Starting /dee2/code/volunteer_pipeline.sh SRR12919329 current disk space = 3051324080128 free memory = 1424577684 SRR12919329 SRAfilesize c541642db87b628e9c7e739dd64d9aab SRR12919329.sra SRR12919329.sra file validated SRR12919329 is paired end SRR12919329 is conventional basespace SRR12919329 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919329_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5375 37.0 37.0 37.0 37.0 37.0 2 36.07475 37.0 37.0 37.0 37.0 37.0 3 36.4395 37.0 37.0 37.0 37.0 37.0 4 36.5585 37.0 37.0 37.0 37.0 37.0 5 36.568 37.0 37.0 37.0 37.0 37.0 6 36.6365 37.0 37.0 37.0 37.0 37.0 7 36.565 37.0 37.0 37.0 37.0 37.0 8 36.641 37.0 37.0 37.0 37.0 37.0 9 36.5735 37.0 37.0 37.0 37.0 37.0 10-14 36.5997 37.0 37.0 37.0 37.0 37.0 15-19 36.5841 37.0 37.0 37.0 37.0 37.0 20-24 36.5852 37.0 37.0 37.0 37.0 37.0 25-29 36.517700000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.5073 37.0 37.0 37.0 37.0 37.0 35-39 36.480500000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.4921 37.0 37.0 37.0 37.0 37.0 45-49 36.443400000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.4111 37.0 37.0 37.0 37.0 37.0 55-59 36.362399999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.2762 37.0 37.0 37.0 37.0 37.0 65-69 36.3536 37.0 37.0 37.0 37.0 37.0 70-74 36.3368 37.0 37.0 37.0 37.0 37.0 75-79 36.3337 37.0 37.0 37.0 37.0 37.0 80-84 36.3457 37.0 37.0 37.0 37.0 37.0 85-89 36.245400000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.2036 37.0 37.0 37.0 37.0 37.0 95-99 36.2339 37.0 37.0 37.0 37.0 37.0 100-104 36.1999 37.0 37.0 37.0 37.0 37.0 105-109 36.1902 37.0 37.0 37.0 37.0 37.0 110-114 36.124 37.0 37.0 37.0 37.0 37.0 115-119 36.0767 37.0 37.0 37.0 37.0 37.0 120-124 36.0589 37.0 37.0 37.0 37.0 37.0 125-129 35.9436 37.0 37.0 37.0 37.0 37.0 130-134 35.93730000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.8836 37.0 37.0 37.0 37.0 37.0 140-144 35.79299999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.7402 37.0 37.0 37.0 37.0 37.0 150-151 35.429500000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 0.0 25 3.0 26 2.0 27 6.0 28 12.0 29 11.0 30 28.0 31 42.0 32 38.0 33 84.0 34 118.0 35 320.0 36 2980.0 37 354.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.349999999999994 13.175 6.75 38.725 2 20.251572327044027 13.383647798742137 36.67924528301887 29.68553459119497 3 16.1 18.475 29.425 36.0 4 22.225 26.325 23.375 28.075 5 23.875 31.775 24.875 19.475 6 21.575 34.125 23.125 21.175 7 16.150000000000002 27.275 40.925 15.65 8 18.099999999999998 25.2 31.95 24.75 9 18.15 23.799999999999997 33.925 24.125 10-14 19.395 29.970000000000002 28.060000000000002 22.575 15-19 20.165 27.515 28.16 24.16 20-24 19.575 28.345 27.68 24.4 25-29 20.395 28.325 27.55 23.73 30-34 19.925 29.125 27.474999999999998 23.474999999999998 35-39 20.125 28.599999999999998 27.605 23.669999999999998 40-44 19.725 28.435 28.17 23.669999999999998 45-49 20.150000000000002 28.73 27.52 23.599999999999998 50-54 20.175 28.499999999999996 27.58 23.745 55-59 19.905 28.544999999999998 27.625 23.925 60-64 20.330000000000002 28.205000000000002 27.41 24.055 65-69 19.865 28.51 27.88 23.745 70-74 20.669999999999998 27.735 27.955000000000002 23.64 75-79 20.05 28.365000000000002 27.779999999999998 23.805 80-84 20.075000000000003 28.48 28.294999999999998 23.150000000000002 85-89 20.485 28.235 27.685 23.595 90-94 20.215 28.134999999999998 27.939999999999998 23.71 95-99 21.025 27.689999999999998 27.525 23.76 100-104 20.49 28.74 27.605 23.165 105-109 20.849999999999998 28.084999999999997 27.22 23.845 110-114 20.215 28.57 27.485 23.73 115-119 21.005 27.61 27.495000000000005 23.89 120-124 21.240000000000002 28.335 26.900000000000002 23.525 125-129 21.04 28.17 27.395000000000003 23.395 130-134 20.49 28.044999999999998 27.38 24.085 135-139 21.015 27.675 27.18 24.13 140-144 21.245 28.42 26.57 23.765 145-149 21.295 28.694999999999997 26.215 23.794999999999998 150-151 20.875 27.175 27.800000000000004 24.