Starting /dee2/code/volunteer_pipeline.sh SRR12919331 current disk space = 3051237900288 free memory = 988634036 SRR12919331 SRAfilesize 2cb624d83ab7520ba229bbe4e7db67cc SRR12919331.sra SRR12919331.sra file validated SRR12919331 is paired end SRR12919331 is conventional basespace SRR12919331 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919331_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5115 37.0 37.0 37.0 37.0 37.0 2 36.2185 37.0 37.0 37.0 37.0 37.0 3 36.575 37.0 37.0 37.0 37.0 37.0 4 36.58 37.0 37.0 37.0 37.0 37.0 5 36.6755 37.0 37.0 37.0 37.0 37.0 6 36.616 37.0 37.0 37.0 37.0 37.0 7 36.584 37.0 37.0 37.0 37.0 37.0 8 36.636 37.0 37.0 37.0 37.0 37.0 9 36.609 37.0 37.0 37.0 37.0 37.0 10-14 36.6652 37.0 37.0 37.0 37.0 37.0 15-19 36.639300000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.6075 37.0 37.0 37.0 37.0 37.0 25-29 36.591899999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.580200000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.54600000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.550599999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.5247 37.0 37.0 37.0 37.0 37.0 50-54 36.4752 37.0 37.0 37.0 37.0 37.0 55-59 36.4876 37.0 37.0 37.0 37.0 37.0 60-64 36.490300000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.451800000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.388400000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.2796 37.0 37.0 37.0 37.0 37.0 80-84 36.366099999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.2585 37.0 37.0 37.0 37.0 37.0 90-94 36.2223 37.0 37.0 37.0 37.0 37.0 95-99 36.2053 37.0 37.0 37.0 37.0 37.0 100-104 36.2325 37.0 37.0 37.0 37.0 37.0 105-109 36.199200000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.148799999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.11149999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.0798 37.0 37.0 37.0 37.0 37.0 125-129 36.040200000000006 37.0 37.0 37.0 37.0 37.0 130-134 36.0479 37.0 37.0 37.0 37.0 37.0 135-139 35.920100000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.77 37.0 37.0 37.0 37.0 37.0 145-149 35.837399999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.71125 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 0.0 24 1.0 25 0.0 26 5.0 27 5.0 28 9.0 29 18.0 30 19.0 31 27.0 32 33.0 33 66.0 34 115.0 35 329.0 36 2982.0 37 390.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.475 12.25 7.324999999999999 38.95 2 19.758064516129032 13.230846774193546 35.23185483870967 31.779233870967744 3 16.950000000000003 17.724999999999998 28.249999999999996 37.075 4 22.175 25.074999999999996 24.175 28.575 5 22.825 30.15 25.85 21.175 6 20.200000000000003 34.8 23.724999999999998 21.275 7 15.35 26.275 40.325 18.05 8 17.25 26.674999999999997 31.175000000000004 24.9 9 17.65 23.575 36.1 22.675 10-14 19.72 29.34 27.85 23.09 15-19 19.675 28.444999999999997 27.950000000000003 23.93 20-24 19.900000000000002 28.199999999999996 27.785 24.115000000000002 25-29 20.075000000000003 28.42 27.500000000000004 24.005000000000003 30-34 20.105 27.889999999999997 27.665 24.34 35-39 19.900000000000002 28.04 27.725 24.335 40-44 20.72 28.565 27.425 23.29 45-49 20.669999999999998 28.17 27.87 23.29 50-54 20.150000000000002 28.804999999999996 27.084999999999997 23.96 55-59 20.91 28.275 27.450000000000003 23.365 60-64 20.715 27.97 27.615000000000002 23.7 65-69 20.215 28.215 27.565 24.005000000000003 70-74 20.26 28.505000000000003 27.61 23.625 75-79 20.064999999999998 28.689999999999998 27.595 23.65 80-84 20.419999999999998 28.215 27.445000000000004 23.919999999999998 85-89 20.645 27.93 27.650000000000002 23.775 90-94 20.595 28.225 27.750000000000004 