Starting /dee2/code/volunteer_pipeline.sh SRR12919336 current disk space = 3050914471936 free memory = 1576950880 SRR12919336 SRAfilesize 013d26c3839ea26bfe3dfb2f12bc9a3d SRR12919336.sra SRR12919336.sra file validated SRR12919336 is paired end SRR12919336 is conventional basespace SRR12919336 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919336_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5145 37.0 37.0 37.0 37.0 37.0 2 36.43 37.0 37.0 37.0 37.0 37.0 3 36.6255 37.0 37.0 37.0 37.0 37.0 4 36.6285 37.0 37.0 37.0 37.0 37.0 5 36.6125 37.0 37.0 37.0 37.0 37.0 6 36.6735 37.0 37.0 37.0 37.0 37.0 7 36.6465 37.0 37.0 37.0 37.0 37.0 8 36.744 37.0 37.0 37.0 37.0 37.0 9 36.7165 37.0 37.0 37.0 37.0 37.0 10-14 36.6802 37.0 37.0 37.0 37.0 37.0 15-19 36.6493 37.0 37.0 37.0 37.0 37.0 20-24 36.6169 37.0 37.0 37.0 37.0 37.0 25-29 36.561899999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.518100000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.5245 37.0 37.0 37.0 37.0 37.0 40-44 36.526 37.0 37.0 37.0 37.0 37.0 45-49 36.498400000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.4693 37.0 37.0 37.0 37.0 37.0 55-59 36.500600000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.3945 37.0 37.0 37.0 37.0 37.0 65-69 36.3572 37.0 37.0 37.0 37.0 37.0 70-74 36.3512 37.0 37.0 37.0 37.0 37.0 75-79 36.322199999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.3332 37.0 37.0 37.0 37.0 37.0 85-89 36.2509 37.0 37.0 37.0 37.0 37.0 90-94 36.232299999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.220600000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.204499999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1443 37.0 37.0 37.0 37.0 37.0 110-114 36.0772 37.0 37.0 37.0 37.0 37.0 115-119 36.0681 37.0 37.0 37.0 37.0 37.0 120-124 36.0924 37.0 37.0 37.0 37.0 37.0 125-129 35.9516 37.0 37.0 37.0 37.0 37.0 130-134 35.9928 37.0 37.0 37.0 37.0 37.0 135-139 35.8486 37.0 37.0 37.0 37.0 37.0 140-144 35.7613 37.0 37.0 37.0 37.0 37.0 145-149 35.75750000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.62925 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 2.0 24 4.0 25 2.0 26 4.0 27 10.0 28 5.0 29 14.0 30 23.0 31 33.0 32 46.0 33 53.0 34 113.0 35 321.0 36 2909.0 37 458.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.275 14.075 6.45 41.199999999999996 2 19.90950226244344 12.97134238310709 36.425339366515836 30.693815987933636 3 16.35 18.175 27.975 37.5 4 20.925 24.4 26.275 28.4 5 22.775000000000002 29.775000000000002 25.4 22.05 6 20.95 35.175 23.3 20.575 7 15.375 26.6 41.75 16.275000000000002 8 17.849999999999998 26.25 31.324999999999996 24.575 9 18.35 24.825 35.525 21.3 10-14 19.265 29.43 27.944999999999997 23.36 15-19 19.27 28.794999999999998 28.155 23.78 20-24 19.32 28.555000000000003 28.315 23.810000000000002 25-29 19.365 28.99 28.544999999999998 23.1 30-34 19.85 27.97 28.535 23.645 35-39 19.73 29.32 27.88 23.07 40-44 19.895 29.215000000000003 27.384999999999998 23.505000000000003 45-49 20.195 28.599999999999998 27.584999999999997 23.62 50-54 20.31 28.249999999999996 27.994999999999997 23.445 55-59 20.1 29.28 26.900000000000002 23.72 60-64 19.615 29.005 27.139999999999997 