Starting /dee2/code/volunteer_pipeline.sh SRR12919332 current disk space = 3051232116736 free memory = 1446309452 SRR12919332 SRAfilesize 81c89f4a54d22d7b5872049744f20902 SRR12919332.sra SRR12919332.sra file validated SRR12919332 is paired end SRR12919332 is conventional basespace SRR12919332 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919332_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5935 37.0 37.0 37.0 37.0 37.0 2 36.1405 37.0 37.0 37.0 37.0 37.0 3 36.5675 37.0 37.0 37.0 37.0 37.0 4 36.68 37.0 37.0 37.0 37.0 37.0 5 36.68 37.0 37.0 37.0 37.0 37.0 6 36.71 37.0 37.0 37.0 37.0 37.0 7 36.632 37.0 37.0 37.0 37.0 37.0 8 36.6475 37.0 37.0 37.0 37.0 37.0 9 36.627 37.0 37.0 37.0 37.0 37.0 10-14 36.683800000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.6731 37.0 37.0 37.0 37.0 37.0 20-24 36.602 37.0 37.0 37.0 37.0 37.0 25-29 36.5471 37.0 37.0 37.0 37.0 37.0 30-34 36.549099999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.5458 37.0 37.0 37.0 37.0 37.0 40-44 36.5687 37.0 37.0 37.0 37.0 37.0 45-49 36.5403 37.0 37.0 37.0 37.0 37.0 50-54 36.48480000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.4696 37.0 37.0 37.0 37.0 37.0 60-64 36.4461 37.0 37.0 37.0 37.0 37.0 65-69 36.4099 37.0 37.0 37.0 37.0 37.0 70-74 36.3698 37.0 37.0 37.0 37.0 37.0 75-79 36.3275 37.0 37.0 37.0 37.0 37.0 80-84 36.3529 37.0 37.0 37.0 37.0 37.0 85-89 36.258500000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.2757 37.0 37.0 37.0 37.0 37.0 95-99 36.2428 37.0 37.0 37.0 37.0 37.0 100-104 36.2164 37.0 37.0 37.0 37.0 37.0 105-109 36.1831 37.0 37.0 37.0 37.0 37.0 110-114 36.1261 37.0 37.0 37.0 37.0 37.0 115-119 36.139599999999994 37.0 37.0 37.0 37.0 37.0 120-124 36.112199999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.08820000000001 37.0 37.0 37.0 37.0 37.0 130-134 36.0048 37.0 37.0 37.0 37.0 37.0 135-139 35.895900000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.9147 37.0 37.0 37.0 37.0 37.0 145-149 35.8404 37.0 37.0 37.0 37.0 37.0 150-151 35.69175 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 1.0 25 2.0 26 3.0 27 3.0 28 10.0 29 14.0 30 18.0 31 25.0 32 40.0 33 73.0 34 117.0 35 302.0 36 2967.0 37 424.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.4 12.5 6.800000000000001 44.3 2 19.242424242424242 12.676767676767678 38.51010101010101 29.57070707070707 3 16.375 16.625 28.475 38.525 4 21.175 24.875 23.9 30.049999999999997 5 23.0 29.325000000000003 24.775 22.900000000000002 6 20.1 32.85 24.5 22.55 7 15.8 24.85 41.65 17.7 8 16.900000000000002 27.224999999999998 32.275 23.599999999999998 9 17.275 24.9 34.5 23.325000000000003 10-14 19.355 29.75 27.74 23.155 15-19 19.66 27.83 28.060000000000002 24.45 20-24 19.375 29.099999999999998 27.685 23.84 25-29 19.825 28.57 27.77 23.835 30-34 19.189999999999998 28.79 27.66 24.36 35-39 19.52 28.310000000000002 27.68 24.490000000000002 40-44 19.865 28.28 28.265 23.59 45-49 19.685 28.48 27.82 24.015 50-54 19.525000000000002 28.98 27.875 23.62 55-59 19.814999999999998 27.965 27.975 24.245 60-64 20.035 28.475 27.88 23.61 65-69 19.875 29.080000000000002 27.395000000000003 23.65 70-74 20.095 28.52 27.650000000000002 23.735 75-79 20.185 27.785 28.01 