23.43 95-99 20.75 28.405 27.544999999999998 23.3 100-104 20.9 28.955 26.57 23.575 105-109 21.005 28.299999999999997 27.71 22.985 110-114 20.68 28.07 27.805000000000003 23.445 115-119 20.775 28.365000000000002 27.435 23.425 120-124 20.685000000000002 28.294999999999998 27.0 24.02 125-129 20.794999999999998 28.325 26.634999999999998 24.245 130-134 20.919999999999998 28.134999999999998 27.325 23.62 135-139 21.23 28.22 27.11 23.44 140-144 21.42 27.950000000000003 26.86 23.77 145-149 21.240000000000002 27.77 27.215 23.775 150-151 21.825 26.700000000000003 27.6875 23.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 1.5 23 2.5 24 3.5 25 3.5 26 5.0 27 7.5 28 10.0 29 19.5 30 20.5 31 16.5 32 25.0 33 37.5 34 55.0 35 70.5 36 82.0 37 105.5 38 126.0 39 165.5 40 191.5 41 189.0 42 211.5 43 234.0 44 255.0 45 258.5 46 255.0 47 249.5 48 243.5 49 226.0 50 191.5 51 157.5 52 119.5 53 107.5 54 90.5 55 67.5 56 56.0 57 41.5 58 25.0 59 17.0 60 16.5 61 11.5 62 9.5 63 6.0 64 2.0 65 2.0 66 2.5 67 1.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.8 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.725 #Duplication Level Percentage of deduplicated Percentage of total 1 89.99721370855391 80.75 2 8.748955140707718 15.7 3 1.0866536639732516 2.9250000000000003 4 0.13931457230426303 0.5 5 0.02786291446085261 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGGAACCTGGTTTTGCCCAGTCCTGTAACCTCCTGTGCTCTGCGAATCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.775 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.3875 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.2 0.0 0.0 0.0 0.0 122-123 3.5125 0.0 0.0 0.0 0.0 124-125 3.8625 0.0 0.0 0.0 0.0 126-127 4.15 0.0 0.0 0.0 0.0 128-129 4.6375 0.0 0.0 0.0 0.0 130-131 4.9 0.0 0.0 0.0 0.0 132-133 5.375 0.0 0.0 0.0 0.0 134-135 5.725 0.0 0.0 0.0 0.0 136-137 6.2125 0.0 0.0 0.0 0.0 138-139 6.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919331 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919331_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2955 37.0 37.0 37.0 37.0 37.0 2 36.095 37.0 37.0 37.0 37.0 37.0 3 36.2865 37.0 37.0 37.0 37.0 37.0 4 36.1855 37.0 37.0 37.0 37.0 37.0 5 36.303 37.0 37.0 37.0 37.0 37.0 6 36.2715 37.0 37.0 37.0 37.0 37.0 7 36.1565 37.0 37.0 37.0 37.0 37.0 8 36.279 37.0 37.0 37.0 37.0 37.0 9 36.217 37.0 37.0 37.0 37.0 37.0 10-14 36.2593 37.0 37.0 37.0 37.0 37.0 15-19 36.2078 37.0 37.0 37.0 37.0 37.0 20-24 36.19840000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.1832 37.0 37.0 37.0 37.0 37.0 30-34 36.144099999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.1347 37.0 37.0 37.0 37.0 37.0 40-44 36.1211 37.0 37.0 37.0 37.0 37.0 45-49 36.0817 37.0 37.0 37.0 37.0 37.0 50-54 36.0098 37.0 37.0 37.0 37.0 37.0 55-59 35.9916 37.0 37.0 37.0 37.0 37.0 60-64 35.94330000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.980199999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.917899999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.8695 37.0 37.0 37.0 37.0 37.0 80-84 35.8826 37.0 37.0 37.0 37.0 37.0 85-89 35.86460000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.7776 37.0 37.0 37.0 37.0 37.0 95-99 35.8313 37.0 37.0 37.0 37.0 37.0 100-104 35.7458 37.0 37.0 37.0 37.0 37.0 105-109 35.736000000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.6929 37.0 37.0 37.0 37.0 37.0 115-119 35.6475 37.0 37.0 37.0 37.0 37.0 120-124 35.5641 37.0 37.0 37.0 37.0 37.0 125-129 35.5828 37.0 37.0 37.0 37.0 37.0 130-134 35.4034 37.0 37.0 37.0 34.6 37.0 135-139 35.262299999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.1447 37.0 37.0 37.0 32.2 37.0 145-149 35.0644 37.0 37.0 37.0 27.4 37.0 150-151 34.88725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 6.0 14 1.0 15 0.0 16 3.0 17 2.0 18 2.0 19 1.0 20 1.0 21 3.0 22 6.0 23 6.0 24 4.0 25 7.0 26 11.0 27 11.0 28 21.0 29 22.0 30 27.0 31 37.0 32 63.0 33 121.0 34 197.0 35 527.0 36 2599.0 37 320.