24.240000000000002 65-69 20.075000000000003 28.185 28.345 23.395 70-74 19.5 28.96 28.075 23.465 75-79 19.814999999999998 28.775000000000002 27.400000000000002 24.01 80-84 20.745 28.294999999999998 27.235 23.724999999999998 85-89 19.955000000000002 29.14 27.389999999999997 23.515 90-94 19.885 28.175 27.860000000000003 24.08 95-99 20.419999999999998 28.71 27.37 23.5 100-104 19.830000000000002 28.165000000000003 28.03 23.974999999999998 105-109 20.445 28.21 27.405 23.94 110-114 20.8 28.665000000000003 27.029999999999998 23.505000000000003 115-119 20.485 29.509999999999998 26.55 23.455000000000002 120-124 20.044999999999998 28.735 26.795 24.425 125-129 20.805 28.005000000000003 27.38 23.810000000000002 130-134 20.75 28.765 26.96 23.525 135-139 20.48 28.53 27.250000000000004 23.74 140-144 20.064999999999998 28.155 27.365000000000002 24.415 145-149 20.69 28.365000000000002 27.125 23.82 150-151 21.025 27.737499999999997 27.725 23.5125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 2.0 21 2.0 22 1.0 23 1.0 24 1.0 25 3.0 26 5.0 27 6.5 28 10.0 29 14.5 30 15.0 31 23.0 32 44.0 33 49.5 34 52.5 35 72.0 36 95.5 37 109.5 38 121.5 39 162.5 40 212.5 41 243.5 42 248.5 43 224.0 44 255.0 45 285.0 46 273.0 47 266.5 48 226.5 49 184.5 50 166.5 51 156.0 52 122.5 53 88.0 54 60.5 55 39.5 56 35.0 57 31.0 58 21.0 59 13.0 60 11.0 61 10.0 62 8.5 63 6.0 64 7.5 65 4.5 66 0.5 67 2.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5499999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.3 #Duplication Level Percentage of deduplicated Percentage of total 1 89.41109852774632 78.95 2 8.861834654586637 15.65 3 1.1325028312570782 3.0 4 0.39637599093997733 1.4000000000000001 5 0.11325028312570783 0.5 6 0.028312570781426957 0.15 7 0.05662514156285391 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCATATTTACTGAAGGACTCCCTGTCTTGACATATACAATAGAAGAACC 7 0.17500000000000002 No Hit CCTGGAACCATTGTTTTCTTATCCAAGCTTCCAGCATTCCCAAAATAGAT 7 0.17500000000000002 No Hit CTTGCATCTCCTCCTATAATGTGAGCATCCATAATTCCCAGAACCAATCT 6 0.15 No Hit CCAGTTTATTTAAATTAGGAGGCCATTTATGACATATAATTTATTCTAGT 5 0.125 No Hit CGAACGTAAAAATCAGAAGTAGAACTCTTCGATCCAAAGACAACTTTGGG 5 0.125 No Hit GACTCACAAGACTCACGATCGAGGACATTCATCATCTCATCACTCACAAG 5 0.125 No Hit CCTTGGAACACCACGAAGAGCTTTTCATTTGACAAAGATGTCAAAGCTAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 1.0499999999999998 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.125 0.0 0.0 0.0 0.0 116-117 2.475 0.0 0.0 0.0 0.0 118-119 2.7125 0.0 0.0 0.0 0.0 120-121 3.0374999999999996 0.0 0.0 0.0 0.0 122-123 3.4375 0.0 0.0 0.0 0.0 124-125 3.7 0.0 0.0 0.0 0.0 126-127 3.9749999999999996 0.0 0.0 0.0 0.0 128-129 4.175000000000001 0.0 0.0 0.0 0.0 130-131 4.4625 0.0 0.0 0.0 0.0 132-133 4.775 0.0 0.0 0.0 0.0 134-135 5.1125 0.0 0.0 0.0 0.0 136-137 5.4625 0.0 0.0 0.0 0.0 138-139 5.