Starting /dee2/code/volunteer_pipeline.sh SRR12919330 current disk space = 3051086168064 free memory = 1578853952 SRR12919330 SRAfilesize 936b8abfd6974059f7f17109724953c1 SRR12919330.sra SRR12919330.sra file validated SRR12919330 is paired end SRR12919330 is conventional basespace SRR12919330 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919330_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.502 37.0 37.0 37.0 37.0 37.0 2 36.4165 37.0 37.0 37.0 37.0 37.0 3 36.606 37.0 37.0 37.0 37.0 37.0 4 36.6685 37.0 37.0 37.0 37.0 37.0 5 36.662 37.0 37.0 37.0 37.0 37.0 6 36.604 37.0 37.0 37.0 37.0 37.0 7 36.633 37.0 37.0 37.0 37.0 37.0 8 36.6355 37.0 37.0 37.0 37.0 37.0 9 36.606 37.0 37.0 37.0 37.0 37.0 10-14 36.67379999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.643 37.0 37.0 37.0 37.0 37.0 20-24 36.5908 37.0 37.0 37.0 37.0 37.0 25-29 36.5433 37.0 37.0 37.0 37.0 37.0 30-34 36.5535 37.0 37.0 37.0 37.0 37.0 35-39 36.507000000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.488800000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.437 37.0 37.0 37.0 37.0 37.0 50-54 36.464600000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.443400000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.3863 37.0 37.0 37.0 37.0 37.0 65-69 36.374900000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.3535 37.0 37.0 37.0 37.0 37.0 75-79 36.3299 37.0 37.0 37.0 37.0 37.0 80-84 36.3291 37.0 37.0 37.0 37.0 37.0 85-89 36.260400000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.2445 37.0 37.0 37.0 37.0 37.0 95-99 36.2817 37.0 37.0 37.0 37.0 37.0 100-104 36.1888 37.0 37.0 37.0 37.0 37.0 105-109 36.135299999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.04299999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.1314 37.0 37.0 37.0 37.0 37.0 120-124 36.101800000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.0481 37.0 37.0 37.0 37.0 37.0 130-134 35.8343 37.0 37.0 37.0 37.0 37.0 135-139 35.86749999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.7819 37.0 37.0 37.0 37.0 37.0 145-149 35.6775 37.0 37.0 37.0 37.0 37.0 150-151 35.4885 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 0.0 24 1.0 25 0.0 26 3.0 27 4.0 28 4.0 29 18.0 30 24.0 31 34.0 32 62.0 33 69.0 34 102.0 35 325.0 36 2961.0 37 391.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.324999999999996 11.125 6.575 42.975 2 18.020050125313283 14.035087719298245 37.719298245614034 30.22556390977444 3 16.975 15.725 28.95 38.35 4 21.75 25.424999999999997 23.9 28.925 5 21.25 30.875000000000004 25.8 22.075 6 21.575 32.05 25.25 21.125 7 15.25 26.974999999999998 41.175 16.6 8 17.150000000000002 26.375 32.25 24.224999999999998 9 17.974999999999998 23.9 34.525 23.599999999999998 10-14 19.215 29.94 27.485 23.36 15-19 19.869999999999997 27.284999999999997 28.139999999999997 24.705 20-24 19.53 28.395 27.265 24.81 25-29 19.85 28.54 27.665 23.945 30-34 19.79 28.675 27.605 23.93 35-39 18.745 28.449999999999996 28.455000000000002 24.349999999999998 40-44 20.3 28.335 27.96 23.405 45-49 19.6 28.535 27.73 24.135 50-54 20.405 28.59 27.735 23.27 55-59 19.625 28.52 27.450000000000003 24.404999999999998 60-64 20.305 28.294999999999998 27.49 23.91 65-69 20.580000000000002 27.815 28.325 23.28 70-74 20.605 27.55 27.955000000000002 23.89 75-79 19.7 27.685 28.48 24.135 80-84 20.095 28.87 27.395000000000003 23.64 85-89 19.845 28.485 28.08 23.59 90-94 20.080000000000002 28.275 28.51 23.135 95-99 20.51 27.815 28.025 23.65 100-104 20.195 28.22 27.97 23.615 105-109 19.975 27.955000000000002 27.810000000000002 24.26 110-114 20.3 28.199999999999996 27.87 23.630000000000003 115-119 20.165 28.294999999999998 28.235 23.305 120-124 19.655 28.605000000000004 27.6 24.14 125-129 20.65 28.134999999999998 27.105 24.11 130-134 20.5 28.73 26.915 23.855 135-139 20.305 28.065 27.755000000000003 23.875 140-144 20.244999999999997 28.444999999999997 27.37 23.94 145-149 20.875 27.875 27.189999999999998 24.060000000000002 150-151 21.3625 28.050000000000004 26.987499999999997 23.