Starting /dee2/code/volunteer_pipeline.sh SRR12919339 current disk space = 3051155722240 free memory = 1413025480 SRR12919339 SRAfilesize fb1255bc3cbb2bc184292e030c70030a SRR12919339.sra SRR12919339.sra file validated SRR12919339 is paired end SRR12919339 is conventional basespace SRR12919339 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919339_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6415 37.0 37.0 37.0 37.0 37.0 2 36.3605 37.0 37.0 37.0 37.0 37.0 3 36.63 37.0 37.0 37.0 37.0 37.0 4 36.616 37.0 37.0 37.0 37.0 37.0 5 36.699 37.0 37.0 37.0 37.0 37.0 6 36.75 37.0 37.0 37.0 37.0 37.0 7 36.5535 37.0 37.0 37.0 37.0 37.0 8 36.6755 37.0 37.0 37.0 37.0 37.0 9 36.6415 37.0 37.0 37.0 37.0 37.0 10-14 36.6724 37.0 37.0 37.0 37.0 37.0 15-19 36.6138 37.0 37.0 37.0 37.0 37.0 20-24 36.63029999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.6169 37.0 37.0 37.0 37.0 37.0 30-34 36.575 37.0 37.0 37.0 37.0 37.0 35-39 36.5504 37.0 37.0 37.0 37.0 37.0 40-44 36.5245 37.0 37.0 37.0 37.0 37.0 45-49 36.5139 37.0 37.0 37.0 37.0 37.0 50-54 36.4567 37.0 37.0 37.0 37.0 37.0 55-59 36.4653 37.0 37.0 37.0 37.0 37.0 60-64 36.38869999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.359300000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.333 37.0 37.0 37.0 37.0 37.0 75-79 36.3326 37.0 37.0 37.0 37.0 37.0 80-84 36.3553 37.0 37.0 37.0 37.0 37.0 85-89 36.2712 37.0 37.0 37.0 37.0 37.0 90-94 36.232600000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.2351 37.0 37.0 37.0 37.0 37.0 100-104 36.25619999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.155499999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1768 37.0 37.0 37.0 37.0 37.0 115-119 36.1256 37.0 37.0 37.0 37.0 37.0 120-124 36.0799 37.0 37.0 37.0 37.0 37.0 125-129 35.970299999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.9723 37.0 37.0 37.0 37.0 37.0 135-139 35.8747 37.0 37.0 37.0 37.0 37.0 140-144 35.7476 37.0 37.0 37.0 37.0 37.0 145-149 35.7361 37.0 37.0 37.0 37.0 37.0 150-151 35.56975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 0.0 24 4.0 25 5.0 26 3.0 27 4.0 28 12.0 29 16.0 30 28.0 31 25.0 32 40.0 33 58.0 34 104.0 35 299.0 36 2962.0 37 437.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.300000000000004 13.750000000000002 6.3 33.650000000000006 2 19.763343403826788 13.192346424974824 35.57401812688822 31.47029204431017 3 16.2 19.0 28.175 36.625 4 20.599999999999998 26.650000000000002 23.75 28.999999999999996 5 22.55 31.525 24.325 21.6 6 20.45 33.650000000000006 23.95 21.95 7 16.275000000000002 25.525 41.199999999999996 17.0 8 17.2 24.625 31.775 26.400000000000002 9 17.875 24.474999999999998 32.9 24.75 10-14 19.355 29.7 27.58 23.365 15-19 20.535 27.87 27.750000000000004 23.845 20-24 19.435 29.099999999999998 27.655 23.810000000000002 25-29 19.775000000000002 29.360000000000003 27.3 23.565 30-34 19.939999999999998 29.015 27.310000000000002 23.735 35-39 19.63 27.994999999999997 28.305000000000003 24.07 40-44 19.82 29.075 27.72 23.385 45-49 20.055 28.315 