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919336 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919336_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3725 37.0 37.0 37.0 37.0 37.0 2 36.109 37.0 37.0 37.0 37.0 37.0 3 36.3245 37.0 37.0 37.0 37.0 37.0 4 36.3085 37.0 37.0 37.0 37.0 37.0 5 36.267 37.0 37.0 37.0 37.0 37.0 6 36.281 37.0 37.0 37.0 37.0 37.0 7 36.3265 37.0 37.0 37.0 37.0 37.0 8 36.3415 37.0 37.0 37.0 37.0 37.0 9 36.3025 37.0 37.0 37.0 37.0 37.0 10-14 36.294799999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.260999999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.251 37.0 37.0 37.0 37.0 37.0 25-29 36.2385 37.0 37.0 37.0 37.0 37.0 30-34 36.1444 37.0 37.0 37.0 37.0 37.0 35-39 36.12519999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.0981 37.0 37.0 37.0 37.0 37.0 45-49 36.0764 37.0 37.0 37.0 37.0 37.0 50-54 36.02569999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.9848 37.0 37.0 37.0 37.0 37.0 60-64 35.985299999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.9618 37.0 37.0 37.0 37.0 37.0 70-74 35.9442 37.0 37.0 37.0 37.0 37.0 75-79 35.9289 37.0 37.0 37.0 37.0 37.0 80-84 35.847899999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.8786 37.0 37.0 37.0 37.0 37.0 90-94 35.8255 37.0 37.0 37.0 37.0 37.0 95-99 35.8294 37.0 37.0 37.0 37.0 37.0 100-104 35.740300000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.7949 37.0 37.0 37.0 37.0 37.0 110-114 35.7727 37.0 37.0 37.0 37.0 37.0 115-119 35.6751 37.0 37.0 37.0 37.0 37.0 120-124 35.6462 37.0 37.0 37.0 37.0 37.0 125-129 35.5642 37.0 37.0 37.0 37.0 37.0 130-134 35.532799999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.3414 37.0 37.0 37.0 34.6 37.0 140-144 35.3926 37.0 37.0 37.0 37.0 37.0 145-149 35.175799999999995 37.0 37.0 37.0 29.8 37.0 150-151 34.985749999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 3.0 15 5.0 16 4.0 17 2.0 18 3.0 19 1.0 20 2.0 21 0.0 22 7.0 23 6.0 24 3.0 25 13.0 26 10.0 27 11.0 28 16.0 29 19.0 30 26.0 31 28.0 32 48.0 33 96.0 34 216.0 35 472.0 36 2712.0 37 293.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.425 25.4 10.05 26.125 2 27.825 26.125 31.075000000000003 14.975 3 20.775 28.325 31.974999999999998 18.925 4 22.575 34.0 23.65 19.775000000000002 5 22.525000000000002 37.225 22.6 17.65 6 20.225 37.95 23.025000000000002 18.8 7 20.225 22.6 38.125 19.05 8 21.65 25.624999999999996 27.625 25.1 9 22.3 24.55 30.25 22.900000000000002 10-14 23.185 29.294999999999998 27.08 20.44 15-19 23.200000000000003 28.305000000000003 28.07 20.424999999999997 20-24 23.23 28.215 27.935 20.62 25-29 23.205000000000002 28.565 27.76 20.47 30-34 22.765 28.32 28.17 20.745 35-39 23.205000000000002 28.610000000000003 27.875 20.31 40-44 23.119999999999997 28.18 28.37 20.330000000000002 45-49 23.365 27.85 27.785 21.0 50-54 23.89 27.839999999999996 28.03 20.24 55-59 23.49 27.99 28.01 20.51 60-64 23.74 27.415 27.994999999999997 20.849999999999998 65-69 23.875 28.59 27.575 19.96 70-74 23.62 27.955000000000002 28.84 19.585 75-79 24.015 28.265 27.43 20.29 80-84 23.405 27.49 28.265 20.84 85-89 24.195 27.725 27.42 20.66 90-94 24.0 27.935 28.225 19.84 95-99 24.03 27.58 27.96 20.43 100-104 23.815 28.24 28.185 19.759999999999998 105-109 24.11 27.384999999999998 28.294999999999998 20.21 110-114 23.76 27.97 27.389999999999997 20.880000000000003 115-119 23.68 28.485 27.62 20.215 120-124 24.89 27.750000000000004 27.46 19.900000000000002 125-129 24.315 28.549999999999997 27.465 19.67 130-134 25.1 27.905 27.125 19.869999999999997 135-139 