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 1.0 20 1.5 21 2.0 22 2.5 23 1.5 24 1.0 25 4.5 26 6.5 27 6.0 28 7.5 29 11.5 30 14.0 31 18.5 32 30.0 33 42.0 34 50.0 35 62.0 36 80.0 37 98.0 38 119.0 39 157.0 40 195.0 41 219.0 42 240.0 43 249.0 44 270.0 45 263.5 46 269.5 47 289.0 48 250.0 49 215.5 50 184.5 51 148.0 52 123.0 53 99.5 54 73.0 55 51.5 56 39.0 57 33.5 58 26.0 59 16.5 60 9.5 61 5.5 62 4.0 63 1.5 64 1.5 65 2.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.975 #Duplication Level Percentage of deduplicated Percentage of total 1 92.2805110084262 84.875 2 6.876868714324545 12.65 3 0.7067137809187279 1.95 4 0.10872519706441967 0.4 5 0.02718129926610492 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGAATTTCATGAGAAGCATCCTTGCATTTTCGCATTCTGAATTTCATCGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.07500000000000001 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.0750000000000002 0.0 0.0 0.0 0.0 104-105 1.2374999999999998 0.0 0.0 0.0 0.0 106-107 1.45 0.0 0.0 0.0 0.0 108-109 1.7 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 1.9874999999999998 0.0 0.0 0.0 0.0 114-115 2.15 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 2.7750000000000004 0.0 0.0 0.0 0.0 122-123 3.125 0.0 0.0 0.0 0.0 124-125 3.4125 0.0 0.0 0.0 0.0 126-127 3.6875 0.0 0.0 0.0 0.0 128-129 4.075 0.0 0.0 0.0 0.0 130-131 4.4 0.0 0.0 0.0 0.0 132-133 4.5875 0.0 0.0 0.0 0.0 134-135 4.875 0.0 0.0 0.0 0.0 136-137 5.175 0.0 0.0 0.0 0.0 138-139 5.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919330 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919330_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1455 37.0 37.0 37.0 37.0 37.0 2 36.1545 37.0 37.0 37.0 37.0 37.0 3 36.2135 37.0 37.0 37.0 37.0 37.0 4 36.17 37.0 37.0 37.0 37.0 37.0 5 36.2985 37.0 37.0 37.0 37.0 37.0 6 36.294 37.0 37.0 37.0 37.0 37.0 7 36.256 37.0 37.0 37.0 37.0 37.0 8 36.3045 37.0 37.0 37.0 37.0 37.0 9 36.2485 37.0 37.0 37.0 37.0 37.0 10-14 36.296499999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.254 37.0 37.0 37.0 37.0 37.0 20-24 36.2872 37.0 37.0 37.0 37.0 37.0 25-29 36.21659999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.1976 37.0 37.0 37.0 37.0 37.0 35-39 36.133300000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.10979999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.090999999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.0307 37.0 37.0 37.0 37.0 37.0 55-59 36.0002 37.0 37.0 37.0 37.0 37.0 60-64 36.03060000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.0239 37.0 37.0 37.0 37.0 37.0 70-74 35.9923 37.0 37.0 37.0 37.0 37.0 75-79 35.9357 37.0 37.0 37.0 37.0 37.0 80-84 35.9052 37.0 37.0 37.0 37.0 37.0 85-89 35.851099999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.8016 37.0 37.0 37.0 37.0 37.0 95-99 35.807100000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.767 37.0 37.0 37.0 37.0 37.0 105-109 35.705 37.0 37.0 37.0 37.0 37.0 110-114 35.716 37.0 37.0 37.0 37.0 37.0 115-119 35.7274 37.0 37.0 37.0 37.0 37.0 120-124 35.643100000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.592999999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.549400000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.4428 37.0 37.0 37.0 37.0 37.0 140-144 35.3445 37.0 37.0 37.0 34.6 37.0 145-149 35.205600000000004 37.0 37.0 37.0 27.4 37.0 150-151 35.17775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 2.0 15 3.0 16 1.0 17 1.0 18 1.0 19 3.0 20 1.0 21 1.0 22 3.0 23 2.0 24 3.0 25 7.0 26 10.0 27 10.0 28 17.0 29 28.0 30 25.0 31 43.0 32 61.0 33 110.0 34 217.0 35 529.0 36 2621.0 37 299.