27.185 24.445 50-54 19.580000000000002 28.615000000000002 27.82 23.985 55-59 19.919999999999998 28.799999999999997 27.575 23.705000000000002 60-64 19.665 28.665000000000003 27.685 23.985 65-69 19.869999999999997 28.48 27.97 23.68 70-74 19.77 28.249999999999996 28.060000000000002 23.919999999999998 75-79 19.98 28.375 27.36 24.285 80-84 19.955000000000002 27.884999999999998 28.345 23.815 85-89 20.805 28.225 27.465 23.505000000000003 90-94 21.279999999999998 27.889999999999997 27.169999999999998 23.66 95-99 19.98 28.189999999999998 28.02 23.810000000000002 100-104 20.65 28.035 27.485 23.830000000000002 105-109 19.955000000000002 28.53 27.665 23.849999999999998 110-114 20.035 28.48 27.189999999999998 24.295 115-119 20.395 28.4 27.21 23.995 120-124 20.93 27.775 27.29 24.005000000000003 125-129 20.549999999999997 28.13 27.515 23.805 130-134 20.645 28.294999999999998 27.11 23.95 135-139 20.78 28.33 26.655 24.235 140-144 20.905 27.944999999999997 26.950000000000003 24.2 145-149 21.05 27.77 26.97 24.21 150-151 21.3125 28.3625 27.1625 23.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 1.0 22 1.0 23 1.5 24 1.5 25 6.0 26 10.0 27 6.5 28 9.0 29 13.0 30 20.5 31 23.5 32 27.0 33 37.5 34 42.5 35 68.5 36 98.0 37 105.5 38 128.5 39 154.0 40 184.0 41 218.5 42 248.0 43 262.0 44 274.5 45 289.5 46 272.0 47 251.0 48 222.0 49 185.5 50 159.5 51 144.0 52 118.0 53 82.0 54 65.0 55 65.0 56 51.0 57 34.0 58 30.0 59 25.0 60 17.0 61 11.0 62 10.0 63 8.0 64 5.5 65 4.0 66 3.5 67 1.5 68 0.0 69 0.0 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.7000000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.35 #Duplication Level Percentage of deduplicated Percentage of total 1 91.46141215106732 83.55 2 7.635467980295567 13.950000000000001 3 0.875752599890531 2.4 4 0.027367268746579094 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.6124999999999998 0.0 0.0 0.0 0.0 108-109 1.8624999999999998 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.325 0.0 0.0 0.0 0.0 114-115 2.5625 0.0 0.0 0.0 0.0 116-117 2.8125 0.0 0.0 0.0 0.0 118-119 3.15 0.0 0.0 0.0 0.0 120-121 3.5 0.0 0.0 0.0 0.0 122-123 3.8499999999999996 0.0 0.0 0.0 0.0 124-125 4.15 0.0 0.0 0.0 0.0 126-127 4.4625 0.0 0.0 0.0 0.0 128-129 4.7875 0.0 0.0 0.0 0.0 130-131 5.15 0.0 0.0 0.0 0.0 132-133 5.55 0.0 0.0 0.0 0.0 134-135 6.050000000000001 0.0 0.0 0.0 0.0 136-137 6.45 0.0 0.0 0.0 0.0 138-139 6.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAAGCA 10 0.006830828 145.0 9 GAACTCC 40 0.005621335 54.375 145 ACGTCTG 35 1.1966578E-4 24.857143 135-139 AGCACAC 35 1.1966578E-4 24.857143 130-134 TGAACTC 45 2.4877938E-5 22.555553 140-144 CACGTCT 35 0.0035366106 20.714287 135-139 AGATCGG 50 5.60876E-5 20.3 120-124 ACACGTC 40 0.0076550315 18.125 135-139 TCTGAAC 40 0.0076550315 18.125 140-144 GGAAGAG 65 0.0076375785 13.384615 125-129 >>END_MODULE SRR12919339 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919339_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.248 37.0 37.0 37.0 37.0 37.0 2 36.179 37.0 37.0 37.0 