Starting /dee2/code/volunteer_pipeline.sh SRR12919338 current disk space = 3051044446208 free memory = 1529304836 SRR12919338 SRAfilesize 2909001a4a2cb7d07bac751237177ca8 SRR12919338.sra SRR12919338.sra file validated SRR12919338 is paired end SRR12919338 is conventional basespace SRR12919338 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919338_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5825 37.0 37.0 37.0 37.0 37.0 2 36.2885 37.0 37.0 37.0 37.0 37.0 3 36.55 37.0 37.0 37.0 37.0 37.0 4 36.589 37.0 37.0 37.0 37.0 37.0 5 36.678 37.0 37.0 37.0 37.0 37.0 6 36.629 37.0 37.0 37.0 37.0 37.0 7 36.586 37.0 37.0 37.0 37.0 37.0 8 36.6375 37.0 37.0 37.0 37.0 37.0 9 36.627 37.0 37.0 37.0 37.0 37.0 10-14 36.658699999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.6268 37.0 37.0 37.0 37.0 37.0 20-24 36.6015 37.0 37.0 37.0 37.0 37.0 25-29 36.5556 37.0 37.0 37.0 37.0 37.0 30-34 36.555899999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.5177 37.0 37.0 37.0 37.0 37.0 40-44 36.4857 37.0 37.0 37.0 37.0 37.0 45-49 36.4778 37.0 37.0 37.0 37.0 37.0 50-54 36.441599999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.405100000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.4096 37.0 37.0 37.0 37.0 37.0 65-69 36.3611 37.0 37.0 37.0 37.0 37.0 70-74 36.33579999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.3098 37.0 37.0 37.0 37.0 37.0 80-84 36.276799999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.217200000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.2014 37.0 37.0 37.0 37.0 37.0 95-99 36.2063 37.0 37.0 37.0 37.0 37.0 100-104 36.16850000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.123000000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.0711 37.0 37.0 37.0 37.0 37.0 115-119 36.06830000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.975100000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.9455 37.0 37.0 37.0 37.0 37.0 130-134 35.9163 37.0 37.0 37.0 37.0 37.0 135-139 35.7958 37.0 37.0 37.0 37.0 37.0 140-144 35.7397 37.0 37.0 37.0 37.0 37.0 145-149 35.6983 37.0 37.0 37.0 37.0 37.0 150-151 35.492 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 0.0 22 0.0 23 1.0 24 0.0 25 0.0 26 3.0 27 8.0 28 10.0 29 19.0 30 13.0 31 34.0 32 64.0 33 69.0 34 103.0 35 343.0 36 2964.0 37 367.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.75 12.075 7.124999999999999 44.05 2 18.68712273641851 13.506036217303825 37.399396378269614 30.40744466800805 3 16.375 16.900000000000002 28.499999999999996 38.224999999999994 4 20.1 25.0 25.025 29.875 5 22.85 31.1 24.125 21.925 6 21.05 33.675 23.95 21.325 7 15.125 27.375 40.2 17.299999999999997 8 16.775000000000002 27.400000000000002 30.825000000000003 25.0 9 18.025 24.25 33.7 24.025 10-14 19.28 29.849999999999998 27.67 23.200000000000003 15-19 19.785 27.74 28.189999999999998 24.285 20-24 19.93 28.38 27.965 23.724999999999998 25-29 19.955000000000002 28.03 27.889999999999997 24.125 30-34 19.965 28.939999999999998 26.965 24.13 35-39 19.72 28.560000000000002 27.575 24.145 40-44 19.57 28.24 28.000000000000004 24.19 45-49 19.865 28.895 27.584999999999997 23.655 50-54 19.535 28.470000000000002 27.765 24.23 55-59 19.955000000000002 29.01 27.400000000000002 23.635 60-64 20.09 27.939999999999998 27.755000000000003 24.215 65-69 19.45 28.970000000000002 28.055000000000003 23.525 70-74 20.215 28.615000000000002 28.16 23.01 75-79 19.895 27.779999999999998 28.42 23.905 80-84 19.5 27.68 28.48 24.34 85-89 20.26 27.894999999999996 27.825 24.02 90-94 20.225 27.97 27.91 23.895 95-99 19.97 28.395 27.415 24.22 100-104 19.96 27.744999999999997 28.525 23.77 105-109 20.895 27.950000000000003 27.694999999999997 23.46 110-114 20.665 28.125 27.525 23.685000000000002 115-119 20.119999999999997 28.535 27.615000000000002 23.73 120-124 21.385 28.235 27.200000000000003 23.18 125-129 20.465 28.194999999999997 27.625 23.715 130-134 21.115000000000002 27.794999999999998 27.310000000000002 23.78 135-139 20.419999999999998 27.62 28.1 23.86 140-144 21.12 28.249999999999996 26.625 24.005000000000003 145-149 21.4 27.815 27.255000000000003 23.53 150-151 20.837500000000002 28.325 27.800000000000004 23.