Starting /dee2/code/volunteer_pipeline.sh SRR12919333 current disk space = 3051238879232 free memory = 1468539624 SRR12919333 SRAfilesize 2d81c56cca23b34cca4480311d045288 SRR12919333.sra SRR12919333.sra file validated SRR12919333 is paired end SRR12919333 is conventional basespace SRR12919333 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919333_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5115 37.0 37.0 37.0 37.0 37.0 2 36.18725 37.0 37.0 37.0 37.0 37.0 3 36.589 37.0 37.0 37.0 37.0 37.0 4 36.5955 37.0 37.0 37.0 37.0 37.0 5 36.6695 37.0 37.0 37.0 37.0 37.0 6 36.6395 37.0 37.0 37.0 37.0 37.0 7 36.5375 37.0 37.0 37.0 37.0 37.0 8 36.632 37.0 37.0 37.0 37.0 37.0 9 36.558 37.0 37.0 37.0 37.0 37.0 10-14 36.612300000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.588499999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5794 37.0 37.0 37.0 37.0 37.0 25-29 36.5102 37.0 37.0 37.0 37.0 37.0 30-34 36.498400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.50019999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.488800000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.4562 37.0 37.0 37.0 37.0 37.0 50-54 36.4313 37.0 37.0 37.0 37.0 37.0 55-59 36.475 37.0 37.0 37.0 37.0 37.0 60-64 36.387100000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.361000000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.366499999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.291 37.0 37.0 37.0 37.0 37.0 80-84 36.3243 37.0 37.0 37.0 37.0 37.0 85-89 36.219100000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.177499999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.176700000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1832 37.0 37.0 37.0 37.0 37.0 105-109 36.110600000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.1164 37.0 37.0 37.0 37.0 37.0 115-119 36.0397 37.0 37.0 37.0 37.0 37.0 120-124 36.02120000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.9042 37.0 37.0 37.0 37.0 37.0 130-134 35.8673 37.0 37.0 37.0 37.0 37.0 135-139 35.891000000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.7725 37.0 37.0 37.0 37.0 37.0 145-149 35.8147 37.0 37.0 37.0 37.0 37.0 150-151 35.62825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.0 27 9.0 28 14.0 29 9.0 30 23.0 31 39.0 32 56.0 33 67.0 34 125.0 35 318.0 36 2966.0 37 370.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.574999999999996 12.225 6.8500000000000005 43.35 2 19.117276166456495 13.568726355611602 37.78058007566204 29.533417402269862 3 17.7 17.299999999999997 29.125 35.875 4 22.125 25.5 24.775 27.6 5 22.675 30.85 24.65 21.825 6 21.25 35.225 22.625 20.9 7 14.975 27.6 41.05 16.375 8 17.8 26.55 32.05 23.599999999999998 9 17.65 25.05 34.725 22.575 10-14 19.46 29.945 27.894999999999996 22.7 15-19 19.765 28.01 28.285 23.94 20-24 19.555 28.02 28.54 23.885 25-29 19.509999999999998 28.389999999999997 28.07 24.03 30-34 19.875 28.595 27.715 23.815 35-39 20.23 28.57 27.46 23.74 40-44 19.735 28.854999999999997 27.325 24.085 45-49 20.57 28.115000000000002 27.16 24.154999999999998 50-54 20.1 28.13 27.860000000000003 23.91 55-59 19.675 28.84 27.310000000000002 24.175 60-64 20.14 28.08 27.63 24.15 65-69 19.765 29.18 27.134999999999998 23.919999999999998 70-74 20.075000000000003 28.634999999999998 27.775 23.515 75-79 19.905 28.58 27.325 24.19 80-84 20.14 28.17 27.505000000000003 24.185000000000002 85-89 20.055 28.675 27.41 23.86 90-94 20.294999999999998 28.084999999999997 27.675 23.945 95-99 19.98 27.474999999999998 28.875 23.669999999999998 100-104 20.064999999999998 28.610000000000003 27.51 23.815 105-109 19.985 28.565 27.605 23.845 110-114 20.255000000000003 28.035 28.09 23.62 115-119 20.44 28.895 26.97 23.695 120-124 20.49 28.575 27.42 23.515 125-129 20.315 27.825 28.055000000000003 23.805 130-134 20.14 28.449999999999996 27.515 23.895 135-139 20.91 27.985 27.525 23.580000000000002 140-144 20.3 28.225 27.26 24.215 145-149 20.46 28.449999999999996 26.71 24.38 150-151 20.7625 28.175 27.462500000000002 23.