24.02 80-84 19.78 28.610000000000003 27.675 23.935000000000002 85-89 20.035 28.785 27.51 23.669999999999998 90-94 20.27 28.015 27.72 23.995 95-99 20.015 28.29 28.294999999999998 23.400000000000002 100-104 20.235 28.12 28.134999999999998 23.51 105-109 20.115 27.685 27.715 24.485 110-114 19.905 28.65 27.04 24.404999999999998 115-119 20.95 29.085 26.424999999999997 23.54 120-124 20.28 27.935 27.815 23.97 125-129 20.595 28.37 27.215 23.82 130-134 20.905 28.955 26.340000000000003 23.799999999999997 135-139 20.875 28.38 26.805 23.94 140-144 20.845 28.144999999999996 26.905 24.104999999999997 145-149 21.065 28.455000000000002 27.715 22.765 150-151 21.0 28.000000000000004 26.450000000000003 24.55 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 1.0 22 0.5 23 2.0 24 3.0 25 5.0 26 4.0 27 6.5 28 10.5 29 15.5 30 23.0 31 27.5 32 34.5 33 43.0 34 60.5 35 78.5 36 90.0 37 93.5 38 117.5 39 147.0 40 180.0 41 239.5 42 257.5 43 257.5 44 271.0 45 263.5 46 238.5 47 237.0 48 235.0 49 221.5 50 172.5 51 133.5 52 122.5 53 94.5 54 78.5 55 60.5 56 42.5 57 31.5 58 27.5 59 23.0 60 16.0 61 8.5 62 6.0 63 3.0 64 4.0 65 3.0 66 0.5 67 1.5 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.0 #Duplication Level Percentage of deduplicated Percentage of total 1 90.44444444444444 81.39999999999999 2 8.222222222222223 14.799999999999999 3 1.1111111111111112 3.0 4 0.2222222222222222 0.8 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.7999999999999998 0.0 0.0 0.0 0.0 114-115 1.975 0.0 0.0 0.0 0.0 116-117 2.2375 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 3.05 0.0 0.0 0.0 0.0 122-123 3.475 0.0 0.0 0.0 0.0 124-125 3.8375000000000004 0.0 0.0 0.0 0.0 126-127 4.1625 0.0 0.0 0.0 0.0 128-129 4.550000000000001 0.0 0.0 0.0 0.0 130-131 5.0375 0.0 0.0 0.0 0.0 132-133 5.45 0.0 0.0 0.0 0.0 134-135 5.8 0.0 0.0 0.0 0.0 136-137 6.387499999999999 0.0 0.0 0.0 0.0 138-139 6.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCCGTT 10 0.0068343505 144.975 8 CTGATGA 10 0.0068343505 144.975 4 CCCGTTG 10 0.0068343505 144.975 9 TACCCGT 10 0.0068343505 144.975 7 ATACCCG 10 0.0068343505 144.975 6 >>END_MODULE SRR12919332 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919332_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4255 37.0 37.0 37.0 37.0 37.0 2 36.2775 37.0 37.0 37.0 37.0 37.0 3 36.333 37.0 37.0 37.0 37.0 37.0 4 36.3405 37.0 37.0 37.0 37.0 37.0 5 36.4165 37.0 37.0 37.0 37.0 37.0 6 36.4905 37.0 37.0 37.0 37.0 37.0 7 36.363 37.0 37.0 37.0 37.0 37.0 8 36.441 37.0 37.0 37.0 37.0 37.0 9 36.38 37.0 37.0 37.0 37.0 37.0 10-14 36.4336 37.0 37.0 37.0 37.0 37.0 15-19 36.407000000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.3899 37.0 37.0 37.0 37.0 37.0 25-29 36.316500000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.284000000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.2907 37.0 37.0 37.0 37.0 37.0 40-44 36.2264 37.0 37.0 37.0 37.0 37.0 45-49 36.2078 37.0 37.0 37.0 37.0 37.0 50-54 36.113299999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.1195 37.0 37.0 37.0 37.0 37.0 60-64 36.132600000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.0881 37.0 37.0 37.0 37.0 37.0 70-74 36.0323 37.0 37.0 37.0 37.0 