Starting /dee2/code/volunteer_pipeline.sh SRR12919335 current disk space = 3051104813056 free memory = 1540494676 SRR12919335 SRAfilesize e01c40a726e1b3871492148b8bdc482a SRR12919335.sra SRR12919335.sra file validated SRR12919335 is paired end SRR12919335 is conventional basespace SRR12919335 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919335_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.609 37.0 37.0 37.0 37.0 37.0 2 36.3185 37.0 37.0 37.0 37.0 37.0 3 36.613 37.0 37.0 37.0 37.0 37.0 4 36.6785 37.0 37.0 37.0 37.0 37.0 5 36.692 37.0 37.0 37.0 37.0 37.0 6 36.6665 37.0 37.0 37.0 37.0 37.0 7 36.597 37.0 37.0 37.0 37.0 37.0 8 36.6405 37.0 37.0 37.0 37.0 37.0 9 36.641 37.0 37.0 37.0 37.0 37.0 10-14 36.6653 37.0 37.0 37.0 37.0 37.0 15-19 36.590999999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.6145 37.0 37.0 37.0 37.0 37.0 25-29 36.555899999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.5481 37.0 37.0 37.0 37.0 37.0 35-39 36.5327 37.0 37.0 37.0 37.0 37.0 40-44 36.52419999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.4833 37.0 37.0 37.0 37.0 37.0 50-54 36.4692 37.0 37.0 37.0 37.0 37.0 55-59 36.4716 37.0 37.0 37.0 37.0 37.0 60-64 36.429899999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.3831 37.0 37.0 37.0 37.0 37.0 70-74 36.3517 37.0 37.0 37.0 37.0 37.0 75-79 36.3158 37.0 37.0 37.0 37.0 37.0 80-84 36.2972 37.0 37.0 37.0 37.0 37.0 85-89 36.2314 37.0 37.0 37.0 37.0 37.0 90-94 36.2059 37.0 37.0 37.0 37.0 37.0 95-99 36.2419 37.0 37.0 37.0 37.0 37.0 100-104 36.1663 37.0 37.0 37.0 37.0 37.0 105-109 36.1345 37.0 37.0 37.0 37.0 37.0 110-114 36.1035 37.0 37.0 37.0 37.0 37.0 115-119 36.07 37.0 37.0 37.0 37.0 37.0 120-124 36.0946 37.0 37.0 37.0 37.0 37.0 125-129 35.958000000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.9716 37.0 37.0 37.0 37.0 37.0 135-139 35.8581 37.0 37.0 37.0 37.0 37.0 140-144 35.80499999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.820100000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.62425 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 4.0 26 3.0 27 6.0 28 16.0 29 18.0 30 31.0 31 28.0 32 39.0 33 60.0 34 118.0 35 271.0 36 2965.0 37 438.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.5 11.450000000000001 7.625 41.425 2 18.513853904282115 13.04785894206549 36.221662468513856 32.21662468513854 3 17.0 17.625 26.724999999999998 38.65 4 20.95 25.35 23.65 30.049999999999997 5 23.775 31.35 24.45 20.424999999999997 6 20.875 35.199999999999996 23.575 20.349999999999998 7 14.924999999999999 26.724999999999998 40.550000000000004 17.8 8 17.549999999999997 26.424999999999997 32.25 23.775 9 17.299999999999997 24.2 34.475 24.025 10-14 19.595000000000002 29.909999999999997 28.025 22.470000000000002 15-19 19.625 28.52 28.000000000000004 23.855 20-24 19.785 28.525 28.105000000000004 23.585 25-29 19.78 28.689999999999998 27.6 23.93 30-34 19.84 28.475 28.025 23.66 35-39 19.775000000000002 29.060000000000002 27.994999999999997 23.169999999999998 40-44 20.095 28.67 27.715 23.52 45-49 19.830000000000002 28.720000000000002 27.589999999999996 23.86 50-54 19.79 28.544999999999998 27.92 23.745 55-59 20.1 28.71 27.79 23.400000000000002 60-64 20.525 28.560000000000002 27.400000000000002 23.515 65-69 20.14 28.58 27.339999999999996 23.94 70-74 20.285 28.599999999999998 27.495000000000005 23.62 75-79 20.345 28.349999999999998 27.52 23.785 80-84 20.43 28.615000000000002 27.26 23.695 85-89 20.625 28.384999999999998 27.955000000000002 23.035 90-94 20.724999999999998 28.349999999999998 27.395000000000003 23.53 95-99 20.330000000000002 27.42 27.965 24.285 100-104 20.47 28.23 27.63 23.669999999999998 105-109 20.965 28.349999999999998 26.87 23.815 110-114 20.775 28.125 27.534999999999997 23.565 115-119 20.674999999999997 28.444999999999997 27.284999999999997 23.595 120-124 20.599999999999998 28.27 27.165 23.965 125-129 20.45 28.235 28.04 23.275000000000002 130-134 20.32 28.185 27.43 24.065 135-139 20.685000000000002 28.134999999999998 27.52 23.66 140-144 20.955 28.78 26.375 23.89 145-149 20.93 28.38 26.83 23.86 150-151 21.349999999999998 28.6875 25.525 24.