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.5 24 4.0 25 4.5 26 3.5 27 6.0 28 10.0 29 15.5 30 22.0 31 22.5 32 26.5 33 39.0 34 57.0 35 66.0 36 72.5 37 109.5 38 141.5 39 163.0 40 195.0 41 219.0 42 230.0 43 249.5 44 270.5 45 280.5 46 290.0 47 256.0 48 217.0 49 198.5 50 174.5 51 147.0 52 110.5 53 96.0 54 78.5 55 50.0 56 36.5 57 26.5 58 23.0 59 17.0 60 12.5 61 11.0 62 9.0 63 8.5 64 6.0 65 4.0 66 3.0 67 3.0 68 2.0 69 2.0 70 1.0 71 0.0 72 1.0 73 2.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.8750000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.83885209713024 82.3 2 8.140176600441501 14.75 3 0.8278145695364238 2.25 4 0.19315673289183224 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.9624999999999999 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.2374999999999998 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.5750000000000002 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 1.975 0.0 0.0 0.0 0.0 116-117 2.2375 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.6875 0.0 0.0 0.0 0.0 122-123 2.95 0.0 0.0 0.0 0.0 124-125 3.2125 0.0 0.0 0.0 0.0 126-127 3.6624999999999996 0.0 0.0 0.0 0.0 128-129 3.9125 0.0 0.0 0.0 0.0 130-131 4.25 0.0 0.0 0.0 0.0 132-133 4.6625 0.0 0.0 0.0 0.0 134-135 5.0125 0.0 0.0 0.0 0.0 136-137 5.4625 0.0 0.0 0.0 0.0 138-139 6.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGAAAA 10 0.0065789125 146.81013 1 GAAAAGC 10 0.0068343505 144.975 3 AAAGCAC 10 0.0068343505 144.975 5 >>END_MODULE SRR12919333 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919333_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2035 37.0 37.0 37.0 37.0 37.0 2 36.2135 37.0 37.0 37.0 37.0 37.0 3 36.2805 37.0 37.0 37.0 37.0 37.0 4 36.34 37.0 37.0 37.0 37.0 37.0 5 36.4045 37.0 37.0 37.0 37.0 37.0 6 36.3415 37.0 37.0 37.0 37.0 37.0 7 36.354 37.0 37.0 37.0 37.0 37.0 8 36.354 37.0 37.0 37.0 37.0 37.0 9 36.3965 37.0 37.0 37.0 37.0 37.0 10-14 36.355900000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.318 37.0 37.0 37.0 37.0 37.0 20-24 36.302499999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.276799999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.2715 37.0 37.0 37.0 37.0 37.0 35-39 36.197799999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.144 37.0 37.0 37.0 37.0 37.0 45-49 36.225 37.0 37.0 37.0 37.0 37.0 50-54 36.0897 37.0 37.0 37.0 37.0 37.0 55-59 36.0943 37.0 37.0 37.0 37.0 37.0 60-64 36.0429 37.0 37.0 37.0 37.0 37.0 65-69 36.009100000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.003 37.0 37.0 37.0 37.0 37.0 75-79 35.948899999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.988299999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.943799999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.856199999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.870400000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.7956 37.0 37.0 37.0 37.0 37.0 105-109 35.757999999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.7992 37.0 37.0 37.0 37.0 37.0 115-119 35.6813 37.0 37.0 37.0 37.0 37.0 120-124 35.6274 37.0 37.0 37.0 37.0 37.0 125-129 35.585699999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.5486 37.0 37.0 37.0 37.0 37.0 135-139 35.4349 37.0 37.0 37.0 37.0 37.0 140-144 35.3335 37.0 37.0 37.0 37.0 37.0 145-149 35.1993 37.0 37.0 37.0 32.2 37.0 150-151 35.0445 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 5.0 15 0.0 16 2.0 17 2.0 18 1.0 19 1.0 20 2.0 21 3.0 22 3.0 23 6.0 24 8.0 25 2.0 26 9.0 27 15.0 28 16.0 29 20.0 30 24.0 31 31.0 32 59.0 33 103.0 34 199.0 35 478.0 36 2687.0 37 323.