37.0 75-79 36.0058 37.0 37.0 37.0 37.0 37.0 80-84 35.969100000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.014300000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.9254 37.0 37.0 37.0 37.0 37.0 95-99 35.8617 37.0 37.0 37.0 37.0 37.0 100-104 35.804500000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.78 37.0 37.0 37.0 37.0 37.0 110-114 35.842 37.0 37.0 37.0 37.0 37.0 115-119 35.8094 37.0 37.0 37.0 37.0 37.0 120-124 35.7013 37.0 37.0 37.0 37.0 37.0 125-129 35.71079999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.5698 37.0 37.0 37.0 37.0 37.0 135-139 35.511900000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.4591 37.0 37.0 37.0 37.0 37.0 145-149 35.352999999999994 37.0 37.0 37.0 32.2 37.0 150-151 35.197 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 2.0 15 1.0 16 1.0 17 1.0 18 1.0 19 4.0 20 2.0 21 3.0 22 3.0 23 4.0 24 2.0 25 8.0 26 4.0 27 12.0 28 13.0 29 19.0 30 22.0 31 41.0 32 45.0 33 81.0 34 196.0 35 499.0 36 2724.0 37 310.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.1 24.75 10.25 28.9 2 26.275 25.35 33.025 15.35 3 19.175 28.050000000000004 32.95 19.825 4 22.3 34.2 24.65 18.85 5 25.4 35.3 22.975 16.325 6 21.575 39.275 22.85 16.3 7 20.05 22.975 39.425 17.549999999999997 8 21.125 25.324999999999996 28.4 25.15 9 20.724999999999998 25.474999999999998 29.95 23.849999999999998 10-14 23.32 29.005 27.125 20.549999999999997 15-19 23.64 28.15 27.415 20.794999999999998 20-24 23.724999999999998 28.38 27.66 20.235 25-29 23.035 28.585 27.450000000000003 20.93 30-34 22.770000000000003 28.965000000000003 27.045 21.22 35-39 22.89 28.28 27.644999999999996 21.185000000000002 40-44 23.244999999999997 27.66 28.244999999999997 20.849999999999998 45-49 23.605 27.650000000000002 27.96 20.785 50-54 24.0 27.73 27.48 20.79 55-59 23.105 27.315 28.685 20.895 60-64 23.9 27.205000000000002 28.634999999999998 20.26 65-69 23.185 27.725 27.944999999999997 21.145 70-74 23.56 28.305000000000003 27.99 20.145 75-79 24.104999999999997 27.67 28.215 20.01 80-84 23.455000000000002 28.134999999999998 27.73 20.68 85-89 24.01 27.67 28.03 20.29 90-94 23.885 27.71 28.115000000000002 20.29 95-99 24.2 28.275 27.815 19.71 100-104 24.275 28.52 27.175 20.03 105-109 24.115000000000002 28.144999999999996 27.700000000000003 20.04 110-114 23.54 27.98 27.884999999999998 20.595 115-119 24.240000000000002 28.54 26.99 20.23 120-124 24.65 27.22 27.87 20.26 125-129 24.610000000000003 28.435 27.02 19.935 130-134 25.03 27.875 27.384999999999998 19.71 135-139 25.275 27.435 27.515 19.775000000000002 140-144 25.185000000000002 28.035 27.375 19.405 145-149 25.765 28.375 26.32 19.54 150-151 26.3125 28.1375 26.987499999999997 18.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 0.0 23 1.0 24 1.5 25 3.0 26 4.5 27 5.5 28 11.5 29 17.0 30 19.0 31 20.0 32 29.5 33 47.5 34 54.0 35 54.5 36 72.5 37 104.0 38 152.5 39 178.5 40 194.5 41 234.0 42 257.5 43 269.5 44 271.5 45 274.0 46 262.5 47 246.0 48 232.5 49 199.5 50 161.5 51 134.0 52 104.0 53 85.0 54 77.5 55 53.0 56 40.5 57 33.0 58 19.5 59 16.5 60 11.0 61 5.5 62 6.5 63 5.0 64 3.5 65 2.0 66 0.5 67 0.0 68 1.0 69 1.0 70 0.5 71 1.5 72 1.5 73 0.5 74 0.