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.625 23.525 10.5 27.35 2 27.925 26.650000000000002 30.15 15.275 3 19.3 28.775000000000002 32.550000000000004 19.375 4 22.725 34.949999999999996 23.724999999999998 18.6 5 25.525 35.625 22.825 16.025 6 21.375 38.574999999999996 23.325000000000003 16.725 7 19.7 22.85 38.725 18.725 8 21.25 26.125 28.849999999999998 23.775 9 22.025 25.15 29.725 23.1 10-14 22.74 29.325000000000003 26.97 20.965 15-19 22.8 28.49 27.544999999999998 21.165 20-24 23.155 28.925 27.62 20.3 25-29 22.575 28.28 28.105000000000004 21.04 30-34 22.67 28.955 27.625 20.75 35-39 22.605 28.015 27.805000000000003 21.575 40-44 23.064999999999998 28.105000000000004 28.095 20.735 45-49 22.755 28.665000000000003 27.200000000000003 21.38 50-54 22.985 27.93 27.925 21.16 55-59 22.830000000000002 27.96 28.205000000000002 21.005 60-64 22.95 28.125 28.16 20.765 65-69 23.294999999999998 27.965 27.74 21.0 70-74 23.14 28.315 27.265 21.279999999999998 75-79 22.955000000000002 28.095 27.694999999999997 21.255 80-84 23.3 28.585 27.389999999999997 20.724999999999998 85-89 23.599999999999998 27.925 27.939999999999998 20.535 90-94 23.905 27.97 27.705000000000002 20.419999999999998 95-99 23.805 27.875 27.68 20.64 100-104 24.075 28.189999999999998 27.295 20.44 105-109 23.66 28.185 27.310000000000002 20.845 110-114 24.0 28.249999999999996 27.685 20.064999999999998 115-119 23.87 28.625 27.139999999999997 20.365 120-124 24.255 27.93 28.000000000000004 19.814999999999998 125-129 24.09 28.18 27.584999999999997 20.145 130-134 24.240000000000002 27.565 27.810000000000002 20.385 135-139 24.435000000000002 28.249999999999996 27.525 19.79 140-144 25.230000000000004 27.500000000000004 26.979999999999997 20.29 145-149 25.385 28.15 26.87 19.595000000000002 150-151 25.912499999999998 28.249999999999996 26.400000000000002 19.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 2.0 16 1.5 17 0.0 18 1.0 19 1.0 20 0.5 21 1.5 22 2.5 23 2.5 24 4.0 25 5.5 26 5.0 27 5.0 28 6.5 29 12.0 30 21.0 31 24.5 32 30.5 33 33.5 34 39.5 35 68.5 36 89.0 37 114.0 38 142.0 39 151.5 40 175.0 41 212.5 42 255.5 43 277.0 44 277.5 45 290.0 46 274.5 47 246.5 48 236.5 49 218.0 50 183.0 51 142.0 52 103.0 53 77.0 54 70.0 55 54.0 56 38.5 57 27.5 58 19.5 59 16.5 60 8.5 61 4.5 62 4.5 63 5.0 64 4.0 65 2.5 66 1.0 67 1.5 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.125 #Duplication Level Percentage of deduplicated Percentage of total 1 92.29308005427409 85.02499999999999 2 6.919945725915875 12.75 3 0.7598371777476255 2.1 4 0.0 0.0 5 0.027137042062415198 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGTTGCTATTTAAGGTATGAGTTATATGATTTCTATGACGGCGCAACTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.07500000000000001 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.0750000000000002 0.0 0.0 0.0 0.0 104-105 1.2374999999999998 0.0 0.0 0.0 0.0 106-107 1.45 0.0 0.0 0.0 0.0 108-109 1.7 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 1.9874999999999998 0.0 0.0 0.0 0.0 114-115 2.15 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 2.7750000000000004 0.0 0.0 0.0 0.0 122-123 3.15 0.0 0.0 0.0 0.0 124-125 3.4375 0.0 0.0 0.0 0.0 126-127 3.7375 0.0 0.0 0.0 0.0 128-129 4.125 0.0 0.0 0.0 0.0 130-131 4.45 0.0 0.0 0.0 0.0 132-133 4.637499999999999 0.0 0.0 0.0 0.0 134-135 4.925000000000001 0.0 0.0 0.0 0.0 136-137 5.225 0.0 0.0 0.0 0.0 138-139 5.550000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGCAGT 10 0.006830828 145.0 7 >>END_MODULE Read 912733 spots