37.0 37.0 3 36.2315 37.0 37.0 37.0 37.0 37.0 4 36.248 37.0 37.0 37.0 37.0 37.0 5 36.3225 37.0 37.0 37.0 37.0 37.0 6 36.2175 37.0 37.0 37.0 37.0 37.0 7 36.346 37.0 37.0 37.0 37.0 37.0 8 36.3555 37.0 37.0 37.0 37.0 37.0 9 36.2035 37.0 37.0 37.0 37.0 37.0 10-14 36.2942 37.0 37.0 37.0 37.0 37.0 15-19 36.213800000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.248400000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.1048 37.0 37.0 37.0 37.0 37.0 30-34 36.14149999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.126799999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.1097 37.0 37.0 37.0 37.0 37.0 45-49 36.0622 37.0 37.0 37.0 37.0 37.0 50-54 36.0454 37.0 37.0 37.0 37.0 37.0 55-59 36.013799999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.0097 37.0 37.0 37.0 37.0 37.0 65-69 35.9827 37.0 37.0 37.0 37.0 37.0 70-74 35.936 37.0 37.0 37.0 37.0 37.0 75-79 35.91459999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.8377 37.0 37.0 37.0 37.0 37.0 85-89 35.8325 37.0 37.0 37.0 37.0 37.0 90-94 35.786199999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.752599999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.7759 37.0 37.0 37.0 37.0 37.0 105-109 35.70119999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.6989 37.0 37.0 37.0 37.0 37.0 115-119 35.706599999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.57789999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.5755 37.0 37.0 37.0 37.0 37.0 130-134 35.51199999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.3981 37.0 37.0 37.0 37.0 37.0 140-144 35.3798 37.0 37.0 37.0 34.6 37.0 145-149 35.2181 37.0 37.0 37.0 29.8 37.0 150-151 35.13375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 6.0 14 7.0 15 1.0 16 2.0 17 3.0 18 1.0 19 0.0 20 3.0 21 2.0 22 7.0 23 6.0 24 6.0 25 7.0 26 13.0 27 10.0 28 16.0 29 19.0 30 22.0 31 25.0 32 49.0 33 82.0 34 185.0 35 553.0 36 2723.0 37 250.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.800000000000004 23.875 8.575000000000001 22.75 2 26.950000000000003 25.775 30.875000000000004 16.400000000000002 3 20.525 27.0 32.4 20.075000000000003 4 23.674999999999997 34.375 23.3 18.65 5 24.775 36.525 21.825 16.875 6 23.525 38.475 21.075 16.925 7 21.45 23.05 35.949999999999996 19.55 8 21.425 25.7 28.075 24.8 9 23.1 23.225 29.7 23.974999999999998 10-14 24.545 28.34 26.055 21.060000000000002 15-19 23.724999999999998 27.85 27.900000000000002 20.525 20-24 23.78 28.82 27.815 19.585 25-29 23.625 27.725 28.235 20.415 30-34 22.975 27.560000000000002 28.405 21.060000000000002 35-39 23.49 28.53 27.495000000000005 20.485 40-44 23.84 28.560000000000002 26.790000000000003 20.810000000000002 45-49 23.849999999999998 27.744999999999997 27.26 21.145 50-54 23.235 28.395 27.85 20.52 55-59 23.735 28.384999999999998 27.48 20.4 60-64 23.57 28.21 28.134999999999998 20.085 65-69 23.845 28.43 27.37 20.355 70-74 23.625 28.59 27.48 20.305 75-79 24.14 27.855 27.68 20.325 80-84 24.235 27.644999999999996 27.889999999999997 20.23 85-89 23.485 27.83 27.74 