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.849999999999994 24.175 9.675 25.3 2 28.050000000000004 26.275 30.325000000000003 15.35 3 19.950000000000003 28.825 32.15 19.075 4 24.675 33.825 22.5 19.0 5 26.125 34.175 21.925 17.775 6 20.625 37.675 23.65 18.05 7 20.8 23.925 36.6 18.675 8 22.650000000000002 26.900000000000002 26.6 23.849999999999998 9 23.125 24.55 29.75 22.575 10-14 23.0 29.294999999999998 26.57 21.135 15-19 23.035 28.435 27.47 21.060000000000002 20-24 22.145 28.310000000000002 27.98 21.565 25-29 22.78 28.34 27.694999999999997 21.185000000000002 30-34 22.735 28.075 27.96 21.23 35-39 22.795 27.71 28.26 21.235 40-44 23.085 27.915 28.015 20.985 45-49 22.67 27.92 27.93 21.48 50-54 22.915 27.66 27.939999999999998 21.485000000000003 55-59 23.05 27.500000000000004 28.29 21.16 60-64 22.715 27.334999999999997 28.355000000000004 21.595 65-69 23.05 27.955000000000002 27.805000000000003 21.19 70-74 22.905 28.265 27.665 21.165 75-79 22.56 27.685 28.03 21.725 80-84 22.88 28.435 27.11 21.575 85-89 22.865 28.854999999999997 26.915 21.365000000000002 90-94 23.125 28.46 27.310000000000002 21.105 95-99 23.39 28.63 26.924999999999997 21.055 100-104 23.380000000000003 28.360000000000003 27.365000000000002 20.895 105-109 23.880000000000003 27.889999999999997 27.560000000000002 20.669999999999998 110-114 24.13 28.09 27.189999999999998 20.59 115-119 23.695 28.21 27.015 21.08 120-124 24.075 27.860000000000003 27.045 21.02 125-129 24.92 27.229999999999997 27.169999999999998 20.68 130-134 25.330000000000002 28.249999999999996 26.035000000000004 20.385 135-139 24.925 27.13 27.485 20.46 140-144 25.165 27.46 26.665 20.71 145-149 26.029999999999998 27.125 26.640000000000004 20.205000000000002 150-151 26.900000000000002 27.3875 26.1125 19.6 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 1.0 16 1.5 17 1.0 18 1.0 19 1.0 20 3.0 21 3.5 22 1.0 23 2.0 24 3.5 25 5.0 26 6.0 27 6.0 28 8.0 29 10.0 30 16.0 31 22.5 32 30.5 33 42.0 34 51.0 35 55.0 36 76.5 37 104.5 38 129.5 39 176.0 40 204.0 41 213.5 42 244.5 43 269.0 44 261.5 45 254.5 46 241.5 47 229.5 48 233.0 49 220.0 50 191.5 51 148.0 52 106.5 53 87.5 54 76.5 55 69.0 56 54.5 57 40.5 58 30.5 59 22.5 60 16.0 61 7.0 62 3.5 63 2.0 64 3.0 65 2.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.35 #Duplication Level Percentage of deduplicated Percentage of total 1 89.98321208729715 80.4 2 8.477895914941243 15.15 3 1.2311135982092893 3.3000000000000003 4 0.2518186905428092 0.8999999999999999 5 0.05595970900951316 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAGCTGCAGTCTATCAGAGTCATACTTGTGTGGTAGTAGGGGCACGCACA 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.3625 0.0 0.0 0.0 0.0 106-107 1.575 0.0 0.0 0.0 0.0 108-109 1.6749999999999998 0.0 0.0 0.0 0.0 110-111 1.8250000000000002 0.0 0.0 0.0 0.0 112-113 2.2249999999999996 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 2.7249999999999996 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.325 0.0 0.0 0.0 0.0 122-123 3.6375 0.0 0.0 0.0 0.0 124-125 3.9875 0.0 0.0 0.0 0.0 126-127 4.275 0.0 0.0 0.0 0.0 128-129 4.7625 0.0 0.0 0.0 0.0 130-131 5.0375 0.0 0.0 0.0 0.0 132-133 5.525 0.0 0.0 0.0 0.0 134-135 5.875 0.0 0.0 0.0 0.0 136-137 6.375 0.0 0.0 0.0 0.0 138-139 6.