for SRR12919330.sra Written 912733 spots for SRR12919330.sra Read 912733 spots for SRR12919330.sra Written 912733 spots for SRR12919330.sra Read 912733 spots for SRR12919330.sra Written 912733 spots for SRR12919330.sra Read 912733 spots for SRR12919330.sra Written 912733 spots for SRR12919330.sra Read 912733 spots for SRR12919330.sra Written 912733 spots for SRR12919330.sra Read 912733 spots for SRR12919330.sra Written 912733 spots for SRR12919330.sra Read 912733 spots for SRR12919330.sra Written 912733 spots for SRR12919330.sra Read 912733 spots for SRR12919330.sra Written 912733 spots for SRR12919330.sra Read 912733 spots for SRR12919330.sra Written 912733 spots for SRR12919330.sra Read 912742 spots for SRR12919330.sra Written 912742 spots for SRR12919330.sra Read 912733 spots for SRR12919330.sra Written 912733 spots for SRR12919330.sra Read 912733 spots for SRR12919330.sra Written 912733 spots for SRR12919330.sra Read 912733 spots for SRR12919330.sra Written 912733 spots for SRR12919330.sra Read 912733 spots for SRR12919330.sra Written 912733 spots for SRR12919330.sra Read 912733 spots for SRR12919330.sra Written 912733 spots for SRR12919330.sra Read 912733 spots for SRR12919330.sra Written 912733 spots for SRR12919330.sra Read 912733 spots for SRR12919330.sra Written 912733 spots for SRR12919330.sra Read 912733 spots for SRR12919330.sra Written 912733 spots for SRR12919330.sra Read 912733 spots for SRR12919330.sra Written 912733 spots for SRR12919330.sra Read 912733 spots for SRR12919330.sra Written 912733 spots for SRR12919330.sra SRR ids: ['SRR12919330.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dhc233a2 SRR12919330.sra spots: 18254669 blocks: [[1, 912733], [912734, 1825466], [1825467, 2738199], [2738200, 3650932], [3650933, 4563665], [4563666, 5476398], [5476399, 6389131], [6389132, 7301864], [7301865, 8214597], [8214598, 9127330], [9127331, 10040063], [10040064, 10952796], [10952797, 11865529], [11865530, 12778262], [12778263, 13690995], [13690996, 14603728], [14603729, 15516461], [15516462, 16429194], [16429195, 17341927], [17341928, 18254669]] SRR12919330 file size 6182034 SRR12919330 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919330 SRR12919330_1.fastq SRR12919330_2.fastq Input file: SRR12919330_1.fastq Paired file: SRR12919330_2.fastq trimmed: SRR12919330-trimmed-pair1.fastq, SRR12919330-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:21:48 2025 >> started Wed Feb 12 19:22:11 2025 >> done (23.489s) 18254669 read pairs processed; of these: 17 ( 0.00%) short read pairs filtered out after trimming by size control 604 ( 0.00%) empty read pairs filtered out after trimming by size control 18254048 (100.00%) read pairs available; of these: 1668915 ( 9.14%) trimmed read pairs available after processing 16585133 (90.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 1 0.00% 21 4 0.00% 22 2 0.00% 23 4 0.00% 24 5 0.00% 25 6 0.00% 26 9 0.00% 27 6 0.00% 28 8 0.00% 29 5 0.00% 30 6 0.00% 31 8 0.00% 32 13 0.00% 33 7 0.00% 34 10 0.00% 35 19 0.00% 36 13 0.00% 37 14 0.00% 38 14 0.00% 39 13 0.00% 40 19 0.00% 41 17 0.00% 42 30 0.00% 43 23 0.00% 44 23 0.00% 45 31 0.00% 46 18 0.00% 47 26 0.00% 48 34 0.00% 49 29 0.00% 50 53 0.00% 51 54 0.00% 52 46 0.00% 53 66 0.00% 54 75 0.00% 55 90 0.00% 56 76 0.00% 57 86 0.00% 58 109 0.00% 59 138 0.00% 60 153 0.00% 61 195 0.00% 62 196 0.00% 63 241 0.00% 64 256 0.00% 65 286 0.00% 66 300 0.00% 67 372 0.00% 68 415 0.00% 69 427 0.00% 70 523 0.00% 71 685 0.00% 72 745 0.00% 73 849 0.00% 74 953 0.01% 75 1000 0.01% 76 1178 0.01% 77 1207 0.01% 78 1421 0.01% 79 1541 0.01% 80 1690 0.01% 81 2002 0.01% 82 2317 0.01% 83 2636 0.01% 84 2932 0.02% 85 3232 0.02% 86 3470 