% 86 4944 0.03% 87 5366 0.04% 88 5885 0.04% 89 6298 0.04% 90 6957 0.05% 91 7650 0.05% 92 8528 0.06% 93 9302 0.06% 94 10291 0.07% 95 10890 0.07% 96 11486 0.08% 97 12357 0.08% 98 12543 0.08% 99 13752 0.09% 100 14345 0.09% 101 15274 0.10% 102 15998 0.10% 103 17642 0.12% 104 18576 0.12% 105 19708 0.13% 106 20312 0.13% 107 20958 0.14% 108 21470 0.14% 109 22523 0.15% 110 23110 0.15% 111 23935 0.16% 112 25258 0.17% 113 26091 0.17% 114 27237 0.18% 115 28587 0.19% 116 29154 0.19% 117 30050 0.20% 118 30762 0.20% 119 31005 0.20% 120 31495 0.21% 121 32983 0.22% 122 33191 0.22% 123 34083 0.22% 124 35642 0.23% 125 37333 0.25% 126 38171 0.25% 127 38668 0.25% 128 39129 0.26% 129 39034 0.26% 130 40046 0.26% 131 40238 0.26% 132 41497 0.27% 133 42891 0.28% 134 43242 0.28% 135 44445 0.29% 136 44758 0.29% 137 45343 0.30% 138 45839 0.30% 139 46622 0.31% 140 46560 0.31% 141 47263 0.31% 142 48105 0.32% 143 48822 0.32% 144 50049 0.33% 145 50366 0.33% 146 51101 0.34% 147 51577 0.34% 148 51885 0.34% 149 51919 0.34% 150 52696 0.35% 151 13262677 87.04% 15236701 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=39 prefix-density=0.19 prefix-fanout=2.1 sequence=TACAGTCCCCAACAAGTTCTCTCCATTCTCTGGATAATTGAAATCTCCAAATACCAGTTTACCTTTCTCCGATCCGAATTTCTTCCAGTTCCAAACTCCTGTGAAGGCAACAGCCTGCGGCACAGAAACATCACCTGGAACCATTGTTTTCTTATCCAAGCTTCCAGCATTCCCAAAATAGATGACTCCGTGAATGCTGAATCTAACTAGAAGGATTTGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=436.71 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=35.1 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=30 prefix-density=0.21 prefix-fanout=2.6 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=52.40 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.2 sequence=CTCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTT SRR12919328 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:37:09 Started mapping on | Feb 12 18:37:09 Finished on | Feb 12 18:39:01 Mapping speed, Million of reads per hour | 489.75 Number of input reads | 15236701 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14060249 Uniquely mapped reads % | 92.28% Average mapped length | 294.24 Number of splices: Total | 13469989 Number of splices: Annotated (sjdb) | 13181337 Number of splices: GT/AG | 13223416 Number of splices: GC/AG | 194716 Number of splices: AT/AC | 15052 Number of splices: Non-canonical | 36805 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 357778 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 34788 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.01% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 818674 818674 818674 N_multimapping 357778 357778 357778 N_noFeature 550605 13889173 632781 N_ambiguous 166287 894 76911 UnstrandedReadsAssigned:13343357 PositiveStrandReadsAssigned:170182 NegativeStrandReadsAssigned:13350557 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919328 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919328-trimmed-pair1.fastq SRR12919328-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,236,701 reads, 13,422,694 reads pseudoaligned [quant] estimated average fragment length: 251.331 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52401 SRR12919328.ke.tsv 34699 SRR12919328.se.tsv 87100 total ==> SRR12919328.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.67 525 23.5418 Potri.005G024800.1.v4.1 1035 784.669 161 16.2638 Potri.004G059700.1.v4.1 961 710.788 45 5.01827 Potri.007G009000.2.v4.1 1416 1165.67 0 0 Potri.003G141000.2.v4.1 2943 2692.67 518 15.2485 Potri.016G087400.1.v4.1 270 89.4045 1089.8 966.204 Potri.015G069301.1.v4.1 564 327.361 0 0 Potri.010G195200.1.v4.1 1773 1522.67 53 2.759 Potri.012G127500.1.v4.1 977 726.735 12046 1313.86 ==> SRR12919328.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 123 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 175 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 82 SRR12919328 completed mapping pipeline successfully