Starting /dee2/code/volunteer_pipeline.sh SRR12919334 current disk space = 3051271643136 free memory = 1411153924 SRR12919334 SRAfilesize fe84105e7a0b70c790e981994dc4ce65 SRR12919334.sra SRR12919334.sra file validated SRR12919334 is paired end SRR12919334 is conventional basespace SRR12919334 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919334_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.644 37.0 37.0 37.0 37.0 37.0 2 36.45975 37.0 37.0 37.0 37.0 37.0 3 36.5925 37.0 37.0 37.0 37.0 37.0 4 36.7045 37.0 37.0 37.0 37.0 37.0 5 36.71 37.0 37.0 37.0 37.0 37.0 6 36.651 37.0 37.0 37.0 37.0 37.0 7 36.6695 37.0 37.0 37.0 37.0 37.0 8 36.7345 37.0 37.0 37.0 37.0 37.0 9 36.6845 37.0 37.0 37.0 37.0 37.0 10-14 36.688 37.0 37.0 37.0 37.0 37.0 15-19 36.659299999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.6633 37.0 37.0 37.0 37.0 37.0 25-29 36.6409 37.0 37.0 37.0 37.0 37.0 30-34 36.5652 37.0 37.0 37.0 37.0 37.0 35-39 36.539699999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.5042 37.0 37.0 37.0 37.0 37.0 45-49 36.5242 37.0 37.0 37.0 37.0 37.0 50-54 36.4598 37.0 37.0 37.0 37.0 37.0 55-59 36.4582 37.0 37.0 37.0 37.0 37.0 60-64 36.4258 37.0 37.0 37.0 37.0 37.0 65-69 36.3608 37.0 37.0 37.0 37.0 37.0 70-74 36.346500000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.3589 37.0 37.0 37.0 37.0 37.0 80-84 36.2971 37.0 37.0 37.0 37.0 37.0 85-89 36.287 37.0 37.0 37.0 37.0 37.0 90-94 36.23350000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.2651 37.0 37.0 37.0 37.0 37.0 100-104 36.2298 37.0 37.0 37.0 37.0 37.0 105-109 36.165499999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.1597 37.0 37.0 37.0 37.0 37.0 115-119 36.1241 37.0 37.0 37.0 37.0 37.0 120-124 36.096199999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.9738 37.0 37.0 37.0 37.0 37.0 130-134 35.963100000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.781499999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.7125 37.0 37.0 37.0 37.0 37.0 145-149 35.6155 37.0 37.0 37.0 37.0 37.0 150-151 35.41825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 3.0 22 0.0 23 4.0 24 3.0 25 1.0 26 1.0 27 12.0 28 3.0 29 20.0 30 16.0 31 22.0 32 34.0 33 70.0 34 114.0 35 294.0 36 2991.0 37 410.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.025 11.95 6.5 41.525 2 18.4032136580467 13.055485814712528 39.066030630178254 29.475269897062518 3 16.950000000000003 17.525 28.799999999999997 36.725 4 21.15 24.6 24.725 29.525000000000002 5 23.3 30.825000000000003 25.074999999999996 20.8 6 19.575 34.925 25.374999999999996 20.125 7 15.8 27.3 40.400000000000006 16.5 8 16.55 26.75 32.375 24.325 9 18.025 24.7 33.15 24.125 10-14 19.8 29.244999999999997 27.96 22.994999999999997 15-19 19.66 28.305000000000003 27.505000000000003 24.529999999999998 20-24 20.169999999999998 27.87 28.16 23.799999999999997 25-29 19.650000000000002 28.910000000000004 28.005000000000003 23.435 30-34 19.509999999999998 29.060000000000002 27.24 24.19 35-39 19.71 28.175 27.595 24.52 40-44 20.3 27.800000000000004 28.12 23.78 45-49 20.07 28.175 27.605 24.15 50-54 19.830000000000002 28.845 27.295 24.03 55-59 19.814999999999998 28.175 27.67 24.34 60-64 19.485 28.439999999999998 27.68 24.395 65-69 20.175 28.244999999999997 27.250000000000004 24.33 70-74 20.115 28.449999999999996 