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 0.5 24 2.0 25 2.5 26 2.5 27 4.5 28 7.0 29 12.5 30 20.0 31 27.5 32 40.0 33 44.5 34 50.0 35 65.5 36 77.5 37 103.5 38 133.0 39 155.5 40 179.5 41 221.0 42 244.0 43 265.5 44 325.5 45 299.5 46 261.0 47 244.5 48 208.0 49 193.5 50 169.0 51 133.5 52 105.5 53 90.0 54 68.5 55 55.5 56 48.0 57 39.0 58 27.0 59 22.0 60 17.0 61 8.0 62 5.5 63 3.5 64 3.0 65 3.0 66 2.5 67 2.0 68 1.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.75 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.05 #Duplication Level Percentage of deduplicated Percentage of total 1 90.08883953359245 81.125 2 8.883953359244865 16.0 3 0.9161576901721267 2.475 4 0.11104941699056081 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.11249999999999999 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.5125000000000002 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.1375 0.0 0.0 0.0 0.0 118-119 2.5125 0.0 0.0 0.0 0.0 120-121 2.9375 0.0 0.0 0.0 0.0 122-123 3.2249999999999996 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 4.025 0.0 0.0 0.0 0.0 128-129 4.300000000000001 0.0 0.0 0.0 0.0 130-131 4.574999999999999 0.0 0.0 0.0 0.0 132-133 4.9 0.0 0.0 0.0 0.0 134-135 5.3375 0.0 0.0 0.0 0.0 136-137 5.7625 0.0 0.0 0.0 0.0 138-139 6.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCGCAA 10 0.006830828 145.0 145 >>END_MODULE SRR12919335 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919335_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.206 37.0 37.0 37.0 37.0 37.0 2 36.2625 37.0 37.0 37.0 37.0 37.0 3 36.216 37.0 37.0 37.0 37.0 37.0 4 36.341 37.0 37.0 37.0 37.0 37.0 5 36.451 37.0 37.0 37.0 37.0 37.0 6 36.3285 37.0 37.0 37.0 37.0 37.0 7 36.255 37.0 37.0 37.0 37.0 37.0 8 36.3175 37.0 37.0 37.0 37.0 37.0 9 36.435 37.0 37.0 37.0 37.0 37.0 10-14 36.357600000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.3355 37.0 37.0 37.0 37.0 37.0 20-24 36.2924 37.0 37.0 37.0 37.0 37.0 25-29 36.2867 37.0 37.0 37.0 37.0 37.0 30-34 36.1815 37.0 37.0 37.0 37.0 37.0 35-39 36.150800000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.13589999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.1295 37.0 37.0 37.0 37.0 37.0 50-54 36.1175 37.0 37.0 37.0 37.0 37.0 55-59 36.09 37.0 37.0 37.0 37.0 37.0 60-64 36.06 37.0 37.0 37.0 37.0 37.0 65-69 36.056000000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.9963 37.0 37.0 37.0 37.0 37.0 75-79 35.9386 37.0 37.0 37.0 37.0 37.0 80-84 36.0226 37.0 37.0 37.0 37.0 37.0 85-89 35.9418 37.0 37.0 37.0 37.0 37.0 90-94 35.910199999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.845299999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.8586 37.0 37.0 37.0 37.0 37.0 105-109 35.8627 37.0 37.0 37.0 37.0 37.0 110-114 35.811899999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.8022 37.0 37.0 37.0 37.0 37.0 120-124 35.68670000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.6344 37.0 37.0 37.0 37.0 37.0 130-134 35.580799999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.49720000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.4664 37.0 37.0 37.0 37.0 37.0 145-149 35.2992 37.0 37.0 37.0 29.8 37.0 150-151 35.17475 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 3.0 16 2.0 17 0.0 18 1.0 19 3.0 20 2.0 21 1.0 22 2.0 23 6.0 24 10.0 25 7.0 26 11.0 27 6.0 28 16.0 29 13.0 30 25.0 31 26.0 32 64.0 33 87.0 34 178.0 35 539.0 36 2714.0 37 281.