20.945 90-94 23.925 28.37 27.150000000000002 20.555 95-99 24.03 28.98 27.435 19.555 100-104 24.855 28.205000000000002 26.72 20.22 105-109 24.535 28.205000000000002 27.584999999999997 19.675 110-114 24.37 28.59 26.96 20.080000000000002 115-119 24.455 27.85 27.445000000000004 20.25 120-124 24.55 28.01 27.500000000000004 19.939999999999998 125-129 24.59 28.76 26.590000000000003 20.06 130-134 25.2 28.675 26.855 19.27 135-139 24.884999999999998 28.54 26.905 19.67 140-144 26.11 28.58 25.935000000000002 19.375 145-149 26.495 28.73 25.96 18.815 150-151 27.875 27.125 26.25 18.75 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 1.0 14 1.0 15 1.0 16 2.5 17 3.0 18 2.5 19 1.5 20 1.0 21 1.0 22 1.0 23 1.0 24 1.0 25 5.5 26 7.5 27 7.0 28 8.5 29 11.0 30 16.5 31 16.0 32 20.0 33 29.0 34 36.0 35 57.0 36 100.0 37 122.0 38 125.5 39 157.5 40 186.5 41 223.0 42 259.0 43 258.0 44 274.5 45 283.0 46 280.5 47 274.0 48 232.5 49 185.5 50 155.0 51 138.5 52 110.5 53 80.5 54 68.0 55 58.0 56 47.5 57 32.0 58 24.5 59 24.0 60 13.5 61 11.0 62 8.5 63 4.0 64 2.0 65 1.0 66 0.5 67 0.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.5 73 1.0 74 1.5 75 1.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 6.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.0 #Duplication Level Percentage of deduplicated Percentage of total 1 91.29120879120879 83.075 2 7.857142857142857 14.299999999999999 3 0.7692307692307693 2.1 4 0.054945054945054944 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027472527472527472 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.3875 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 2.0875 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.5625 0.0 0.0 0.0 0.0 116-117 2.8125 0.0 0.0 0.0 0.0 118-119 3.15 0.0 0.0 0.0 0.0 120-121 3.5125 0.0 0.0 0.0 0.0 122-123 3.9000000000000004 0.0 0.0 0.0 0.0 124-125 4.2 0.0 0.0 0.0 0.0 126-127 4.512499999999999 0.0 0.0 0.0 0.0 128-129 4.8375 0.0 0.0 0.0 0.0 130-131 5.2 0.0 0.0 0.0 0.0 132-133 5.5875 0.0 0.0 0.0 0.0 134-135 6.0875 0.0 0.0 0.0 0.0 136-137 6.525 0.0 0.0 0.0 0.0 138-139 6.987500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGAAAG 35 0.0033124194 62.14286 145 AGCGTCG 35 1.1966578E-4 24.857143 130-134 CGTGTAG 30 0.0014437955 24.166668 135-139 AGGGAAA 40 2.9585467E-4 21.75 140-144 GGAAGAG 45 6.5511256E-4 19.333332 125-129 AGATCGG 45 6.5511256E-4 19.333332 120-124 GAGCGTC 40 0.0076550315 18.125 130-134 AGAGCGT 50 0.0013298223 17.4 130-134 >>END_MODULE Read 822547 spots for SRR12919339.sra Written 822547 spots for SRR12919339.sra Read 822547 spots for SRR12919339.sra Written 822547 spots for SRR12919339.sra Read 822547 spots for SRR12919339.sra Written 822547 spots for SRR12919339.sra Read 822547 spots for SRR12919339.sra Written 822547 spots for SRR12919339.sra Read 822547 spots for SRR12919339.sra Written 822547 spots for SRR12919339.sra Read 822547 spots for SRR12919339.sra Written 822547 spots for SRR12919339.sra Read 822547 spots for SRR12919339.sra Written 822547 spots for SRR12919339.sra