24.25 27.705000000000002 28.12 19.925 140-144 25.580000000000002 27.925 26.805 19.689999999999998 145-149 25.21 28.375 27.275 19.139999999999997 150-151 25.775 27.3 26.950000000000003 19.975 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 2.0 21 1.5 22 1.5 23 1.0 24 1.5 25 3.5 26 4.5 27 7.0 28 9.5 29 12.5 30 18.5 31 19.5 32 26.0 33 37.0 34 43.0 35 62.5 36 88.5 37 109.0 38 137.0 39 190.5 40 228.0 41 237.0 42 240.0 43 252.5 44 278.5 45 296.0 46 271.0 47 227.0 48 220.0 49 206.5 50 156.0 51 126.0 52 116.5 53 90.5 54 65.0 55 47.0 56 35.5 57 29.5 58 22.0 59 13.5 60 10.5 61 8.5 62 8.0 63 6.0 64 2.5 65 2.0 66 3.0 67 1.5 68 1.0 69 1.5 70 0.5 71 0.5 72 2.0 73 1.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 1.0 83 1.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.94999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 89.74142776840922 79.825 2 8.628442945474985 15.35 3 1.1523327712197864 3.075 4 0.44969083754918493 1.6 5 0.0 0.0 6 0.028105677346824058 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCCAACATCCATGCATTAAGTATAACAGCACATAAGTGTTTGGTGCGTA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 1.0499999999999998 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.125 0.0 0.0 0.0 0.0 116-117 2.475 0.0 0.0 0.0 0.0 118-119 2.7125 0.0 0.0 0.0 0.0 120-121 3.0374999999999996 0.0 0.0 0.0 0.0 122-123 3.4625 0.0 0.0 0.0 0.0 124-125 3.7249999999999996 0.0 0.0 0.0 0.0 126-127 4.012499999999999 0.0 0.0 0.0 0.0 128-129 4.25 0.0 0.0 0.0 0.0 130-131 4.5625 0.0 0.0 0.0 0.0 132-133 4.8875 0.0 0.0 0.0 0.0 134-135 5.2375 0.0 0.0 0.0 0.0 136-137 5.5875 0.0 0.0 0.0 0.0 138-139 6.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 946910 spots for SRR12919336.sra Written 946910 spots for SRR12919336.sra Read 946910 spots for SRR12919336.sra Written 946910 spots for SRR12919336.sra Read 946910 spots for SRR12919336.sra Written 946910 spots for SRR12919336.sra Read 946910 spots for SRR12919336.sra Written 946910 spots for SRR12919336.sra Read 946910 spots for SRR12919336.sra Written 946910 spots for SRR12919336.sra Read 946910 spots for SRR12919336.sra Written 946910 spots for SRR12919336.sra Read 946910 spots for SRR12919336.sra Written 946910 spots for SRR12919336.sra Read 946910 spots for SRR12919336.sra Written 946910 spots for SRR12919336.sra Read 946910 spots for SRR12919336.sra Written 946910 spots for SRR12919336.sra Read 946910 spots for SRR12919336.sra Written 946910 spots for SRR12919336.sra Read 946910 spots for SRR12919336.sra Written 946910 spots for SRR12919336.sra Read 946912 spots for SRR12919336.sra Written 946912 spots for SRR12919336.sra Read 946910 spots for SRR12919336.sra Written 946910 spots for SRR12919336.sra Read 946910 spots for SRR12919336.sra Written 946910 spots for SRR12919336.sra Read 946910 spots for SRR12919336.sra Written 946910 spots for SRR12919336.sra Read 946910 spots for SRR12919336.sra Written 946910 spots for SRR12919336.sra Read 946910 spots for SRR12919336.sra Written 946910 spots for SRR12919336.sra Read 946910 spots for SRR12919336.sra Written 946910 spots for SRR12919336.sra Read 946910 spots for SRR12919336.sra Written 946910 spots for SRR12919336.sra Read 946910 spots for SRR12919336.sra Written 946910 spots for SRR12919336.sra SRR ids: ['SRR12919336.