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.5 80 1.0 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.075 #Duplication Level Percentage of deduplicated Percentage of total 1 90.61892867055231 81.625 2 8.076602830974188 14.549999999999999 3 1.1101859561476548 3.0 4 0.16652789342214822 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02775464890369137 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.8250000000000002 0.0 0.0 0.0 0.0 114-115 2.0 0.0 0.0 0.0 0.0 116-117 2.2625 0.0 0.0 0.0 0.0 118-119 2.65 0.0 0.0 0.0 0.0 120-121 3.1 0.0 0.0 0.0 0.0 122-123 3.5375 0.0 0.0 0.0 0.0 124-125 3.9125 0.0 0.0 0.0 0.0 126-127 4.237500000000001 0.0 0.0 0.0 0.0 128-129 4.6 0.0 0.0 0.0 0.0 130-131 5.05 0.0 0.0 0.0 0.0 132-133 5.45 0.0 0.0 0.0 0.0 134-135 5.8 0.0 0.0 0.0 0.0 136-137 6.387499999999999 0.0 0.0 0.0 0.0 138-139 6.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCCAG 10 0.006830828 145.0 145 AACCCCT 10 0.006830828 145.0 6 GTTCAAT 10 0.006830828 145.0 1 ATGGAAC 10 0.006830828 145.0 2 GAACCCC 10 0.006830828 145.0 5 ACCCCTA 10 0.006830828 145.0 7 CCCCTAT 10 0.006830828 145.0 8 CATGGAA 10 0.006830828 145.0 1 GGAACCC 10 0.006830828 145.0 4 CCCTATA 10 0.006830828 145.0 9 >>END_MODULE Read 1222932 spots for SRR12919332.sra Written 1222932 spots for SRR12919332.sra Read 1222932 spots for SRR12919332.sra Written 1222932 spots for SRR12919332.sra Read 1222932 spots for SRR12919332.sra Written 1222932 spots for SRR12919332.sra Read 1222932 spots for SRR12919332.sra Written 1222932 spots for SRR12919332.sra Read 1222932 spots for SRR12919332.sra Written 1222932 spots for SRR12919332.sra Read 1222932 spots for SRR12919332.sra Written 1222932 spots for SRR12919332.sra Read 1222932 spots for SRR12919332.sra Written 1222932 spots for SRR12919332.sra Read 1222932 spots for SRR12919332.sra Written 1222932 spots for SRR12919332.sra Read 1222932 spots for SRR12919332.sra Written 1222932 spots for SRR12919332.sra Read 1222932 spots for SRR12919332.sra Written 1222932 spots for SRR12919332.sra Read 1222932 spots for SRR12919332.sra Written 1222932 spots for SRR12919332.sra Read 1222932 spots for SRR12919332.sra Written 1222932 spots for SRR12919332.sra Read 1222932 spots for SRR12919332.sra Written 1222932 spots for SRR12919332.sra Read 1222932 spots for SRR12919332.sra Written 1222932 spots for SRR12919332.sra Read 1222932 spots for SRR12919332.sra Written 1222932 spots for SRR12919332.sra Read 1222932 spots for SRR12919332.sra Written 1222932 spots for SRR12919332.sra Read 1222932 spots for SRR12919332.sra Written 1222932 spots for SRR12919332.sra Read 1222938 spots for SRR12919332.sra Written 1222938 spots for SRR12919332.sra Read 1222932 spots for SRR12919332.sra Written 1222932 spots for SRR12919332.sra Read 1222932 spots for SRR12919332.sra Written 1222932 spots for SRR12919332.sra SRR ids: ['SRR12919332.