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.5 22 0.5 23 1.5 24 2.0 25 2.5 26 6.0 27 7.5 28 12.0 29 15.0 30 12.0 31 23.5 32 32.5 33 40.5 34 54.5 35 67.0 36 87.0 37 105.0 38 130.0 39 153.0 40 167.0 41 201.0 42 249.5 43 267.0 44 260.0 45 277.5 46 287.5 47 266.5 48 236.0 49 205.0 50 171.0 51 136.0 52 123.0 53 101.5 54 66.0 55 52.0 56 46.0 57 31.0 58 26.0 59 26.5 60 16.0 61 8.0 62 6.5 63 4.5 64 3.0 65 2.0 66 2.0 67 2.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.625 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.45 #Duplication Level Percentage of deduplicated Percentage of total 1 89.85466741196198 80.375 2 8.69200670765791 15.55 3 1.3135830072666295 3.5249999999999995 4 0.11179429849077697 0.4 5 0.0 0.0 6 0.027948574622694244 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCAGCAGCTTCCTCTCCAACATTTGAGTCAGTGACAAATCCATTGAATT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.5499999999999998 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.4625 0.0 0.0 0.0 0.0 118-119 2.775 0.0 0.0 0.0 0.0 120-121 3.1625 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.5875 0.0 0.0 0.0 0.0 126-127 3.95 0.0 0.0 0.0 0.0 128-129 4.3375 0.0 0.0 0.0 0.0 130-131 4.9 0.0 0.0 0.0 0.0 132-133 5.35 0.0 0.0 0.0 0.0 134-135 5.9125 0.0 0.0 0.0 0.0 136-137 6.4375 0.0 0.0 0.0 0.0 138-139 6.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCATCA 10 0.006830828 145.0 7 CCCACAA 10 0.006830828 145.0 1 GTCCCAG 10 0.006830828 145.0 1 CCACAAG 10 0.006830828 145.0 2 >>END_MODULE SRR12919329 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919329_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.995 37.0 37.0 37.0 37.0 37.0 2 35.727 37.0 37.0 37.0 37.0 37.0 3 35.847 37.0 37.0 37.0 37.0 37.0 4 36.0235 37.0 37.0 37.0 37.0 37.0 5 35.8665 37.0 37.0 37.0 37.0 37.0 6 36.0055 37.0 37.0 37.0 37.0 37.0 7 36.026 37.0 37.0 37.0 37.0 37.0 8 36.0665 37.0 37.0 37.0 37.0 37.0 9 36.0485 37.0 37.0 37.0 37.0 37.0 10-14 36.0376 37.0 37.0 37.0 37.0 37.0 15-19 36.061699999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.0406 37.0 37.0 37.0 37.0 37.0 25-29 35.937200000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.955200000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.8899 37.0 37.0 37.0 37.0 37.0 40-44 35.8496 37.0 37.0 37.0 37.0 37.0 45-49 35.86130000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.7932 37.0 37.0 37.0 37.0 37.0 55-59 35.799800000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.7959 37.0 37.0 37.0 37.0 37.0 65-69 35.7815 37.0 37.0 37.0 37.0 37.0 70-74 35.6385 37.0 37.0 37.0 37.0 37.0 75-79 35.6853 37.0 37.0 37.0 37.0 37.0 80-84 35.6459 37.0 37.0 37.0 37.0 37.0 85-89 35.6589 37.0 37.0 37.0 37.0 37.0 90-94 35.6082 37.0 37.0 37.0 37.0 37.0 95-99 35.51780000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.5284 37.0 37.0 37.0 37.0 37.0 105-109 35.4827 37.0 37.0 37.0 37.0 37.0 110-114 35.533100000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.5106 37.0 37.0 37.0 37.0 37.0 120-124 35.3913 37.0 37.0 37.0 37.0 37.0 125-129 35.3765 37.0 37.0 37.0 34.6 37.0 130-134 35.2739 37.0 37.0 37.0 34.6 37.0 135-139 35.1474 37.0 37.0 37.0 25.0 37.0 140-144 35.1217 37.0 37.0 37.0 27.4 37.0 145-149 34.986000000000004 37.0 37.0 37.0 25.0 37.0 150-151 34.884 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 1.0 15 1.0 16 1.0 17 0.0 18 4.0 19 2.0 20 6.0 21 9.0 22 4.0 23 6.0 24 9.0 25 8.0 26 17.0 27 15.0 28 18.0 29 24.0 30 43.0 31 50.0 32 75.0 33 132.0 34 244.0 35 656.0 36 2451.0 37 221.