27.555000000000003 23.880000000000003 75-79 20.145 28.225 27.875 23.755000000000003 80-84 20.075000000000003 28.09 28.000000000000004 23.835 85-89 19.72 28.999999999999996 27.935 23.345 90-94 20.7 28.09 27.529999999999998 23.68 95-99 20.215 27.625 28.249999999999996 23.91 100-104 20.57 28.615000000000002 27.474999999999998 23.34 105-109 20.51 28.294999999999998 27.029999999999998 24.165 110-114 20.385 28.16 27.96 23.494999999999997 115-119 20.71 28.485 27.339999999999996 23.465 120-124 20.895 28.865000000000002 26.919999999999998 23.32 125-129 20.43 29.15 26.38 24.04 130-134 20.895 28.415000000000003 27.334999999999997 23.355 135-139 20.945 28.7 26.11 24.245 140-144 21.165 27.685 27.1 24.05 145-149 20.61 28.98 26.165 24.245 150-151 21.625 28.8375 25.874999999999996 23.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 0.5 22 2.0 23 3.0 24 1.5 25 0.0 26 5.0 27 7.0 28 8.0 29 12.5 30 19.5 31 27.5 32 32.0 33 41.0 34 52.5 35 75.0 36 91.0 37 100.0 38 127.5 39 169.5 40 201.5 41 204.5 42 220.0 43 254.0 44 258.5 45 260.5 46 274.5 47 253.0 48 228.5 49 210.5 50 172.5 51 138.5 52 118.5 53 108.0 54 80.5 55 55.0 56 46.5 57 30.0 58 19.0 59 20.0 60 17.5 61 14.0 62 13.0 63 9.0 64 6.5 65 3.5 66 2.0 67 2.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.42500000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.65 #Duplication Level Percentage of deduplicated Percentage of total 1 93.14624932541824 86.3 2 5.990286022665947 11.1 3 0.7285483000539665 2.025 4 0.053966540744738264 0.2 5 0.08094981111710739 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCTTCGTTTGCCCTCTTGAAATACTCCGGCTTTTTCAAGAGCTCGGCC 5 0.125 No Hit CGTTAAGGAAGTCTCCGTATGCTTTATTTCGAACGTAAAAATCAGAAGTA 5 0.125 No Hit GTCCATCTTTTCTATGATCTGATGCCTAACCTTTTCAACTGCTTCAGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.6000000000000001 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.9875 0.0 0.0 0.0 0.0 96-97 1.125 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.4625 0.0 0.0 0.0 0.0 102-103 1.7625 0.0 0.0 0.0 0.0 104-105 1.9749999999999999 0.0 0.0 0.0 0.0 106-107 2.1625 0.0 0.0 0.0 0.0 108-109 2.4625 0.0 0.0 0.0 0.0 110-111 2.8 0.0 0.0 0.0 0.0 112-113 3.1375 0.0 0.0 0.0 0.0 114-115 3.4625 0.0 0.0 0.0 0.0 116-117 3.925 0.0 0.0 0.0 0.0 118-119 4.275 0.0 0.0 0.0 0.0 120-121 4.5875 0.0 0.0 0.0 0.0 122-123 5.0875 0.0 0.0 0.0 0.0 124-125 5.5875 0.0 0.0 0.0 0.0 126-127 5.9875 0.0 0.0 0.0 0.0 128-129 6.6 0.0 0.0 0.0 0.0 130-131 7.2625 0.0 0.0 0.0 0.0 132-133 7.8125 0.0 0.0 0.0 0.0 134-135 8.5125 0.0 0.0 0.0 0.0 136-137 8.875 0.0 0.0 0.0 0.0 138-139 9.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTTAA 10 0.006830828 145.0 6 >>END_MODULE SRR12919334 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919334_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.294 37.0 37.0 37.0 37.0 37.0 2 36.3515 37.0 37.0 37.0 37.0 37.0 3 36.3695 37.0 37.0 37.0 37.0 37.0 4 36.466 37.0 37.0 37.0 37.0 37.0 5 36.4485 37.0 37.0 37.0 37.0 37.0 6 36.4625 37.0 37.0 37.0 37.0 37.0 7 36.419 37.0 37.0 37.0 37.0 37.0 8 36.457 37.0 37.0 37.0 37.0 37.0 9 36.5085 37.0 37.0 37.0 37.0 37.0 10-14 36.465700000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.4763 37.0 37.0 37.0 37.0 37.0 20-24 36.434799999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.4057 37.0 