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.275 25.424999999999997 8.975 27.325 2 27.800000000000004 26.05 31.525 14.625 3 20.674999999999997 28.050000000000004 32.025 19.25 4 23.200000000000003 34.725 23.775 18.3 5 24.7 37.05 20.825 17.424999999999997 6 19.7 41.199999999999996 21.775 17.325 7 21.25 23.9 35.425000000000004 19.425 8 22.375 26.075 28.999999999999996 22.55 9 22.45 25.525 30.075000000000003 21.95 10-14 22.81 29.705 26.715 20.77 15-19 23.974999999999998 28.025 27.315 20.685000000000002 20-24 23.64 28.689999999999998 27.055 20.615 25-29 23.335 28.945 27.05 20.669999999999998 30-34 23.25 28.744999999999997 27.46 20.544999999999998 35-39 23.46 28.455000000000002 27.025 21.060000000000002 40-44 23.549999999999997 28.310000000000002 27.425 20.715 45-49 22.81 28.27 27.755000000000003 21.165 50-54 23.1 28.77 27.345000000000002 20.785 55-59 23.895 27.825 27.76 20.52 60-64 23.925 28.165000000000003 27.389999999999997 20.52 65-69 23.185 28.355000000000004 27.665 20.794999999999998 70-74 23.175 28.525 27.88 20.419999999999998 75-79 24.025 28.15 27.77 20.055 80-84 23.565 27.794999999999998 27.87 20.77 85-89 23.685000000000002 28.050000000000004 27.834999999999997 20.43 90-94 23.77 28.410000000000004 27.24 20.580000000000002 95-99 23.43 28.595 27.310000000000002 20.665 100-104 23.455000000000002 28.389999999999997 27.375 20.78 105-109 24.285 28.505000000000003 27.57 19.64 110-114 24.305 27.310000000000002 28.32 20.064999999999998 115-119 24.46 28.065 27.58 19.895 120-124 24.33 27.705000000000002 27.689999999999998 20.275000000000002 125-129 24.035 28.38 27.455000000000002 20.13 130-134 24.779999999999998 27.525 27.67 20.025000000000002 135-139 24.925 27.555000000000003 27.66 19.86 140-144 25.290000000000003 28.499999999999996 26.93 19.28 145-149 25.72 27.685 26.88 19.715 150-151 25.387500000000003 27.224999999999998 27.1 20.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 1.5 22 2.5 23 3.0 24 1.5 25 2.5 26 5.5 27 7.0 28 7.0 29 11.0 30 16.5 31 20.0 32 32.5 33 40.5 34 58.5 35 77.5 36 74.5 37 93.5 38 129.0 39 178.0 40 214.5 41 214.0 42 257.0 43 287.5 44 271.0 45 278.5 46 271.5 47 248.0 48 210.0 49 178.5 50 165.5 51 138.5 52 103.0 53 81.5 54 73.0 55 56.5 56 39.0 57 31.0 58 24.5 59 18.5 60 18.0 61 13.0 62 6.5 63 6.0 64 7.0 65 5.0 66 3.5 67 1.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 1.0 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.1594602038006 82.75 2 7.7664555218947955 14.099999999999998 3 0.8537592949600661 2.325 4 0.19278435692646653 0.7000000000000001 5 0.02754062241806665 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.9624999999999999 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.2374999999999998 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.5750000000000002 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 1.975 0.0 0.0 0.0 0.0 116-117 2.2375 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.6875 0.0 0.0 0.0 0.0 122-123 2.95 0.0 0.0 0.0 0.0 124-125 3.2125 0.0 0.0 0.0 0.0 126-127 3.6 0.0 0.0 0.0 0.0 128-129 3.8499999999999996 0.0 0.0 0.0 0.0 130-131 4.2 0.0 0.0 0.0 0.0 132-133 4.625 0.0 0.0 0.0 0.0 134-135 5.0 0.0 0.0 0.0 0.0 136-137 5.4625 0.0 0.0 0.0 0.0 138-139 6.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAACT 10 0.006830828 145.0 6 CTTTGCT 10 0.006830828 145.0 7 ATCTGCT 10 0.006830828 145.0 4 TTTGCTC 10 0.006830828 145.0 8 >>END_MODULE Read 1101033 spots for SRR12919333.sra Written 1101033 spots for SRR12919333.sra Read 1101033 spots for SRR12919333.sra Written 1101033 spots for SRR12919333.sra Read 1101033 spots for SRR12919333.sra Written 1101033 spots for SRR12919333.sra Read 1101033 spots for SRR12919333.sra Written 1101033 spots for SRR12919333.sra Read 1101033 spots for SRR12919333.sra Written 1101033 spots for SRR12919333.sra Read 1101033 spots for SRR12919333.sra Written 1101033 spots for SRR12919333.sra Read 1101033 spots