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 2.0 23 1.5 24 3.0 25 5.0 26 5.5 27 8.5 28 11.5 29 14.5 30 16.5 31 26.0 32 35.0 33 38.5 34 41.0 35 60.0 36 81.5 37 96.5 38 137.0 39 170.0 40 196.0 41 223.0 42 246.5 43 261.5 44 261.5 45 272.5 46 268.0 47 251.5 48 225.5 49 207.5 50 188.5 51 137.5 52 108.5 53 94.0 54 76.0 55 52.0 56 35.5 57 29.0 58 20.5 59 20.0 60 20.0 61 11.5 62 9.5 63 10.5 64 5.0 65 5.0 66 3.5 67 1.5 68 1.0 69 0.5 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.6 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.07499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.35328026351908 83.2 2 7.71342300301949 14.05 3 0.7685973099094153 2.1 4 0.1372495196266813 0.5 5 0.0 0.0 6 0.02744990392533626 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCAGACGCCGCCGTCGCCGCTGCCCTTTTTGAGGAGGTTGCTGCTGCTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.38749999999999996 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.2625000000000002 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114-115 1.6375000000000002 0.0 0.0 0.0 0.0 116-117 1.9249999999999998 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.5 0.0 0.0 0.0 0.0 122-123 2.8 0.0 0.0 0.0 0.0 124-125 3.275 0.0 0.0 0.0 0.0 126-127 3.8 0.0 0.0 0.0 0.0 128-129 4.15 0.0 0.0 0.0 0.0 130-131 4.75 0.0 0.0 0.0 0.0 132-133 5.175 0.0 0.0 0.0 0.0 134-135 5.612500000000001 0.0 0.0 0.0 0.0 136-137 6.15 0.0 0.0 0.0 0.0 138-139 6.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919338 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919338_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.357 37.0 37.0 37.0 37.0 37.0 2 36.2995 37.0 37.0 37.0 37.0 37.0 3 36.3185 37.0 37.0 37.0 37.0 37.0 4 36.37 37.0 37.0 37.0 37.0 37.0 5 36.3545 37.0 37.0 37.0 37.0 37.0 6 36.343 37.0 37.0 37.0 37.0 37.0 7 36.291 37.0 37.0 37.0 37.0 37.0 8 36.481 37.0 37.0 37.0 37.0 37.0 9 36.4195 37.0 37.0 37.0 37.0 37.0 10-14 36.3782 37.0 37.0 37.0 37.0 37.0 15-19 36.365300000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.370900000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.2718 37.0 37.0 37.0 37.0 37.0 30-34 36.262699999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.287 37.0 37.0 37.0 37.0 37.0 40-44 36.265100000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.218900000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.1489 37.0 37.0 37.0 37.0 37.0 55-59 36.154399999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.114799999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.1294 37.0 37.0 37.0 37.0 37.0 70-74 36.092699999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.001 37.0 37.0 37.0 37.0 37.0 80-84 36.01610000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.979200000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.9307 37.0 37.0 37.0 37.0 37.0 95-99 35.9394 37.0 37.0 37.0 37.0 37.0 100-104 35.9113 37.0 37.0 37.0 37.0 37.0 105-109 35.870999999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.7821 37.0 37.0 37.0 37.0 37.0 115-119 35.7626 37.0 37.0 37.0 37.0 37.0 120-124 35.7744 37.0 37.0 37.0 37.0 37.0 125-129 35.7385 37.0 37.0 37.0 37.0 37.0 130-134 35.7014 37.0 37.0 37.0 37.0 37.0 135-139 35.5616 37.0 37.0 37.0 37.0 37.0 140-144 35.5259 37.0 37.0 37.0 37.0 37.0 145-149 35.4203 37.0 37.0 37.0 37.0 37.0 150-151 35.17075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 0.0 17 0.0 18 3.0 19 1.0 20 2.0 21 3.0 22 3.0 23 3.0 24 4.0 25 4.0 26 8.0 27 10.0 28 13.0 29 21.0 30 21.0 31 39.0 32 53.0 33 87.0 34 183.0 35 535.0 36 2655.0 37 350.