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2kggwm31 SRR12919332.sra spots: 24458646 blocks: [[1, 1222932], [1222933, 2445864], [2445865, 3668796], [3668797, 4891728], [4891729, 6114660], [6114661, 7337592], [7337593, 8560524], [8560525, 9783456], [9783457, 11006388], [11006389, 12229320], [12229321, 13452252], [13452253, 14675184], [14675185, 15898116], [15898117, 17121048], [17121049, 18343980], [18343981, 19566912], [19566913, 20789844], [20789845, 22012776], [22012777, 23235708], [23235709, 24458646]] SRR12919332 file size 8290417 SRR12919332 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919332 SRR12919332_1.fastq SRR12919332_2.fastq Input file: SRR12919332_1.fastq Paired file: SRR12919332_2.fastq trimmed: SRR12919332-trimmed-pair1.fastq, SRR12919332-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:39:08 2025 >> started Wed Feb 12 18:39:35 2025 >> done (27.045s) 24458646 read pairs processed; of these: 34 ( 0.00%) short read pairs filtered out after trimming by size control 125 ( 0.00%) empty read pairs filtered out after trimming by size control 24458487 (100.00%) read pairs available; of these: 2661198 (10.88%) trimmed read pairs available after processing 21797289 (89.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 7 0.00% 20 4 0.00% 21 4 0.00% 22 7 0.00% 23 4 0.00% 24 7 0.00% 25 9 0.00% 26 6 0.00% 27 15 0.00% 28 12 0.00% 29 11 0.00% 30 15 0.00% 31 14 0.00% 32 19 0.00% 33 23 0.00% 34 13 0.00% 35 19 0.00% 36 21 0.00% 37 24 0.00% 38 21 0.00% 39 32 0.00% 40 24 0.00% 41 27 0.00% 42 36 0.00% 43 29 0.00% 44 35 0.00% 45 31 0.00% 46 37 0.00% 47 47 0.00% 48 62 0.00% 49 56 0.00% 50 77 0.00% 51 68 0.00% 52 83 0.00% 53 69 0.00% 54 88 0.00% 55 83 0.00% 56 108 0.00% 57 134 0.00% 58 136 0.00% 59 192 0.00% 60 214 0.00% 61 240 0.00% 62 341 0.00% 63 290 0.00% 64 410 0.00% 65 386 0.00% 66 426 0.00% 67 502 0.00% 68 546 0.00% 69 670 0.00% 70 729 0.00% 71 931 0.00% 72 1075 0.00% 73 1335 0.01% 74 1422 0.01% 75 1498 0.01% 76 1824 0.01% 77 1853 0.01% 78 2163 0.01% 79 2465 0.01% 80 2907 0.01% 81 3318 0.01% 82 3864 0.02% 83 4414 0.02% 84 4925 0.02% 85 5529 0.02% 86 5700 0.02% 87 6294 0.03% 88 6821 0.03% 89 7421 0.03% 90 8176 0.03% 91 9372 0.04% 92 10277 0.04% 93 11257 0.05% 94 12843 0.05% 95 13415 0.05% 96 14404 0.06% 97 15257 0.06% 98 15544 0.06% 99 17118 0.07% 100 17920 0.07% 101 19113 0.08% 102 20744 0.08% 103 22249 0.09% 104 23936 0.10% 105 25132 0.10% 106 26427 0.11% 107 26828 0.11% 108 28049 0.11% 109 29100 0.12% 110 29204 0.12% 111 31023 0.13% 112 32754 0.13% 113 34184 0.14% 114 35936 0.15% 115 37867 0.15% 116 38945 0.16% 117 39739 0.16% 118 41033 0.17% 119 41384 0.17% 120 42422 0.17% 121 43849 0.18% 122 44188 0.18% 123 46745 0.19% 124 48433 0.20% 125 50196 0.21% 126 51674 0.21% 127 52335 0.21% 128 52962 0.22% 129 53154 0.22% 130 54353 0.22% 131 55118 0.23% 132 56557 0.23% 133 58325 0.24% 134 59528 0.24% 135 61176 0.25% 136 62561 0.26% 137 63332 0.26% 138 63458 0.26% 139 64368 0.26% 140 64259 0.26% 141 65703 0.27% 142 66947 0.27% 143 67360 0.28% 144 71344 0.29% 145 71905 0.29% 146 73292 0.30% 147 73437 0.30% 148 73273 0.30% 149 72957 0.30% 150 74534 0.30% 151 21797289 89.12% 24458487 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=24 prefix-density=0.66 prefix-fanout=2.0 sequence=GCTTTATTTCGAACGTAAAAATCAGAAGTAGAACTCTTCGATCCAAAGACAACTTTGGGTTTTCCGGGCAGGCATTCATCAGAATAGCATTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=17 fanout-score=17.02 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=5.5 