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sm1ddsra SRR12919336.sra spots: 18938202 blocks: [[1, 946910], [946911, 1893820], [1893821, 2840730], [2840731, 3787640], [3787641, 4734550], [4734551, 5681460], [5681461, 6628370], [6628371, 7575280], [7575281, 8522190], [8522191, 9469100], [9469101, 10416010], [10416011, 11362920], [11362921, 12309830], [12309831, 13256740], [13256741, 14203650], [14203651, 15150560], [15150561, 16097470], [16097471, 17044380], [17044381, 17991290], [17991291, 18938202]] SRR12919336 file size 6414329 SRR12919336 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919336 SRR12919336_1.fastq SRR12919336_2.fastq Input file: SRR12919336_1.fastq Paired file: SRR12919336_2.fastq trimmed: SRR12919336-trimmed-pair1.fastq, SRR12919336-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:37:09 2025 >> started Wed Feb 12 19:37:30 2025 >> done (20.500s) 18938202 read pairs processed; of these: 30 ( 0.00%) short read pairs filtered out after trimming by size control 674 ( 0.00%) empty read pairs filtered out after trimming by size control 18937498 (100.00%) read pairs available; of these: 1829908 ( 9.66%) trimmed read pairs available after processing 17107590 (90.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 5 0.00% 21 8 0.00% 22 7 0.00% 23 6 0.00% 24 7 0.00% 25 5 0.00% 26 7 0.00% 27 14 0.00% 28 7 0.00% 29 3 0.00% 30 7 0.00% 31 14 0.00% 32 15 0.00% 33 18 0.00% 34 12 0.00% 35 19 0.00% 36 17 0.00% 37 21 0.00% 38 19 0.00% 39 21 0.00% 40 26 0.00% 41 26 0.00% 42 28 0.00% 43 13 0.00% 44 32 0.00% 45 30 0.00% 46 27 0.00% 47 37 0.00% 48 41 0.00% 49 40 0.00% 50 62 0.00% 51 63 0.00% 52 61 0.00% 53 48 0.00% 54 68 0.00% 55 78 0.00% 56 82 0.00% 57 100 0.00% 58 125 0.00% 59 147 0.00% 60 162 0.00% 61 206 0.00% 62 217 0.00% 63 227 0.00% 64 291 0.00% 65 256 0.00% 66 311 0.00% 67 368 0.00% 68 406 0.00% 69 469 0.00% 70 557 0.00% 71 640 0.00% 72 793 0.00% 73 939 0.00% 74 950 0.01% 75 1090 0.01% 76 1205 0.01% 77 1327 0.01% 78 1565 0.01% 79 1662 0.01% 80 1935 0.01% 81 2232 0.01% 82 2676 0.01% 83 2794 0.01% 84 3350 0.02% 85 3739 0.02% 86 3978 0.02% 87 4129 0.02% 88 4645 0.02% 89 4892 0.03% 90 5460 0.03% 91 6237 0.03% 92 6757 0.04% 93 7527 0.04% 94 8181 0.04% 95 8712 0.05% 96 9512 0.05% 97 10088 0.05% 98 10620 0.06% 99 11249 0.06% 100 11748 0.06% 101 12556 0.07% 102 13951 0.07% 103 14717 0.08% 104 15757 0.08% 105 16808 0.09% 106 17484 0.09% 107 18081 0.10% 108 19123 0.10% 109 19240 0.10% 110 20051 0.11% 111 21120 0.11% 112 21923 0.12% 113 23086 0.12% 114 24431 0.13% 115 25632 0.14% 116 26170 0.14% 117 26765 0.14% 118 27602 0.15% 119 27726 0.15% 120 28677 0.15% 121 29130 0.15% 122 30315 0.16% 123 31554 0.17% 124 33009 0.17% 125 34280 0.18% 126 35416 0.19% 127 35483 0.19% 128 36202 0.19% 129 36628 0.19% 130 37393 0.20% 131 37989 0.20% 132 38724 0.20% 133 39848 0.21% 134 41071 0.22% 135 42470 0.22% 136 42847 0.23% 137 43880 0.23% 138 44339 0.23% 139 44686 0.24% 140 45270 0.24% 141 46139 0.24% 142 47758 0.25% 143 47506 0.25% 144 50541 0.27% 145 50838 0.27% 146 51892 0.27% 147 52091 