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.225 25.174999999999997 10.2 29.4 2 26.674999999999997 27.325 30.675 15.325 3 18.05 28.675 32.1 21.175 4 22.75 35.35 23.549999999999997 18.35 5 23.925 36.85 22.2 17.025000000000002 6 20.575 39.025 21.975 18.425 7 21.099999999999998 21.7 37.475 19.725 8 20.4 25.525 28.725 25.35 9 21.65 25.1 30.525000000000002 22.725 10-14 22.395 30.42 26.619999999999997 20.565 15-19 22.925 28.675 27.58 20.82 20-24 22.6 28.365000000000002 27.88 21.154999999999998 25-29 23.095 28.165000000000003 27.91 20.830000000000002 30-34 22.955000000000002 28.625 26.97 21.45 35-39 22.41 28.425 27.74 21.425 40-44 23.185 28.215 27.779999999999998 20.82 45-49 22.49 28.994999999999997 27.485 21.029999999999998 50-54 22.985 27.534999999999997 28.735 20.745 55-59 22.900000000000002 28.720000000000002 27.400000000000002 20.979999999999997 60-64 22.470000000000002 28.22 28.355000000000004 20.955 65-69 23.07 27.865000000000002 28.189999999999998 20.875 70-74 22.865 28.43 28.305000000000003 20.4 75-79 23.785 27.785 27.88 20.549999999999997 80-84 23.25 28.345 27.96 20.445 85-89 23.830000000000002 28.610000000000003 27.615000000000002 19.945 90-94 23.615 28.76 27.36 20.265 95-99 23.615 27.894999999999996 27.944999999999997 20.544999999999998 100-104 23.735 29.160000000000004 27.224999999999998 19.88 105-109 23.76 28.144999999999996 27.675 20.419999999999998 110-114 24.03 27.589999999999996 27.435 20.945 115-119 24.54 28.53 27.295 19.634999999999998 120-124 24.035 28.935 27.6 19.43 125-129 23.89 27.935 28.115000000000002 20.06 130-134 25.06 28.410000000000004 26.86 19.67 135-139 25.285000000000004 27.955000000000002 27.175 19.585 140-144 25.3 28.51 26.625 19.564999999999998 145-149 25.81 28.294999999999998 26.72 19.175 150-151 25.474999999999998 28.275 26.6 19.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 1.5 20 1.5 21 2.0 22 2.5 23 2.0 24 4.5 25 6.5 26 4.5 27 5.5 28 9.0 29 11.0 30 15.5 31 20.0 32 32.0 33 45.0 34 50.5 35 60.0 36 84.5 37 121.0 38 155.5 39 178.5 40 199.0 41 230.5 42 259.0 43 270.0 44 283.0 45 289.5 46 273.5 47 238.0 48 205.0 49 179.5 50 160.0 51 136.0 52 107.0 53 81.5 54 59.0 55 51.0 56 33.5 57 24.5 58 24.0 59 18.5 60 14.5 61 9.5 62 10.0 63 9.5 64 3.0 65 2.0 66 2.0 67 0.0 68 1.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.07499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.38073016744441 83.22500000000001 2 7.658523195168816 13.950000000000001 3 0.7960472138347515 2.175 4 0.1372495196266813 0.5 5 0.0 0.0 6 0.02744990392533626 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTACATCAAGCCCTAGATACCTCCATCTCCCCTCCTCCGATCTCTCTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.38749999999999996 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.2625000000000002 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.6625 0.0 0.0 0.0 0.0 116-117 1.95 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.5250000000000004 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.3 0.0 0.0 0.0 0.0 126-127 3.8125 0.0 0.0 0.0 0.0 128-129 4.175000000000001 0.0 0.0 0.0 0.0 130-131 4.775 0.0 0.0 0.0 0.0 132-133 5.175 0.0 0.0 0.0 0.0 134-135 5.612500000000001 0.0 0.0 0.0 0.0 136-137 6.125 0.0 0.0 0.0 0.0 138-139 6.574999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 880636 spots for SRR12919338.sra Written 880636 spots for SRR12919338.sra Read 880636 spots for SRR12919338.sra Written 880636 spots for SRR12919338.sra Read 880636 spots for SRR12919338.sra Written 880636 spots for SRR12919338.sra Read 880636 spots for SRR12919338.sra Written 880636 spots for