Read 822547 spots for SRR12919339.sra Written 822547 spots for SRR12919339.sra Read 822547 spots for SRR12919339.sra Written 822547 spots for SRR12919339.sra Read 822547 spots for SRR12919339.sra Written 822547 spots for SRR12919339.sra Read 822547 spots for SRR12919339.sra Written 822547 spots for SRR12919339.sra Read 822547 spots for SRR12919339.sra Written 822547 spots for SRR12919339.sra Read 822547 spots for SRR12919339.sra Written 822547 spots for SRR12919339.sra Read 822547 spots for SRR12919339.sra Written 822547 spots for SRR12919339.sra Read 822547 spots for SRR12919339.sra Written 822547 spots for SRR12919339.sra Read 822547 spots for SRR12919339.sra Written 822547 spots for SRR12919339.sra Read 822547 spots for SRR12919339.sra Written 822547 spots for SRR12919339.sra Read 822555 spots for SRR12919339.sra Written 822555 spots for SRR12919339.sra Read 822547 spots for SRR12919339.sra Written 822547 spots for SRR12919339.sra Read 822547 spots for SRR12919339.sra Written 822547 spots for SRR12919339.sra SRR ids: ['SRR12919339.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eqhgudoj SRR12919339.sra spots: 16450948 blocks: [[1, 822547], [822548, 1645094], [1645095, 2467641], [2467642, 3290188], [3290189, 4112735], [4112736, 4935282], [4935283, 5757829], [5757830, 6580376], [6580377, 7402923], [7402924, 8225470], [8225471, 9048017], [9048018, 9870564], [9870565, 10693111], [10693112, 11515658], [11515659, 12338205], [12338206, 13160752], [13160753, 13983299], [13983300, 14805846], [14805847, 15628393], [15628394, 16450948]] SRR12919339 file size 5569051 SRR12919339 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919339 SRR12919339_1.fastq SRR12919339_2.fastq Input file: SRR12919339_1.fastq Paired file: SRR12919339_2.fastq trimmed: SRR12919339-trimmed-pair1.fastq, SRR12919339-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:02:20 2025 >> started Wed Feb 12 19:02:49 2025 >> done (29.819s) 16450948 read pairs processed; of these: 22 ( 0.00%) short read pairs filtered out after trimming by size control 5593 ( 0.03%) empty read pairs filtered out after trimming by size control 16445333 (99.97%) read pairs available; of these: 1721163 (10.47%) trimmed read pairs available after processing 14724170 (89.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 6 0.00% 21 4 0.00% 22 6 0.00% 23 2 0.00% 24 5 0.00% 25 6 0.00% 26 5 0.00% 27 14 0.00% 28 2 0.00% 29 11 0.00% 30 14 0.00% 31 12 0.00% 32 11 0.00% 33 15 0.00% 34 13 0.00% 35 16 0.00% 36 18 0.00% 37 27 0.00% 38 33 0.00% 39 29 0.00% 40 43 0.00% 41 33 0.00% 42 39 0.00% 43 47 0.00% 44 38 0.00% 45 62 0.00% 46 64 0.00% 47 59 0.00% 48 52 0.00% 49 79 0.00% 50 83 0.00% 51 115 0.00% 52 106 0.00% 53 119 0.00% 54 113 0.00% 55 152 0.00% 56 151 0.00% 57 151 0.00% 58 148 0.00% 59 198 0.00% 60 263 0.00% 61 308 0.00% 62 350 0.00% 63 412 0.00% 64 402 0.00% 65 433 0.00% 66 400 0.00% 67 480 0.00% 68 572 0.00% 69 568 0.00% 70 744 0.00% 71 951 0.01% 72 1046 0.01% 73 1220 0.01% 74 1317 0.01% 75 1411 