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.6 24.025 10.05 24.325 2 26.950000000000003 26.450000000000003 30.425 16.175 3 20.275000000000002 27.650000000000002 33.074999999999996 19.0 4 23.5 34.2 23.275000000000002 19.025 5 24.65 36.55 22.425 16.375 6 21.825 37.675 21.025 19.475 7 21.125 21.475 37.65 19.75 8 19.950000000000003 26.900000000000002 28.299999999999997 24.85 9 22.85 25.55 30.375000000000004 21.224999999999998 10-14 23.555 29.020000000000003 26.640000000000004 20.785 15-19 22.725 28.54 27.3 21.435000000000002 20-24 23.01 28.494999999999997 27.310000000000002 21.185000000000002 25-29 22.435 28.22 28.050000000000004 21.295 30-34 23.09 28.110000000000003 27.589999999999996 21.21 35-39 22.900000000000002 27.595 28.449999999999996 21.055 40-44 23.07 27.935 28.205000000000002 20.79 45-49 22.53 28.22 28.1 21.15 50-54 23.155 27.189999999999998 28.515 21.14 55-59 23.07 27.42 28.625 20.885 60-64 23.095 27.32 28.515 21.07 65-69 23.369999999999997 27.61 27.495000000000005 21.525 70-74 23.435 27.785 27.575 21.205 75-79 22.935 28.105000000000004 27.725 21.235 80-84 23.549999999999997 27.779999999999998 27.800000000000004 20.87 85-89 22.89 28.549999999999997 27.595 20.965 90-94 23.32 27.395000000000003 28.03 21.255 95-99 23.189999999999998 28.005000000000003 27.66 21.145 100-104 23.71 27.275 27.935 21.08 105-109 23.330000000000002 28.144999999999996 27.565 20.96 110-114 24.035 28.405 27.11 20.45 115-119 23.935000000000002 27.800000000000004 27.700000000000003 20.565 120-124 23.575 28.12 27.465 20.84 125-129 24.41 27.845 27.474999999999998 20.27 130-134 24.355 27.685 27.54 20.419999999999998 135-139 25.495 27.785 27.08 19.64 140-144 24.93 27.93 26.61 20.53 145-149 25.224999999999998 28.04 27.04 19.695 150-151 26.075 27.487499999999997 26.450000000000003 19.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.5 14 1.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 2.0 21 3.0 22 1.5 23 3.0 24 5.5 25 4.5 26 6.0 27 7.5 28 5.5 29 11.5 30 20.5 31 20.5 32 24.0 33 38.5 34 49.5 35 58.5 36 84.0 37 111.5 38 132.0 39 168.5 40 194.0 41 223.0 42 246.5 43 249.5 44 260.5 45 253.0 46 269.0 47 271.5 48 226.5 49 203.5 50 175.0 51 140.0 52 112.5 53 93.0 54 82.5 55 59.0 56 47.5 57 38.5 58 19.0 59 15.0 60 17.5 61 9.5 62 4.0 63 4.5 64 3.0 65 1.5 66 2.0 67 1.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.0 96 2.0 97 2.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.67500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.10315026484528 80.80000000000001 2 8.64231948703652 15.5 3 1.0315026484527459 2.775 4 0.16727069974909395 0.6 5 0.0 0.0 6 0.027878449958182325 0.15 7 0.027878449958182325 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATG 7 0.17500000000000002 No Hit GTTCAGAGATGGAAACCGACATATGTAGCTGTAAGGCAATTCAATGGATT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.5499999999999998 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.4625 0.0 0.0 0.0 0.0 118-119 2.8 0.0 0.0 0.0 0.0 120-121 3.1875 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.5875 0.0 0.0 0.0 0.0 126-127 3.95 0.0 0.0 0.0 0.0 128-129 4.3125 0.0 0.0 0.0 0.0 130-131 4.875 0.0 0.0 0.0 0.0 132-133 5.3125 0.0 0.0 0.0 0.0 134-135 5.875 0.0 0.0 0.0 0.0 136-137 6.4125 0.0 0.0 0.0 0.0 138-139 6.