for SRR12919333.sra Written 1101033 spots for SRR12919333.sra Read 1101033 spots for SRR12919333.sra Written 1101033 spots for SRR12919333.sra Read 1101033 spots for SRR12919333.sra Written 1101033 spots for SRR12919333.sra Read 1101033 spots for SRR12919333.sra Written 1101033 spots for SRR12919333.sra Read 1101033 spots for SRR12919333.sra Written 1101033 spots for SRR12919333.sra Read 1101033 spots for SRR12919333.sra Written 1101033 spots for SRR12919333.sra Read 1101033 spots for SRR12919333.sra Written 1101033 spots for SRR12919333.sra Read 1101033 spots for SRR12919333.sra Written 1101033 spots for SRR12919333.sra Read 1101047 spots for SRR12919333.sra Written 1101047 spots for SRR12919333.sra Read 1101033 spots for SRR12919333.sra Written 1101033 spots for SRR12919333.sra Read 1101033 spots for SRR12919333.sra Written 1101033 spots for SRR12919333.sra Read 1101033 spots for SRR12919333.sra Written 1101033 spots for SRR12919333.sra Read 1101033 spots for SRR12919333.sra Written 1101033 spots for SRR12919333.sra Read 1101033 spots for SRR12919333.sra Written 1101033 spots for SRR12919333.sra SRR ids: ['SRR12919333.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6_qs6arg SRR12919333.sra spots: 22020674 blocks: [[1, 1101033], [1101034, 2202066], [2202067, 3303099], [3303100, 4404132], [4404133, 5505165], [5505166, 6606198], [6606199, 7707231], [7707232, 8808264], [8808265, 9909297], [9909298, 11010330], [11010331, 12111363], [12111364, 13212396], [13212397, 14313429], [14313430, 15414462], [15414463, 16515495], [16515496, 17616528], [17616529, 18717561], [18717562, 19818594], [19818595, 20919627], [20919628, 22020674]] SRR12919333 file size 7461888 SRR12919333 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919333 SRR12919333_1.fastq SRR12919333_2.fastq Input file: SRR12919333_1.fastq Paired file: SRR12919333_2.fastq trimmed: SRR12919333-trimmed-pair1.fastq, SRR12919333-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:49:27 2025 >> started Wed Feb 12 18:50:05 2025 >> done (37.903s) 22020674 read pairs processed; of these: 35 ( 0.00%) short read pairs filtered out after trimming by size control 95 ( 0.00%) empty read pairs filtered out after trimming by size control 22020544 (100.00%) read pairs available; of these: 2214079 (10.05%) trimmed read pairs available after processing 19806465 (89.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 3 0.00% 21 5 0.00% 22 5 0.00% 23 6 0.00% 24 5 0.00% 25 6 0.00% 26 14 0.00% 27 8 0.00% 28 5 0.00% 29 15 0.00% 30 5 0.00% 31 11 0.00% 32 15 0.00% 33 9 0.00% 34 19 0.00% 35 13 0.00% 36 10 0.00% 37 7 0.00% 38 10 0.00% 39 15 0.00% 40 15 0.00% 41 36 0.00% 42 30 0.00% 43 19 0.00% 44 26 0.00% 45 28 0.00% 46 36 0.00% 47 48 0.00% 48 43 0.00% 49 54 0.00% 50 53 0.00% 51 58 0.00% 52 58 0.00% 53 71 0.00% 54 69 0.00% 55 95 0.00% 56 81 0.00% 57 93 0.00% 58 116 0.00% 59 117 0.00% 60 146 0.00% 61 174 0.00% 62 181 0.00% 63 188 0.00% 64 254 0.00% 65 292 0.00% 66 300 0.00% 67 356 0.00% 68 409 0.00% 69 471 0.00% 70 570 0.00% 71 687 0.00% 72 816 0.00% 73 960 0.00% 74 1022 0.00% 75 1159 0.01% 76 1312 0.01% 77 1434 0.01% 78 1569 0.01% 79 1928 0.01% 80 2037 0.01% 81 2382 0.01% 82 2779 0.01% 83 3349 0.02% 84 3714 0.02% 85 4196 0.02% 86 4419 0.02% 87 4763 0.02% 88 5198 0.02% 89 5766 0.03% 90 6302 0.03% 91 7039 0.03% 92 7690 0.03% 93 8760 0.04% 94 9334 0.04% 95 10609 0.05% 96 11164 0.05% 97 11812 0.05% 98 12455 0.06% 99 13023 0.06% 100 13999 0.06% 101 14867 0.07% 102 16130 0.07% 103 17591 0.08% 104 19043 0.09% 105 19918 0.09% 106 21171 0.10% 107 21974 0.10% 108 22473 0.10% 109 23312 0.11% 110 23594 0.11% 111 24913 0.11% 112 26408 0.12% 113 27478 0.12% 114 29515 0.13% 115 30622 0.14% 116 31965 0.15% 117 32808 0.15% 118 33838 0.15% 119 33754 0.15% 120 33837 0.15% 121 35629 0.16% 122 36921 0.17% 123 38356 