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.5 22.925 12.15 26.424999999999997 2 27.650000000000002 25.825 29.625 16.900000000000002 3 21.349999999999998 28.449999999999996 31.75 18.45 4 23.599999999999998 32.95 23.75 19.7 5 23.375 37.025000000000006 21.675 17.925 6 20.875 39.300000000000004 23.225 16.6 7 20.875 22.1 37.824999999999996 19.2 8 21.3 25.1 27.900000000000002 25.7 9 20.65 24.975 31.775 22.6 10-14 23.06 29.23 26.179999999999996 21.529999999999998 15-19 22.735 28.07 27.83 21.365000000000002 20-24 22.545 28.63 27.73 21.095 25-29 22.905 27.93 28.115000000000002 21.05 30-34 23.080000000000002 28.33 27.675 20.915 35-39 22.59 27.779999999999998 28.58 21.05 40-44 23.51 28.73 27.36 20.4 45-49 22.759999999999998 27.92 28.175 21.145 50-54 23.89 27.884999999999998 27.595 20.630000000000003 55-59 22.84 28.22 28.4 20.54 60-64 23.625 27.6 27.97 20.805 65-69 23.44 27.51 28.115000000000002 20.935000000000002 70-74 23.0 28.32 27.500000000000004 21.18 75-79 23.59 27.505000000000003 27.815 21.09 80-84 23.53 27.884999999999998 27.77 20.815 85-89 23.544999999999998 27.439999999999998 28.42 20.595 90-94 23.825 27.73 27.51 20.935000000000002 95-99 23.835 28.110000000000003 27.105 20.95 100-104 23.785 27.92 27.595 20.7 105-109 23.69 28.244999999999997 27.575 20.49 110-114 23.72 27.36 27.74 21.18 115-119 24.025 28.365000000000002 27.0 20.61 120-124 24.05 27.91 27.3 20.74 125-129 24.265 27.855 27.43 20.45 130-134 24.595 28.655 26.58 20.169999999999998 135-139 24.884999999999998 27.639999999999997 27.229999999999997 20.244999999999997 140-144 24.9 28.37 26.810000000000002 19.919999999999998 145-149 25.724999999999998 28.549999999999997 26.009999999999998 19.715 150-151 25.162499999999998 28.1 27.025 19.7125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 0.5 23 2.5 24 4.0 25 3.5 26 3.5 27 4.5 28 8.0 29 9.0 30 14.0 31 21.0 32 27.5 33 36.0 34 40.0 35 51.0 36 74.5 37 99.0 38 134.0 39 162.0 40 219.0 41 262.0 42 256.0 43 272.5 44 273.0 45 263.0 46 260.5 47 255.5 48 242.5 49 197.5 50 158.5 51 144.0 52 116.5 53 85.5 54 68.5 55 57.0 56 42.0 57 28.5 58 21.0 59 17.5 60 13.0 61 7.0 62 7.0 63 7.5 64 6.0 65 3.5 66 1.5 67 2.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 90.26622296173045 81.375 2 8.735440931780367 15.75 3 0.8042151968940654 2.175 4 0.19412090959511924 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.11249999999999999 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7124999999999999 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 0.9125 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.5125000000000002 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.9875 0.0 0.0 0.0 0.0 122-123 3.2750000000000004 0.0 0.0 0.0 0.0 124-125 3.6125 0.0 0.0 0.0 0.0 126-127 4.05 0.0 0.0 0.0 0.0 128-129 4.324999999999999 0.0 0.0 0.0 0.0 130-131 4.6 0.0 0.0 0.0 0.0 132-133 4.925000000000001 0.0 0.0 0.0 0.0 134-135 5.362500000000001 0.0 0.0 0.0 0.0 136-137 5.775 0.0 0.0 0.0 0.0 138-139 6.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCAAGC 10 0.006830828 145.0 6 >>END_MODULE Read 977902 spots for SRR12919335.sra Written 977902 spots for SRR12919335.sra Read 977902 spots for SRR12919335.sra Written 977902 spots for SRR12919335.sra Read 977902 spots for SRR12919335.sra Written 977902 spots for SRR12919335.sra Read 977902 spots for SRR12919335.sra Written 977902 spots for SRR12919335.sra Read 977902 spots for SRR12919335.sra Written 977902 spots for SRR12919335.sra Read 977902 spots for SRR12919335.sra Written 977902 spots for SRR12919335.sra Read 977902 spots for SRR12919335.sra Written 977902 spots for SRR12919335.sra Read 977902 