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTTG 10 0.006830828 145.0 4 AGTACAA 10 0.006830828 145.0 145 AGTTGTG 10 0.006830828 145.0 5 >>END_MODULE Read 877802 spots for SRR12919329.sra Written 877802 spots for SRR12919329.sra Read 877802 spots for SRR12919329.sra Written 877802 spots for SRR12919329.sra Read 877802 spots for SRR12919329.sra Written 877802 spots for SRR12919329.sra Read 877802 spots for SRR12919329.sra Written 877802 spots for SRR12919329.sra Read 877802 spots for SRR12919329.sra Written 877802 spots for SRR12919329.sra Read 877802 spots for SRR12919329.sra Written 877802 spots for SRR12919329.sra Read 877802 spots for SRR12919329.sra Written 877802 spots for SRR12919329.sra Read 877802 spots for SRR12919329.sra Written 877802 spots for SRR12919329.sra Read 877802 spots for SRR12919329.sra Written 877802 spots for SRR12919329.sra Read 877802 spots for SRR12919329.sra Written 877802 spots for SRR12919329.sra Read 877802 spots for SRR12919329.sra Written 877802 spots for SRR12919329.sra Read 877818 spots for SRR12919329.sra Written 877818 spots for SRR12919329.sra Read 877802 spots for SRR12919329.sra Written 877802 spots for SRR12919329.sra Read 877802 spots for SRR12919329.sra Written 877802 spots for SRR12919329.sra Read 877802 spots for SRR12919329.sra Written 877802 spots for SRR12919329.sra Read 877802 spots for SRR12919329.sra Written 877802 spots for SRR12919329.sra Read 877802 spots for SRR12919329.sra Written 877802 spots for SRR12919329.sra Read 877802 spots for SRR12919329.sra Written 877802 spots for SRR12919329.sra Read 877802 spots for SRR12919329.sra Written 877802 spots for SRR12919329.sra Read 877802 spots for SRR12919329.sra Written 877802 spots for SRR12919329.sra SRR ids: ['SRR12919329.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9jk6gph8 SRR12919329.sra spots: 17556056 blocks: [[1, 877802], [877803, 1755604], [1755605, 2633406], [2633407, 3511208], [3511209, 4389010], [4389011, 5266812], [5266813, 6144614], [6144615, 7022416], [7022417, 7900218], [7900219, 8778020], [8778021, 9655822], [9655823, 10533624], [10533625, 11411426], [11411427, 12289228], [12289229, 13167030], [13167031, 14044832], [14044833, 14922634], [14922635, 15800436], [15800437, 16678238], [16678239, 17556056]] SRR12919329 file size 5944615 SRR12919329 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919329 SRR12919329_1.fastq SRR12919329_2.fastq Input file: SRR12919329_1.fastq Paired file: SRR12919329_2.fastq trimmed: SRR12919329-trimmed-pair1.fastq, SRR12919329-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:29:52 2025 >> started Wed Feb 12 18:30:21 2025 >> done (29.341s) 17556056 read pairs processed; of these: 22 ( 0.00%) short read pairs filtered out after trimming by size control 5597 ( 0.03%) empty read pairs filtered out after trimming by size control 17550437 (99.97%) read pairs available; of these: 1691505 ( 9.64%) trimmed read pairs available after processing 15858932 (90.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 7 0.00% 20 3 0.00% 21 6 0.00% 22 10 0.00% 23 2 0.00% 24 6 0.00% 25 1 0.00% 26 6 0.00% 27 5 0.00% 28 11 0.00% 29 3 0.00% 30 8 0.00% 31 8 0.00% 32 6 0.00% 33 3 0.00% 34 11 0.00% 35 10 0.00% 36 6 0.00% 37 7 0.00% 38 17 0.00% 39 12 0.00% 40 8 0.00% 41 18 0.00% 42 24 0.00% 43 19 0.00% 44 20 0.00% 45 21 0.00% 46 22 0.00% 47 29 0.00% 48 39 0.00% 49 39 0.00% 50 42 0.00% 51 71 0.00% 52 75 0.00% 53 72 0.00% 54 62 0.00% 55 76 0.00% 56 116 0.00% 57 115 0.00% 58 140 0.00% 59 134 0.00% 60 190 0.00% 61 214 0.00% 62 234 0.00% 63 277 0.00% 64 288 0.00% 65 317 0.00% 66 359 0.00% 67 375 0.00% 68 458 0.00% 69 536 0.00% 70 608 0.00% 71 730 0.00% 72 809 0.00% 73 974 0.01% 74 1075 0.01% 75 1165 0.01% 76 1351 0.01% 77 1350 0.01% 78 1575 0.01% 79 1854 0.01% 80 2104 0.01% 81 2408 0.01% 82 2649 0.02% 83 3100 0.02% 84 3535 0.02% 85 3834 0.02% 86 