0.28% 148 51756 0.27% 149 52127 0.28% 150 52354 0.28% 151 17107590 90.34% 18937498 reads passed initial QC criterion=sequence-density sequence-density=1.43 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=14 prefix-density=2.21 prefix-fanout=1.9 sequence=AAGACTCACGATCGAGGACATTCAT criterion=fanout-score sequence-density=0.35 sequence-density-rank=17 fanout-score=10.71 fanout-score-rank=1 prefix-density=1.80 prefix-fanout=2.1 sequence=TGAACTTGTTTTACCAGCTACAT criterion=sequence-density sequence-density=1.44 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=26 prefix-density=1.41 prefix-fanout=2.0 sequence=TCACTTTACTTAACACTTGAGCTACATAGAATGTCTACAGTCAATTTGGCAGCACTGCTGTTGCTTGGGCTGCTGCTGGTTATGCCACAGCAGTCCATGCAAGCGAGTTTGATAGACCCCATTGCTGAAATCGAGAGAAGCAACTGCAAAATCGCACACCTTCGCTTAGGGCTTGTTTTTAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=45.69 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=1.3 sequence=GTTGCATTTCTAAAGTACTATCCGTCTGCTCAATCCACTTCACACAATGTCGAGTATCAATTTGGCA SRR12919336 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:38:22 Started mapping on | Feb 12 19:38:23 Finished on | Feb 12 19:42:01 Mapping speed, Million of reads per hour | 312.73 Number of input reads | 18937498 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16857085 Uniquely mapped reads % | 89.01% Average mapped length | 296.33 Number of splices: Total | 16376923 Number of splices: Annotated (sjdb) | 16007498 Number of splices: GT/AG | 16074831 Number of splices: GC/AG | 208288 Number of splices: AT/AC | 18219 Number of splices: Non-canonical | 75585 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 487615 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 70118 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.90% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1592798 1592798 1592798 N_multimapping 487615 487615 487615 N_noFeature 516921 16677522 597991 N_ambiguous 221168 987 122055 UnstrandedReadsAssigned:16118996 PositiveStrandReadsAssigned:178576 NegativeStrandReadsAssigned:16137039 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919336 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919336-trimmed-pair1.fastq SRR12919336-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,937,498 reads, 16,069,705 reads pseudoaligned [quant] estimated average fragment length: 267.675 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52401 SRR12919336.ke.tsv 34699 SRR12919336.se.tsv 87100 total ==> SRR12919336.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.33 633 22.5601 Potri.005G024800.1.v4.1 1035 768.325 231 18.766 Potri.004G059700.1.v4.1 961 694.421 8 0.719071 Potri.007G009000.2.v4.1 1416 1149.33 6 0.325846 Potri.003G141000.2.v4.1 2943 2676.33 501.267 11.6905 Potri.016G087400.1.v4.1 270 83.7832 1187 884.297 Potri.015G069301.1.v4.1 564 312.159 0 0 Potri.010G195200.1.v4.1 1773 1506.33 106 4.39229 Potri.012G127500.1.v4.1 977 710.37 3618 317.898 ==> SRR12919336.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 85 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 172 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 68 SRR12919336 completed mapping pipeline successfully