spots for SRR12919335.sra Written 977902 spots for SRR12919335.sra Read 977902 spots for SRR12919335.sra Written 977902 spots for SRR12919335.sra Read 977902 spots for SRR12919335.sra Written 977902 spots for SRR12919335.sra Read 977902 spots for SRR12919335.sra Written 977902 spots for SRR12919335.sra Read 977902 spots for SRR12919335.sra Written 977902 spots for SRR12919335.sra Read 977902 spots for SRR12919335.sra Written 977902 spots for SRR12919335.sra Read 977902 spots for SRR12919335.sra Written 977902 spots for SRR12919335.sra Read 977902 spots for SRR12919335.sra Written 977902 spots for SRR12919335.sra Read 977902 spots for SRR12919335.sra Written 977902 spots for SRR12919335.sra Read 977902 spots for SRR12919335.sra Written 977902 spots for SRR12919335.sra Read 977902 spots for SRR12919335.sra Written 977902 spots for SRR12919335.sra Read 977902 spots for SRR12919335.sra Written 977902 spots for SRR12919335.sra Read 977915 spots for SRR12919335.sra Written 977915 spots for SRR12919335.sra SRR ids: ['SRR12919335.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pkxv_xtr SRR12919335.sra spots: 19558053 blocks: [[1, 977902], [977903, 1955804], [1955805, 2933706], [2933707, 3911608], [3911609, 4889510], [4889511, 5867412], [5867413, 6845314], [6845315, 7823216], [7823217, 8801118], [8801119, 9779020], [9779021, 10756922], [10756923, 11734824], [11734825, 12712726], [12712727, 13690628], [13690629, 14668530], [14668531, 15646432], [15646433, 16624334], [16624335, 17602236], [17602237, 18580138], [18580139, 19558053]] SRR12919335 file size 6624981 SRR12919335 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919335 SRR12919335_1.fastq SRR12919335_2.fastq Input file: SRR12919335_1.fastq Paired file: SRR12919335_2.fastq trimmed: SRR12919335-trimmed-pair1.fastq, SRR12919335-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:20:26 2025 >> started Wed Feb 12 19:20:46 2025 >> done (20.633s) 19558053 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 4335 ( 0.02%) empty read pairs filtered out after trimming by size control 19553699 (99.98%) read pairs available; of these: 1851656 ( 9.47%) trimmed read pairs available after processing 17702043 (90.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 4 0.00% 21 4 0.00% 22 5 0.00% 23 4 0.00% 24 8 0.00% 25 5 0.00% 26 8 0.00% 27 8 0.00% 28 8 0.00% 29 13 0.00% 30 12 0.00% 31 15 0.00% 32 16 0.00% 33 11 0.00% 34 26 0.00% 35 27 0.00% 36 11 0.00% 37 16 0.00% 38 13 0.00% 39 32 0.00% 40 24 0.00% 41 34 0.00% 42 26 0.00% 43 36 0.00% 44 35 0.00% 45 40 0.00% 46 36 0.00% 47 47 0.00% 48 45 0.00% 49 56 0.00% 50 75 0.00% 51 68 0.00% 52 83 0.00% 53 109 0.00% 54 85 0.00% 55 107 0.00% 56 118 0.00% 57 153 0.00% 58 159 0.00% 59 185 0.00% 60 222 0.00% 61 261 0.00% 62 287 0.00% 63 316 0.00% 64 330 0.00% 65 357 0.00% 66 381 0.00% 67 426 0.00% 68 517 0.00% 69 540 0.00% 70 674 0.00% 71 772 0.00% 72 921 0.00% 73 1036 0.01% 74 1146 0.01% 75 1246 0.01% 76 1362 0.01% 77 1472 0.01% 78 1612 0.01% 79 1826 0.01% 80 2103 0.01% 81 2459 0.01% 82 2851 0.01% 83 3175 0.02% 84 3550 0.02% 85 3860 0.02% 86 4198 0.02% 87 4530 0.02% 88 4831 0.02% 89 5356 0.03% 90 5876 0.03% 91 6479 0.03% 92 7049 0.04% 93 7940 0.04% 94 8534 0.04% 95 9327 0.05% 96 9978 0.05% 97 10384 0.05% 98 10870 0.06% 99 11789 0.06% 100 12278 0.06% 101 12984 0.07% 102 14388 0.07% 103 15227 0.08% 104 16084 0.08% 105 17279 0.09% 106 17797 0.09% 107 18443 0.09% 108 19188 0.10% 109 19990 0.10% 110 20084 0.10% 111 21353 0.11% 112 22161 0.11% 113 23195 0.12% 114 24626 0.13% 115 25780 0.13% 116 26368 0.13% 117 26827 0.14% 118 28154 0.14% 119 28244 0.14% 120 28595 0.15% 121 29758 0.15% 122 30583 0.16% 123 32085 0.16% 124 33347 0.17% 125 33986 