37.0 37.0 37.0 37.0 30-34 36.3118 37.0 37.0 37.0 37.0 37.0 35-39 36.265699999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.280499999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.2543 37.0 37.0 37.0 37.0 37.0 50-54 36.2325 37.0 37.0 37.0 37.0 37.0 55-59 36.15990000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.1521 37.0 37.0 37.0 37.0 37.0 65-69 36.168099999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.1165 37.0 37.0 37.0 37.0 37.0 75-79 36.05760000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.0799 37.0 37.0 37.0 37.0 37.0 85-89 36.058 37.0 37.0 37.0 37.0 37.0 90-94 36.041999999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.98729999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.0078 37.0 37.0 37.0 37.0 37.0 105-109 35.97449999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.8948 37.0 37.0 37.0 37.0 37.0 115-119 35.874900000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.83019999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.7467 37.0 37.0 37.0 37.0 37.0 130-134 35.6366 37.0 37.0 37.0 37.0 37.0 135-139 35.536500000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.451499999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.3178 37.0 37.0 37.0 34.6 37.0 150-151 35.08325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 5.0 16 1.0 17 2.0 18 2.0 19 1.0 20 4.0 21 1.0 22 2.0 23 0.0 24 7.0 25 5.0 26 5.0 27 7.0 28 14.0 29 13.0 30 19.0 31 18.0 32 55.0 33 97.0 34 171.0 35 458.0 36 2781.0 37 330.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.125 25.8 8.7 28.375 2 26.900000000000002 26.55 31.5 15.049999999999999 3 18.975 28.299999999999997 33.074999999999996 19.650000000000002 4 23.175 33.425 24.85 18.55 5 26.174999999999997 34.575 22.05 17.2 6 20.275000000000002 38.9 22.25 18.575 7 21.025 22.525000000000002 37.5 18.95 8 21.05 24.65 29.15 25.15 9 21.224999999999998 25.124999999999996 30.8 22.85 10-14 23.369999999999997 28.54 26.740000000000002 21.349999999999998 15-19 23.075000000000003 27.97 27.794999999999998 21.16 20-24 22.685 28.77 27.325 21.22 25-29 22.745 27.97 28.21 21.075 30-34 23.14 28.845 27.189999999999998 20.825 35-39 22.855 28.360000000000003 28.01 20.775 40-44 23.395 27.955000000000002 27.689999999999998 20.96 45-49 23.425 28.425 27.88 20.27 50-54 22.915 27.51 28.585 20.990000000000002 55-59 23.535 27.650000000000002 27.744999999999997 21.07 60-64 22.825 27.685 28.410000000000004 21.08 65-69 23.189999999999998 28.18 28.02 20.61 70-74 23.385 27.925 28.27 20.419999999999998 75-79 23.630000000000003 27.845 27.744999999999997 20.78 80-84 23.365 28.689999999999998 27.450000000000003 20.495 85-89 23.57 27.665 27.435 21.33 90-94 23.555 27.955000000000002 28.51 19.98 95-99 23.685000000000002 28.694999999999997 27.51 20.11 100-104 23.805 28.345 27.49 20.36 105-109 23.630000000000003 28.21 28.065 20.095 110-114 24.195 28.349999999999998 27.29 20.165 115-119 24.035 29.01 26.77 20.185 120-124 24.775 27.634999999999998 27.455000000000002 20.135 125-129 24.705 28.139999999999997 27.215 19.939999999999998 130-134 25.11 28.65 26.44 19.8 135-139 25.679999999999996 27.975 26.590000000000003 19.755 140-144 25.729999999999997 27.55 26.915 19.805 145-149 26.405 27.994999999999997 26.479999999999997 19.12 150-151 26.6125 28.8375 26.3625 18.