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATGAC 10 0.006830828 145.0 6 TTGCTTG 10 0.006830828 145.0 5 >>END_MODULE Read 1028051 spots for SRR12919331.sra Written 1028051 spots for SRR12919331.sra Read 1028051 spots for SRR12919331.sra Written 1028051 spots for SRR12919331.sra Read 1028051 spots for SRR12919331.sra Written 1028051 spots for SRR12919331.sra Read 1028051 spots for SRR12919331.sra Written 1028051 spots for SRR12919331.sra Read 1028051 spots for SRR12919331.sra Written 1028051 spots for SRR12919331.sra Read 1028051 spots for SRR12919331.sra Written 1028051 spots for SRR12919331.sra Read 1028051 spots for SRR12919331.sra Written 1028051 spots for SRR12919331.sra Read 1028051 spots for SRR12919331.sra Written 1028051 spots for SRR12919331.sra Read 1028051 spots for SRR12919331.sra Written 1028051 spots for SRR12919331.sra Read 1028051 spots for SRR12919331.sra Written 1028051 spots for SRR12919331.sra Read 1028051 spots for SRR12919331.sra Written 1028051 spots for SRR12919331.sra Read 1028051 spots for SRR12919331.sra Written 1028051 spots for SRR12919331.sra Read 1028062 spots for SRR12919331.sra Written 1028062 spots for SRR12919331.sra Read 1028051 spots for SRR12919331.sra Written 1028051 spots for SRR12919331.sra Read 1028051 spots for SRR12919331.sra Written 1028051 spots for SRR12919331.sra Read 1028051 spots for SRR12919331.sra Written 1028051 spots for SRR12919331.sra Read 1028051 spots for SRR12919331.sra Written 1028051 spots for SRR12919331.sra Read 1028051 spots for SRR12919331.sra Written 1028051 spots for SRR12919331.sra Read 1028051 spots for SRR12919331.sra Written 1028051 spots for SRR12919331.sra Read 1028051 spots for SRR12919331.sra Written 1028051 spots for SRR12919331.sra SRR ids: ['SRR12919331.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_59yanpxs SRR12919331.sra spots: 20561031 blocks: [[1, 1028051], [1028052, 2056102], [2056103, 3084153], [3084154, 4112204], [4112205, 5140255], [5140256, 6168306], [6168307, 7196357], [7196358, 8224408], [8224409, 9252459], [9252460, 10280510], [10280511, 11308561], [11308562, 12336612], [12336613, 13364663], [13364664, 14392714], [14392715, 15420765], [15420766, 16448816], [16448817, 17476867], [17476868, 18504918], [18504919, 19532969], [19532970, 20561031]] SRR12919331 file size 6965837 SRR12919331 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919331 SRR12919331_1.fastq SRR12919331_2.fastq Input file: SRR12919331_1.fastq Paired file: SRR12919331_2.fastq trimmed: SRR12919331-trimmed-pair1.fastq, SRR12919331-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:39:06 2025 >> started Wed Feb 12 18:39:32 2025 >> done (26.693s) 20561031 read pairs processed; of these: 29 ( 0.00%) short read pairs filtered out after trimming by size control 733 ( 0.00%) empty read pairs filtered out after trimming by size control 20560269 (100.00%) read pairs available; of these: 2182618 (10.62%) trimmed read pairs available after processing 18377651 (89.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 7 0.00% 21 6 0.00% 22 4 0.00% 23 7 0.00% 24 5 0.00% 25 1 0.00% 26 7 0.00% 27 14 0.00% 28 9 0.00% 29 8 0.00% 30 11 0.00% 31 11 0.00% 32 11 0.00% 33 7 0.00% 34 10 0.00% 35 5 0.00% 36 9 0.00% 37 14 0.00% 38 21 0.00% 39 23 0.00% 40 15 0.00% 41 29 0.00% 42 34 0.00% 43 18 0.00% 44 24 0.00% 45 35 0.00% 46 33 0.00% 47 32 0.00% 48 39 0.00% 49 56 0.00% 50 70 0.00% 51 77 0.00% 52 79 0.00% 53 83 0.00% 54 107 0.00% 55 102 0.00% 56 114 0.00% 57 126 0.00% 58 135 0.00% 59 235 0.00% 60 214 0.00% 61 265 0.00% 62 277 0.00% 63 337 0.00% 64 347 0.00% 65 381 0.00% 66 425 0.00% 67 442 0.00% 68 598 0.00% 69 654 0.00% 70 773 0.00% 71 960 0.00% 72 1007 0.00% 73 1248 0.01% 74 1398 0.01% 75 1433 0.01% 76 1552 0.01% 77 1758 0.01% 78 2016 0.01% 79 2231 0.01% 80 2576 0.01% 81 2979 0.01% 82 3450 