sequence=TTTCTCAATTTG criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=29 prefix-density=0.78 prefix-fanout=2.0 sequence=CATAGAATGTCTACAGTCAATTTGGCAGCACTGCTGTTGCTTGGGCTGCTGCTGGTTATGCCACAGCAGTCCATGCAAGCGAGTTTGATAGACCCCATTGCTGAAATCGAGAGAAGCAACTGCAAAATCGCACACCTTCGCTTAGGGCTTGTTTTTAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=382.59 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=17.9 sequence=AGAGAAAAGATAAGCTAGGCAAGATGGTTTTACTAGACAAGATGTGGGATGATGTTGTTGCTGGACCTCAGCCAGAACGTGGCCTTGGCAAGCTTAGAAAGATCAGCACCAGACCACTTAACATCAAAGATATTGACGTCGGAGAGGGGAGCAGTCCTGTTAATAAGTTTCAGAGGTCCATGACTATGCCAGGAACTCCAGGGACACCGACGACACCAGTGACCCCTACAACCCCAGTGTCGGCGCGTAGCAATGTTTGGAGGAGCGTGTTCCACCCTGGTAGCAACCTTGCTACTAAGAATATTGGTGCTCATGTTTTTGACAAGCCACAGCCTAACACACCCACTGTCTATGACTGGATGTACAGTGGAGAGACGAAGAGCGAGCATCGTTGATGAGGTTGCCTTCAACCAAGGTTGCCCATGTAAATACGTACTGTGTTTTGTTTTTCAGTACTCATCTGCAATATGTCTCTTGTTGTTATGGTTCTACGGTTCTACCGTGCCTGGAA SRR12919332 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:40:46 Started mapping on | Feb 12 18:40:47 Finished on | Feb 12 18:43:49 Mapping speed, Million of reads per hour | 483.79 Number of input reads | 24458487 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 22899416 Uniquely mapped reads % | 93.63% Average mapped length | 295.57 Number of splices: Total | 22039984 Number of splices: Annotated (sjdb) | 21555704 Number of splices: GT/AG | 21658239 Number of splices: GC/AG | 297571 Number of splices: AT/AC | 23537 Number of splices: Non-canonical | 60637 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.02 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 679541 % of reads mapped to multiple loci | 2.78% Number of reads mapped to too many loci | 59754 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.26% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 879530 879530 879530 N_multimapping 679541 679541 679541 N_noFeature 809719 22648805 928880 N_ambiguous 263385 973 131471 UnstrandedReadsAssigned:21826312 PositiveStrandReadsAssigned:249638 NegativeStrandReadsAssigned:21839065 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919332 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919332-trimmed-pair1.fastq SRR12919332-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,458,487 reads, 21,838,713 reads pseudoaligned [quant] estimated average fragment length: 260.497 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52401 SRR12919332.ke.tsv 34699 SRR12919332.se.tsv 87100 total ==> SRR12919332.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.5 1282 33.0831 Potri.005G024800.1.v4.1 1035 775.503 480 28.0879 Potri.004G059700.1.v4.1 961 701.591 32 2.0698 Potri.007G009000.2.v4.1 1416 1156.5 0 0 Potri.003G141000.2.v4.1 2943 2683.5 693 11.7191 Potri.016G087400.1.v4.1 270 86.0069 1640 865.311 Potri.015G069301.1.v4.1 564 318.083 0 0 Potri.010G195200.1.v4.1 1773 1513.5 134 4.01775 Potri.012G127500.1.v4.1 977 717.564 13471 851.924 ==> SRR12919332.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 201 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 253 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR12919332 completed mapping pipeline successfully