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.5 7 1.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 3.0 24 2.0 25 4.0 26 8.5 27 5.0 28 3.5 29 9.0 30 18.0 31 21.0 32 24.0 33 42.0 34 57.5 35 75.0 36 90.0 37 105.0 38 130.0 39 169.5 40 208.0 41 239.0 42 262.0 43 271.5 44 267.0 45 267.5 46 252.5 47 233.5 48 221.5 49 185.5 50 156.0 51 125.5 52 104.5 53 89.0 54 67.0 55 62.0 56 57.0 57 40.5 58 28.5 59 21.5 60 18.0 61 14.5 62 11.0 63 5.0 64 3.0 65 3.5 66 2.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.825 #Duplication Level Percentage of deduplicated Percentage of total 1 93.13223808241314 86.45 2 6.140587126312955 11.4 3 0.6194451925666576 1.725 4 0.08079719903043361 0.3 5 0.026932399676811204 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGCACCAATATTTCAGGTTCAAAAATTGTTTTTGCAAATGGGTCTCAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.025 0.0 88-89 0.4875 0.0 0.0 0.025 0.0 90-91 0.6000000000000001 0.0 0.0 0.025 0.0 92-93 0.8125 0.0 0.0 0.025 0.0 94-95 0.9875 0.0 0.0 0.025 0.0 96-97 1.125 0.0 0.0 0.025 0.0 98-99 1.2 0.0 0.0 0.025 0.0 100-101 1.4625 0.0 0.0 0.025 0.0 102-103 1.7625 0.0 0.0 0.025 0.0 104-105 1.9749999999999999 0.0 0.0 0.025 0.0 106-107 2.1625 0.0 0.0 0.025 0.0 108-109 2.4625 0.0 0.0 0.025 0.0 110-111 2.8 0.0 0.0 0.025 0.0 112-113 3.15 0.0 0.0 0.025 0.0 114-115 3.4875 0.0 0.0 0.025 0.0 116-117 3.95 0.0 0.0 0.025 0.0 118-119 4.3 0.0 0.0 0.025 0.0 120-121 4.612500000000001 0.0 0.0 0.025 0.0 122-123 5.1125 0.0 0.0 0.025 0.0 124-125 5.6125 0.0 0.0 0.025 0.0 126-127 6.0125 0.0 0.0 0.025 0.0 128-129 6.625 0.0 0.0 0.025 0.0 130-131 7.2875 0.0 0.0 0.025 0.0 132-133 7.8625 0.0 0.0 0.025 0.0 134-135 8.575 0.0 0.0 0.025 0.0 136-137 8.95 0.0 0.0 0.025 0.0 138-139 9.524999999999999 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGACT 10 0.006830828 145.0 2 ATCCAGC 10 0.006830828 145.0 6 GTGACTT 10 0.006830828 145.0 3 TGGTGAC 10 0.006830828 145.0 1 >>END_MODULE Read 863999 spots for SRR12919334.sra Written 863999 spots for SRR12919334.sra Read 863999 spots for SRR12919334.sra Written 863999 spots for SRR12919334.sra Read 863999 spots for SRR12919334.sra Written 863999 spots for SRR12919334.sra Read 863999 spots for SRR12919334.sra Written 863999 spots for SRR12919334.sra Read 863999 spots for SRR12919334.sra Written 863999 spots for SRR12919334.sra Read 863999 spots for SRR12919334.sra Written 863999 spots for SRR12919334.sra Read 863999 spots for SRR12919334.sra Written 863999 spots for SRR12919334.sra Read 863999 spots for SRR12919334.sra Written 863999 spots for SRR12919334.sra Read 863999 spots for SRR12919334.sra Written 863999 spots for SRR12919334.sra Read 863999 spots for SRR12919334.sra Written 863999 spots for SRR12919334.sra Read 863999 spots for SRR12919334.sra Written 863999 spots for SRR12919334.sra Read 863999 spots for SRR12919334.sra Written 863999 spots for SRR12919334.sra Read 863999 spots for SRR12919334.sra Written 863999 spots for SRR12919334.sra Read 863999 spots for SRR12919334.sra Written 863999 spots for SRR12919334.sra Read 863999 spots for SRR12919334.sra Written 863999 spots for SRR12919334.sra Read 863999 spots for SRR12919334.sra Written 863999 spots for SRR12919334.sra Read 863999 spots for SRR12919334.sra Written 863999 spots for SRR12919334.sra Read 863999 spots for SRR12919334.sra Written 863999 spots for SRR12919334.sra Read 863999 spots for SRR12919334.sra Written 863999 spots for SRR12919334.sra Read 864003 spots for SRR12919334.sra Written 864003 spots for SRR12919334.sra SRR ids: ['SRR12919334.