0.02% 83 3912 0.02% 84 4412 0.02% 85 4699 0.02% 86 5214 0.03% 87 5719 0.03% 88 5965 0.03% 89 6513 0.03% 90 7405 0.04% 91 8073 0.04% 92 8774 0.04% 93 9870 0.05% 94 10696 0.05% 95 11578 0.06% 96 12226 0.06% 97 13009 0.06% 98 13509 0.07% 99 14378 0.07% 100 15212 0.07% 101 16097 0.08% 102 17651 0.09% 103 18855 0.09% 104 20073 0.10% 105 20882 0.10% 106 21906 0.11% 107 22779 0.11% 108 23366 0.11% 109 24278 0.12% 110 24908 0.12% 111 26011 0.13% 112 27424 0.13% 113 28352 0.14% 114 29619 0.14% 115 31226 0.15% 116 32067 0.16% 117 33014 0.16% 118 33717 0.16% 119 34233 0.17% 120 35286 0.17% 121 36049 0.18% 122 36223 0.18% 123 37789 0.18% 124 39292 0.19% 125 40160 0.20% 126 41251 0.20% 127 42907 0.21% 128 42941 0.21% 129 43587 0.21% 130 44084 0.21% 131 44970 0.22% 132 45843 0.22% 133 47184 0.23% 134 47529 0.23% 135 48898 0.24% 136 50478 0.25% 137 50813 0.25% 138 51642 0.25% 139 53023 0.26% 140 52669 0.26% 141 53165 0.26% 142 54201 0.26% 143 55069 0.27% 144 56656 0.28% 145 57227 0.28% 146 57967 0.28% 147 58884 0.29% 148 60280 0.29% 149 59384 0.29% 150 60584 0.29% 151 18377651 89.38% 20560269 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=21 prefix-density=0.66 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=48.08 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=2.2 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=21 prefix-density=0.90 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=32.67 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR12919331 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:40:48 Started mapping on | Feb 12 18:40:48 Finished on | Feb 12 18:43:06 Mapping speed, Million of reads per hour | 536.35 Number of input reads | 20560269 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19403908 Uniquely mapped reads % | 94.38% Average mapped length | 295.52 Number of splices: Total | 19069610 Number of splices: Annotated (sjdb) | 18655551 Number of splices: GT/AG | 18662172 Number of splices: GC/AG | 338677 Number of splices: AT/AC | 13547 Number of splices: Non-canonical | 55214 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 437754 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 38098 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.19% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 718607 718607 718607 N_multimapping 437754 437754 437754 N_noFeature 702968 19145229 814937 N_ambiguous 272105 1330 124484 UnstrandedReadsAssigned:18428835 PositiveStrandReadsAssigned:257349 NegativeStrandReadsAssigned:18464487 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919331 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919331-trimmed-pair1.fastq SRR12919331-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,560,269 reads, 18,521,794 reads pseudoaligned [quant] estimated average fragment length: 267.251 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 981 rounds 52401 SRR12919331.ke.tsv 34699 SRR12919331.se.tsv 87100 total ==> SRR12919331.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.75 605 18.618 Potri.005G024800.1.v4.1 1035 768.749 193 13.5339 Potri.004G059700.1.v4.1 961 695.019 209 16.2106 Potri.007G009000.2.v4.1 1416 1149.75 0 0 Potri.003G141000.2.v4.1 2943 2676.75 869 17.5009 Potri.016G087400.1.v4.1 270 85.2189 906 573.115 Potri.015G069301.1.v4.1 564 316.687 0 0 Potri.010G195200.1.v4.1 1773 1506.75 7 0.250442 Potri.012G127500.1.v4.1 977 710.876 109 8.26575 ==> SRR12919331.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 198 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 198 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 8 SRR12919331 completed mapping pipeline successfully