0.17% 126 35360 0.18% 127 35863 0.18% 128 36119 0.18% 129 36737 0.19% 130 37883 0.19% 131 37969 0.19% 132 39190 0.20% 133 40249 0.21% 134 40536 0.21% 135 42599 0.22% 136 43612 0.22% 137 43652 0.22% 138 44895 0.23% 139 45614 0.23% 140 45434 0.23% 141 46370 0.24% 142 47361 0.24% 143 47903 0.24% 144 49849 0.25% 145 51148 0.26% 146 50899 0.26% 147 52312 0.27% 148 52414 0.27% 149 52769 0.27% 150 53497 0.27% 151 17702043 90.53% 19553699 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=5.40 fanout-score-rank=26 prefix-density=0.61 prefix-fanout=3.7 sequence=CATCTTCTCATCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=7 fanout-score=100.80 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=18.7 sequence=CTTCTTCAATTCCACTAGATCATGGT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=29 prefix-density=0.25 prefix-fanout=2.5 sequence=TCCTTACTCTTCATGGCGACTATTTCTCCTTGCGCTTTCTCTATGAGGGAAATCCCACTCACCTCTGATGGCGTTGATGAGATCGCTACTAGTAATACCAAGAACATTCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=93.27 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=6.4 sequence=AGAAAAGATAAGCTAGGCAAGATGGTTTTACTAGACAAGATGTGGGATGATGTTGTTGCTGGACCTCAGCCAGAACGTGGCCTTGGCAAGCTTAGAAAGATCAGCACCAGACCACTTAACATCAAAGATATTGACGTCGGAGAGGGGAGCAGTCCTGTTAATAAGTTTCAGAGGTCCATGACTATGCCAGGAACTCCAGGGACACCGACGACACCAGTGACCCCTACAACCCCAGTGTCGGCGCGTAGCAATGTTTGGAGGAGCGTGTTCCACCCTGGTAGCAACCTTGCTACTAAGAATATTGGTGCTCATGTTTTTGACAAGCCACAGCCTAACACACCCACTGTCTATGACTGGATGTACAGTGGAGAGACGAAGAGCGAGCATCGTTGATGAGGT SRR12919335 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:21:29 Started mapping on | Feb 12 19:21:29 Finished on | Feb 12 19:23:43 Mapping speed, Million of reads per hour | 525.32 Number of input reads | 19553699 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18231441 Uniquely mapped reads % | 93.24% Average mapped length | 296.17 Number of splices: Total | 17661588 Number of splices: Annotated (sjdb) | 17267793 Number of splices: GT/AG | 17352331 Number of splices: GC/AG | 232599 Number of splices: AT/AC | 19994 Number of splices: Non-canonical | 56664 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 559078 % of reads mapped to multiple loci | 2.86% Number of reads mapped to too many loci | 95242 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.23% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 763180 763180 763180 N_multimapping 559078 559078 559078 N_noFeature 608462 17945589 749313 N_ambiguous 254155 1159 108605 UnstrandedReadsAssigned:17368824 PositiveStrandReadsAssigned:284693 NegativeStrandReadsAssigned:17373523 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919335 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919335-trimmed-pair1.fastq SRR12919335-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,553,699 reads, 17,432,384 reads pseudoaligned [quant] estimated average fragment length: 263.795 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,069 rounds 52401 SRR12919335.ke.tsv 34699 SRR12919335.se.tsv 87100 total ==> SRR12919335.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.2 1118 34.6443 Potri.005G024800.1.v4.1 1035 772.205 653 45.9937 Potri.004G059700.1.v4.1 961 698.348 21 1.63555 Potri.007G009000.2.v4.1 1416 1153.2 0 0 Potri.003G141000.2.v4.1 2943 2680.2 704.297 14.2924 Potri.016G087400.1.v4.1 270 81.8729 1067 708.829 Potri.015G069301.1.v4.1 564 313.506 0 0 Potri.010G195200.1.v4.1 1773 1510.2 387.922 13.9709 Potri.012G127500.1.v4.1 977 714.264 13961 1063.1 ==> SRR12919335.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 25 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 325 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 104 SRR12919335 completed mapping pipeline successfully