0.17% 124 40164 0.18% 125 41609 0.19% 126 42813 0.19% 127 43773 0.20% 128 43713 0.20% 129 45008 0.20% 130 45403 0.21% 131 46233 0.21% 132 47538 0.22% 133 48853 0.22% 134 50235 0.23% 135 51603 0.23% 136 53291 0.24% 137 54299 0.25% 138 54658 0.25% 139 54566 0.25% 140 55231 0.25% 141 55933 0.25% 142 57742 0.26% 143 57957 0.26% 144 59972 0.27% 145 61221 0.28% 146 62626 0.28% 147 63509 0.29% 148 64614 0.29% 149 64081 0.29% 150 64956 0.29% 151 19806465 89.95% 22020544 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=18.37 fanout-score-rank=15 prefix-density=0.39 prefix-fanout=6.1 sequence=TTCTTGTCAAATGGAGGTTGCTCCTGGAGCCTAAATGTGTCAACGATGTCAACAACCTTGGCAGCTTGGTCATCAACACCCTCATCCTCATCACCTCCTTCAGCTGAAGGATTTGCACCAATGTCTACATCAACGGCTCCTTGAACAACCCACTTTCCTTCAACTTCCCACAGTATCCCATTCTCAATCTCCTTGTATGGGAACGAATCCGAGAGAAGCTCATCACCAGAGAGAAGATCTTGATAGACCAACATGATTGCGCAGAAGAGCTCCTCTCTTTCGGATCGACCCAAAGACAGACAAAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=421.49 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=33.4 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=13.28 fanout-score-rank=15 prefix-density=0.34 prefix-fanout=6.6 sequence=TTTGACAAGAAGCAGTTTCTTACACAGATTAAGAAATTTATCAAGAACCTGTCGGAGAAACTTGATGAGGACCAGAAGGAACATTTTAGAAAGAACATTGAGGGAGCAACCAAGTTCTTGCTTTCAAAAATCAAGGACTTGCAATTCTTTGTGGGGGAGAGCATGCATGATGATGGTTGTTTGGTCTTTGCTTATTACAAAGAAGGTGCTACCGATCCAACATTCTTGTACTTTGCCCCTTCTTTGAAGGAGGTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=672.07 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=15.4 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAGCTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGA SRR12919333 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:50:55 Started mapping on | Feb 12 18:50:56 Finished on | Feb 12 18:56:11 Mapping speed, Million of reads per hour | 251.66 Number of input reads | 22020544 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20249233 Uniquely mapped reads % | 91.96% Average mapped length | 296.09 Number of splices: Total | 19076059 Number of splices: Annotated (sjdb) | 18630222 Number of splices: GT/AG | 18718162 Number of splices: GC/AG | 279840 Number of splices: AT/AC | 20947 Number of splices: Non-canonical | 57110 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 531748 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 76060 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.15% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1239563 1239563 1239563 N_multimapping 531748 531748 531748 N_noFeature 780433 20021318 889197 N_ambiguous 232690 1153 112871 UnstrandedReadsAssigned:19236110 PositiveStrandReadsAssigned:226762 NegativeStrandReadsAssigned:19247165 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919333 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919333-trimmed-pair1.fastq SRR12919333-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,020,544 reads, 19,341,370 reads pseudoaligned [quant] estimated average fragment length: 264.28 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52401 SRR12919333.ke.tsv 34699 SRR12919333.se.tsv 87100 total ==> SRR12919333.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1754.72 852 26.1623 Potri.005G024800.1.v4.1 1035 771.72 204 14.2434 Potri.004G059700.1.v4.1 961 697.882 13 1.0037 Potri.007G009000.2.v4.1 1416 1152.72 1 0.0467433 Potri.003G141000.2.v4.1 2943 2679.72 697.32 14.0212 Potri.016G087400.1.v4.1 270 83.5235 1288.98 831.537 Potri.015G069301.1.v4.1 564 316.832 0 0 Potri.010G195200.1.v4.1 1773 1509.72 136 4.85385 Potri.012G127500.1.v4.1 977 713.802 12810 966.974 ==> SRR12919333.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 81 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 339 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 4 SRR12919333 completed mapping pipeline successfully