0.02% 87 3990 0.02% 88 4211 0.02% 89 4640 0.03% 90 4961 0.03% 91 5602 0.03% 92 6092 0.03% 93 6771 0.04% 94 7541 0.04% 95 8204 0.04% 96 8647 0.05% 97 9277 0.05% 98 9716 0.05% 99 10373 0.06% 100 10952 0.06% 101 11378 0.06% 102 12509 0.07% 103 13233 0.07% 104 14175 0.08% 105 15333 0.08% 106 15894 0.09% 107 16413 0.09% 108 16942 0.09% 109 17741 0.10% 110 18006 0.10% 111 19084 0.10% 112 19622 0.11% 113 20567 0.11% 114 21767 0.12% 115 22982 0.13% 116 23693 0.13% 117 24355 0.13% 118 24988 0.14% 119 25426 0.14% 120 26262 0.14% 121 26844 0.15% 122 27694 0.15% 123 28507 0.16% 124 30068 0.16% 125 30644 0.17% 126 31968 0.18% 127 32211 0.18% 128 32834 0.18% 129 33289 0.18% 130 34035 0.19% 131 35069 0.19% 132 35507 0.19% 133 36580 0.20% 134 37375 0.20% 135 38544 0.21% 136 39522 0.22% 137 39793 0.22% 138 40584 0.22% 139 42015 0.23% 140 41664 0.23% 141 42806 0.23% 142 43707 0.24% 143 43805 0.24% 144 44546 0.24% 145 45494 0.25% 146 46638 0.26% 147 47032 0.26% 148 48390 0.27% 149 48341 0.26% 150 49626 0.27% 151 16585133 90.86% 18254048 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=24 prefix-density=0.46 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=35.38 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=2.3 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=31 prefix-density=0.73 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.19 sequence-density-rank=22 fanout-score=16.68 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=6.0 sequence=GCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12919330 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:23:02 Started mapping on | Feb 12 19:23:02 Finished on | Feb 12 19:24:49 Mapping speed, Million of reads per hour | 614.15 Number of input reads | 18254048 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17250040 Uniquely mapped reads % | 94.50% Average mapped length | 296.35 Number of splices: Total | 16722453 Number of splices: Annotated (sjdb) | 16354614 Number of splices: GT/AG | 16381328 Number of splices: GC/AG | 274841 Number of splices: AT/AC | 12681 Number of splices: Non-canonical | 53603 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 405928 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 33330 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.98% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 598080 598080 598080 N_multimapping 405928 405928 405928 N_noFeature 644867 17019788 748924 N_ambiguous 240209 1476 113031 UnstrandedReadsAssigned:16364964 PositiveStrandReadsAssigned:228776 NegativeStrandReadsAssigned:16388085 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919330 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919330-trimmed-pair1.fastq SRR12919330-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,254,048 reads, 16,451,710 reads pseudoaligned [quant] estimated average fragment length: 270.889 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR12919330.ke.tsv 34699 SRR12919330.se.tsv 87100 total ==> SRR12919330.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.11 697 24.3762 Potri.005G024800.1.v4.1 1035 765.111 218 17.4195 Potri.004G059700.1.v4.1 961 691.294 190 16.8032 Potri.007G009000.2.v4.1 1416 1146.11 0 0 Potri.003G141000.2.v4.1 2943 2673.11 742.545 16.9828 Potri.016G087400.1.v4.1 270 81.9295 706.617 527.287 Potri.015G069301.1.v4.1 564 311.161 0 0 Potri.010G195200.1.v4.1 1773 1503.11 29 1.17953 Potri.012G127500.1.v4.1 977 707.244 61 5.27307 ==> SRR12919330.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 66 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 319 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 41 SRR12919330 completed mapping pipeline successfully