4153 0.02% 87 4333 0.02% 88 4755 0.03% 89 5099 0.03% 90 5662 0.03% 91 6228 0.04% 92 6806 0.04% 93 7762 0.04% 94 8339 0.05% 95 8890 0.05% 96 9529 0.05% 97 10026 0.06% 98 10443 0.06% 99 11065 0.06% 100 11642 0.07% 101 12217 0.07% 102 13444 0.08% 103 14158 0.08% 104 15310 0.09% 105 16104 0.09% 106 16988 0.10% 107 17082 0.10% 108 17350 0.10% 109 18160 0.10% 110 18489 0.11% 111 19787 0.11% 112 20710 0.12% 113 21424 0.12% 114 22352 0.13% 115 23571 0.13% 116 24358 0.14% 117 25081 0.14% 118 25156 0.14% 119 25734 0.15% 120 26408 0.15% 121 27401 0.16% 122 27638 0.16% 123 29215 0.17% 124 30214 0.17% 125 30995 0.18% 126 32732 0.19% 127 32955 0.19% 128 33216 0.19% 129 33558 0.19% 130 34122 0.19% 131 33972 0.19% 132 35471 0.20% 133 36833 0.21% 134 37692 0.21% 135 38285 0.22% 136 39607 0.23% 137 39650 0.23% 138 40588 0.23% 139 41425 0.24% 140 41031 0.23% 141 41124 0.23% 142 42123 0.24% 143 43025 0.25% 144 44609 0.25% 145 45480 0.26% 146 45873 0.26% 147 47028 0.27% 148 47504 0.27% 149 47341 0.27% 150 48522 0.28% 151 15858932 90.36% 17550437 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=23 prefix-density=0.72 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=50.70 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=2.3 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=21 prefix-density=0.91 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=74.00 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=3.5 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC SRR12919329 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:31:15 Started mapping on | Feb 12 18:31:16 Finished on | Feb 12 18:33:51 Mapping speed, Million of reads per hour | 407.62 Number of input reads | 17550437 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16482739 Uniquely mapped reads % | 93.92% Average mapped length | 295.89 Number of splices: Total | 16071669 Number of splices: Annotated (sjdb) | 15738553 Number of splices: GT/AG | 15740982 Number of splices: GC/AG | 274843 Number of splices: AT/AC | 10516 Number of splices: Non-canonical | 45328 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 393924 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 27130 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.57% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 673774 673774 673774 N_multimapping 393924 393924 393924 N_noFeature 568115 16258694 659571 N_ambiguous 235986 991 102762 UnstrandedReadsAssigned:15678638 PositiveStrandReadsAssigned:223054 NegativeStrandReadsAssigned:15720406 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919329 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919329-trimmed-pair1.fastq SRR12919329-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,550,437 reads, 15,761,408 reads pseudoaligned [quant] estimated average fragment length: 271.335 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR12919329.ke.tsv 34699 SRR12919329.se.tsv 87100 total ==> SRR12919329.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.66 467 16.4793 Potri.005G024800.1.v4.1 1035 764.665 166 13.388 Potri.004G059700.1.v4.1 961 690.849 38 3.39219 Potri.007G009000.2.v4.1 1416 1145.66 0 0 Potri.003G141000.2.v4.1 2943 2672.66 795 18.3444 Potri.016G087400.1.v4.1 270 83.6747 586 431.901 Potri.015G069301.1.v4.1 564 312.928 0 0 Potri.010G195200.1.v4.1 1773 1502.66 13 0.533533 Potri.012G127500.1.v4.1 977 706.766 171 14.9211 ==> SRR12919329.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 249 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 164 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 5 SRR12919329 completed mapping pipeline successfully