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kul55m3o SRR12919334.sra spots: 17279984 blocks: [[1, 863999], [864000, 1727998], [1727999, 2591997], [2591998, 3455996], [3455997, 4319995], [4319996, 5183994], [5183995, 6047993], [6047994, 6911992], [6911993, 7775991], [7775992, 8639990], [8639991, 9503989], [9503990, 10367988], [10367989, 11231987], [11231988, 12095986], [12095987, 12959985], [12959986, 13823984], [13823985, 14687983], [14687984, 15551982], [15551983, 16415981], [16415982, 17279984]] SRR12919334 file size 5850794 SRR12919334 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919334 SRR12919334_1.fastq SRR12919334_2.fastq Input file: SRR12919334_1.fastq Paired file: SRR12919334_2.fastq trimmed: SRR12919334-trimmed-pair1.fastq, SRR12919334-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:46:46 2025 >> started Wed Feb 12 18:47:15 2025 >> done (29.190s) 17279984 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 292 ( 0.00%) empty read pairs filtered out after trimming by size control 17279669 (100.00%) read pairs available; of these: 2440734 (14.12%) trimmed read pairs available after processing 14838935 (85.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 4 0.00% 21 5 0.00% 22 4 0.00% 23 1 0.00% 24 6 0.00% 25 2 0.00% 26 13 0.00% 27 7 0.00% 28 9 0.00% 29 6 0.00% 30 3 0.00% 31 7 0.00% 32 12 0.00% 33 13 0.00% 34 19 0.00% 35 13 0.00% 36 15 0.00% 37 11 0.00% 38 26 0.00% 39 28 0.00% 40 27 0.00% 41 38 0.00% 42 27 0.00% 43 33 0.00% 44 26 0.00% 45 32 0.00% 46 42 0.00% 47 56 0.00% 48 61 0.00% 49 73 0.00% 50 107 0.00% 51 124 0.00% 52 104 0.00% 53 134 0.00% 54 148 0.00% 55 178 0.00% 56 186 0.00% 57 205 0.00% 58 264 0.00% 59 329 0.00% 60 361 0.00% 61 457 0.00% 62 506 0.00% 63 539 0.00% 64 599 0.00% 65 667 0.00% 66 724 0.00% 67 815 0.00% 68 1018 0.01% 69 1175 0.01% 70 1379 0.01% 71 1612 0.01% 72 1851 0.01% 73 2079 0.01% 74 2354 0.01% 75 2639 0.02% 76 2827 0.02% 77 3035 0.02% 78 3494 0.02% 79 3853 0.02% 80 4397 0.03% 81 4975 0.03% 82 5795 0.03% 83 6515 0.04% 84 7211 0.04% 85 7806 0.05% 86 8208 0.05% 87 8801 0.05% 88 9256 0.05% 89 9965 0.06% 90 10826 0.06% 91 12078 0.07% 92 13367 0.08% 93 14359 0.08% 94 15513 0.09% 95 16479 0.10% 96 17265 0.10% 97 17989 0.10% 98 18589 0.11% 99 19282 0.11% 100 20332 0.12% 101 21156 0.12% 102 22910 0.13% 103 24318 0.14% 104 25790 0.15% 105 26751 0.15% 106 27910 0.16% 107 28051 0.16% 108 28842 0.17% 109 29132 0.17% 110 29972 0.17% 111 31054 0.18% 112 32321 0.19% 113 33423 0.19% 114 35201 0.20% 115 36376 0.21% 116 37299 0.22% 117 37953 0.22% 118 37743 0.22% 119 37867 0.22% 120 38700 0.22% 121 39916 0.23% 122 40498 0.23% 123 41892 0.24% 124 43613 0.25% 125 44874 0.26% 126 45923 0.27% 127 46568 0.27% 128 46359 0.27% 129 46108 0.27% 130 47184 0.27% 131 47629 0.28% 132 48681 0.28% 133 50213 0.29% 134 50753 0.29% 135 52460 0.30% 136 52800 0.31% 137 53454 0.31% 138 53514 0.31% 139 53692 0.31% 140 53010 0.31% 141 54391 0.31% 142 54909 0.32% 143 55345 0.32% 144 57109 0.33% 145 57752 0.33% 146 58488 0.34% 147 