SRR12919338.sra Read 880636 spots for SRR12919338.sra Written 880636 spots for SRR12919338.sra Read 880636 spots for SRR12919338.sra Written 880636 spots for SRR12919338.sra Read 880636 spots for SRR12919338.sra Written 880636 spots for SRR12919338.sra Read 880636 spots for SRR12919338.sra Written 880636 spots for SRR12919338.sra Read 880636 spots for SRR12919338.sra Written 880636 spots for SRR12919338.sra Read 880636 spots for SRR12919338.sra Written 880636 spots for SRR12919338.sra Read 880636 spots for SRR12919338.sra Written 880636 spots for SRR12919338.sra Read 880636 spots for SRR12919338.sra Written 880636 spots for SRR12919338.sra Read 880636 spots for SRR12919338.sra Written 880636 spots for SRR12919338.sra Read 880636 spots for SRR12919338.sra Written 880636 spots for SRR12919338.sra Read 880636 spots for SRR12919338.sra Written 880636 spots for SRR12919338.sra Read 880636 spots for SRR12919338.sra Written 880636 spots for SRR12919338.sra Read 880636 spots for SRR12919338.sra Written 880636 spots for SRR12919338.sra Read 880644 spots for SRR12919338.sra Written 880644 spots for SRR12919338.sra Read 880636 spots for SRR12919338.sra Written 880636 spots for SRR12919338.sra Read 880636 spots for SRR12919338.sra Written 880636 spots for SRR12919338.sra SRR ids: ['SRR12919338.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j4byl9vv SRR12919338.sra spots: 17612728 blocks: [[1, 880636], [880637, 1761272], [1761273, 2641908], [2641909, 3522544], [3522545, 4403180], [4403181, 5283816], [5283817, 6164452], [6164453, 7045088], [7045089, 7925724], [7925725, 8806360], [8806361, 9686996], [9686997, 10567632], [10567633, 11448268], [11448269, 12328904], [12328905, 13209540], [13209541, 14090176], [14090177, 14970812], [14970813, 15851448], [15851449, 16732084], [16732085, 17612728]] SRR12919338 file size 5963875 SRR12919338 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919338 SRR12919338_1.fastq SRR12919338_2.fastq Input file: SRR12919338_1.fastq Paired file: SRR12919338_2.fastq trimmed: SRR12919338-trimmed-pair1.fastq, SRR12919338-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:30:47 2025 >> started Wed Feb 12 19:31:06 2025 >> done (18.625s) 17612728 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 389 ( 0.00%) empty read pairs filtered out after trimming by size control 17612316 (100.00%) read pairs available; of these: 1721237 ( 9.77%) trimmed read pairs available after processing 15891079 (90.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 5 0.00% 22 3 0.00% 23 5 0.00% 24 6 0.00% 25 7 0.00% 26 8 0.00% 27 10 0.00% 28 13 0.00% 29 5 0.00% 30 9 0.00% 31 9 0.00% 32 16 0.00% 33 7 0.00% 34 5 0.00% 35 7 0.00% 36 14 0.00% 37 13 0.00% 38 14 0.00% 39 10 0.00% 40 22 0.00% 41 15 0.00% 42 25 0.00% 43 24 0.00% 44 13 0.00% 45 19 0.00% 46 22 0.00% 47 38 0.00% 48 25 0.00% 49 33 0.00% 50 42 0.00% 51 47 0.00% 52 40 0.00% 53 48 0.00% 54 52 0.00% 55 47 0.00% 56 71 0.00% 57 77 0.00% 58 108 0.00% 59 104 0.00% 60 127 0.00% 61 162 0.00% 62 205 0.00% 63 213 0.00% 64 224 0.00% 65 224 0.00% 66 270 0.00% 67 323 0.00% 68 375 0.00% 69 437 0.00% 70 505 0.00% 71 631 0.00% 72 712 0.00% 73 801 0.00% 74 914 0.01% 75 1034 0.01% 76 1174 0.01% 77 1253 0.01% 78 1367 0.01% 79 1670 0.01% 80 1836 0.01% 81 2165 0.01% 82 2666 0.02% 83 2810 0.02% 84 3140 0.02% 85 3631 0.02% 86 3800 0.02% 87 4124 0.02% 88 4426 0.03% 89 4965 0.03% 90 5278 0.03% 91 6164 0.03% 92 6735 0.04% 93 7541 0.04% 94 8425 0.05% 95 8970 0.05% 96 9325 0.05% 97 10125 0.06% 98 10284 0.06% 99 11023 0.06% 100 11746 0.07% 101 12272 0.07% 102 13097 0.07% 103 14292 0.08% 104 15592 0.09% 105 16141 0.09% 106 17040 0.10% 107 17585 0.10% 108 18030 0.10% 109 18557 0.11% 110 18953 0.11% 111 19953 0.11% 112 21272 0.12% 113 22185 0.13% 114 23440 0.13% 115 24351 0.14% 116 25119 0.14% 117 25705 0.15% 118 26409 0.15% 119 26470 0.15% 120 26645 0.15% 121 27957 0.16% 122 28494 0.16% 123 29788 0.17% 124 30816 0.17% 125 32390 0.18% 126 33413 0.19% 127 34041 0.19% 128 34349 0.20% 129 34195 0.19% 130 35262 0.20% 131 35427 0.20% 132 36752 0.21% 133 37762 0.21% 134 38019 0.22% 135 39602 0.22% 136 40689 0.23% 137 40799 0.23% 138 41372 0.23% 139 41208 0.23% 140 42206 0.24% 141 42983 0.24% 142 43460 0.25% 143 43817 0.25% 144 44936 0.26% 145 46353 0.26% 146 47145 0.27% 147 47565 0.27% 148 47824 0.27% 149 47917 0.27% 150 48744 0.28% 151 15891079 90.23% 17612316 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=15.64 fanout-score-rank=13 prefix-density=0.32 prefix-fanout=7.3 sequence=TTCTTGATAAATTTCTTAATCTGTGTAAGAAACTGCTTCTTGTCAAATGGAGGTTGCTCCTGGAGCCTAAATGTGTCAACGATGTCAACAACCTTGGCAGCTTGGTCATCAACACCCTCATCCTCATCACCTCCTTCAGCTGAAGGATTTGCACCAATGTCTACATCAACGGCTCCTTGAACAACCCACTTTCCTTCAACTTCCCACAGTATCCCATTCTCAATCTCCTTGTATGGGAACGAATCCGAGAGAAGCTCATCACCAGAGAGAAGATCTTGATAGACCAACATGATTGCGCAGAAGAGCTCCTCTCTTTCGGATCGACCCAAAGACAGACAAAGAAGCAGCGATTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=215.48 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=27.0 sequence=TCATCTTCATCA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=30 prefix-density=0.19 prefix-fanout=2.8 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.08 sequence-density-rank=15 fanout-score=374.06 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=32.5 sequence=AAGAAGAAGAAA SRR12919338 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:31:50 Started mapping on | Feb 12 19:31:51 Finished on | Feb 12 19:34:09 Mapping speed, Million of reads per hour | 459.45 Number of input reads | 17612316 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16300029 Uniquely mapped reads % | 92.55% Average mapped length | 296.00 Number of splices: Total | 15589041 Number of splices: Annotated (sjdb) | 15216730 Number of splices: GT/AG | 15300656 Number of splices: GC/AG | 225366 Number of splices: AT/AC | 17700 Number of splices: Non-canonical | 45319 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.02 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 421773 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 55533 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.61% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 890514 890514 890514 N_multimapping 421773 421773 421773 N_noFeature 620762 16106352 720583 N_ambiguous 192406 1050 97890 UnstrandedReadsAssigned:15486861 PositiveStrandReadsAssigned:192627 NegativeStrandReadsAssigned:15481556 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919338 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919338-trimmed-pair1.fastq SRR12919338-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,612,316 reads, 15,519,419 reads pseudoaligned [quant] estimated average fragment length: 272.833 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR12919338.ke.tsv 34699 SRR12919338.se.tsv 87100 total ==> SRR12919338.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.17 869 32.9014 Potri.005G024800.1.v4.1 1035 763.167 205 17.7588 Potri.004G059700.1.v4.1 961 689.442 30 2.87676 Potri.007G009000.2.v4.1 1416 1144.17 2 0.115564 Potri.003G141000.2.v4.1 2943 2671.17 412.562 10.211 Potri.016G087400.1.v4.1 270 84.7298 1071 835.668 Potri.015G069301.1.v4.1 564 311.927 0 0 Potri.010G195200.1.v4.1 1773 1501.17 72 3.17091 Potri.012G127500.1.v4.1 977 705.307 7382 691.953 ==> SRR12919338.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 191 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 186 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR12919338 completed mapping pipeline successfully