59521 0.34% 148 59476 0.34% 149 59205 0.34% 150 59233 0.34% 151 14838935 85.88% 17279669 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=29 prefix-density=0.20 prefix-fanout=1.9 sequence=AAGACTCACGATCGAGGACATTCAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=222.81 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=13.6 sequence=ACAACAACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=36 prefix-density=0.18 prefix-fanout=2.1 sequence=CATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTTCAGCTGAAGGAGGTGATGAGGATGAGGGTGTTGATGACCAAGCTGCCAAGGTTGTTGACATCGTTGACACATTTAGGCTCCAGGAGCAACCTCCATTTGACAAGAAGCAGTTTCTTACACAGATTAAGAAATTTATCAAGAATCTGTCGGAGAAACTTGATGAGGACCAGAAGGAACATTTTAGAAAGAACATTGAGGGAGCAACCAAGTTCTTGCTTTCAAAAATCAAGGACTTGCAATTCTTTGTGGGGGAGAGCATGCATGATGATGGTTGTTTGGTCTTTGCTTATTACAAAGAAGGTGCTACCGATCCAACATTCTTGTACTTTGCCCCTTCTTTGAAGGAGGTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=665.08 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=19.8 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAGCTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGA SRR12919334 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:48:15 Started mapping on | Feb 12 18:48:15 Finished on | Feb 12 18:52:24 Mapping speed, Million of reads per hour | 249.83 Number of input reads | 17279669 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15600965 Uniquely mapped reads % | 90.29% Average mapped length | 293.30 Number of splices: Total | 14503659 Number of splices: Annotated (sjdb) | 14147520 Number of splices: GT/AG | 14219129 Number of splices: GC/AG | 215398 Number of splices: AT/AC | 17086 Number of splices: Non-canonical | 52046 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 426255 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 72381 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.68% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1252449 1252449 1252449 N_multimapping 426255 426255 426255 N_noFeature 573894 15417364 657855 N_ambiguous 200278 996 100195 UnstrandedReadsAssigned:14826793 PositiveStrandReadsAssigned:182605 NegativeStrandReadsAssigned:14842915 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919334 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919334-trimmed-pair1.fastq SRR12919334-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,279,669 reads, 14,890,354 reads pseudoaligned [quant] estimated average fragment length: 247.168 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR12919334.ke.tsv 34699 SRR12919334.se.tsv 87100 total ==> SRR12919334.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.83 874 35.3481 Potri.005G024800.1.v4.1 1035 788.832 81 7.3583 Potri.004G059700.1.v4.1 961 714.975 100 10.0227 Potri.007G009000.2.v4.1 1416 1169.83 0 0 Potri.003G141000.2.v4.1 2943 2696.83 492.169 13.0779 Potri.016G087400.1.v4.1 270 91.4609 1046 819.545 Potri.015G069301.1.v4.1 564 330.572 0 0 Potri.010G195200.1.v4.1 1773 1526.83 79 3.70777 Potri.012G127500.1.v4.1 977 730.926 6534 640.593 ==> SRR12919334.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 298 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 217 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 14 Potri.001G452600.v4.1 9 SRR12919334 completed mapping pipeline successfully