0.01% 76 1534 0.01% 77 1571 0.01% 78 1745 0.01% 79 1949 0.01% 80 2167 0.01% 81 2667 0.02% 82 3287 0.02% 83 3537 0.02% 84 3920 0.02% 85 4120 0.03% 86 4370 0.03% 87 4616 0.03% 88 4872 0.03% 89 5205 0.03% 90 5839 0.04% 91 6678 0.04% 92 7545 0.05% 93 8527 0.05% 94 9320 0.06% 95 9471 0.06% 96 9762 0.06% 97 10073 0.06% 98 10469 0.06% 99 10968 0.07% 100 11759 0.07% 101 12714 0.08% 102 13929 0.08% 103 15279 0.09% 104 16683 0.10% 105 17141 0.10% 106 17520 0.11% 107 17719 0.11% 108 18377 0.11% 109 18239 0.11% 110 18821 0.11% 111 19818 0.12% 112 21537 0.13% 113 22587 0.14% 114 24139 0.15% 115 25119 0.15% 116 25435 0.15% 117 25253 0.15% 118 25384 0.15% 119 25656 0.16% 120 26224 0.16% 121 27361 0.17% 122 28471 0.17% 123 30346 0.18% 124 31430 0.19% 125 32661 0.20% 126 33594 0.20% 127 33475 0.20% 128 33276 0.20% 129 33188 0.20% 130 33386 0.20% 131 33782 0.21% 132 35461 0.22% 133 36575 0.22% 134 38199 0.23% 135 40187 0.24% 136 40661 0.25% 137 40654 0.25% 138 40880 0.25% 139 40596 0.25% 140 40228 0.24% 141 41005 0.25% 142 41437 0.25% 143 42743 0.26% 144 45155 0.27% 145 45901 0.28% 146 46910 0.29% 147 46780 0.28% 148 46890 0.29% 149 46745 0.28% 150 46651 0.28% 151 14724170 89.53% 16445333 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=39 prefix-density=0.40 prefix-fanout=2.1 sequence=AGATGTCAAAGCTACAGAAGCACTTGCTGTATCGGCAATTTTTGCATCAAAATTATCGTTAAGGAAGTCTCCGTATGCTTTATTTCGAACGTAAAAATCAGAAGTAGAACTCTTCGATCCAAAGACAACTTTGGGTTTTCCGGGCAGGCATTTATCTGAATAGCATTTTCTTAACTTCATATCCTTGAGCGCTTTAGTGGCAGCATCATACCAGGATGTGGTGATGGGAAGCCAGAAAACTTCCTTGGGTGCTTCACTTGGAGAGAACATGTTAATTTTCTCATACTCTACAGTCCCCAACAAGTTCTCTCCATTCTCTGGATAATTGAAATCTCCAAATACCAGTTTACCTTTCTCCGATCCGAATTTCTTCCAGTTCCAAACTCCTGTGAAGGCAACAGCCTGCGGCACAGAAACATCACCTGGAACCATTGTTTTCTTATCCAAGCTTCCAGCATTCCCAAAATAGATGACTCCGTGAATGCTGAATCTAGCTAAAAGGATTTGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=39 fanout-score=123.79 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=11.2 sequence=CATCACCATCCCTGATTGATCTTTGATTCACAACAAGACCAACCAACCGTACAATGTTTACATAACTTGGGATAATCTCACAAGAAAGAAAGATCAATACAAAACTAGTCAGCTCAGGATGTTCCAGGCACGGTAGAACCGTAGAACCATAACAACAAGAGACATATTGCAGATGAGTACTGAAAAACAAAACACAGTACGTATTTACATGGGCAACCTTGGTTGAAGGCAACCTCATCAACGATGCTCGCTCTTCGTCTCTCCACTGTACATCCAGTCATAGACAGTGGGTGTGTTAGGCTGTGGCTTGTCAAAAACATGAGCACCAATATTCTTAGTAGCAAGGTTGCTACCAGGGTGGAACACGCTCCTCCAAACATTGCTACGCGCCGACACTGGGGTTGTAGGGGTCACTGGTGTCGTCGGTGTCCCTGGAGTTCCTGGCATAGTCATGGACCTCTGAAACTTATTAACAGGACTGCTCCCCTCTCCGACGTCAATATCTTTGATG criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=35 prefix-density=0.22 prefix-fanout=2.0 sequence=TAGATTCAGCATTCACGGAGTCATCTATTTTGGGAATGCTGGAAGCTTGGATAAGAAAACAATGGTTCCAGGTGATGTTTCTGTGCCGCAGGCTGTTGCCTTCACAGGAGTTTGGAACTGGAAGAAATTCGGATCGGAGAAAGGTAAACTGGTATTTGGAGATTTCAATTATCCAGAGAATGGAGAGAACTTGTTGGGGACTGTAGAGTATGAGAAAATTAACATGTTCTCTCCAAGTGAAGCACCCAAGGAAGTTTTCTGGCTTCCCATCACCACATCCTGGTATGATGCTGCCACTAAAGCGCTCAAGGATATGAAGTTAAGAAAATGCTATTCAGATAAATGCCTGCCCGGAAAACCCAAAGTTGTCTTTGGATCGAAGAGTTCTACTTCTGATTTTTACGTTCGAAATAAAGCATACGGAGACTTCCTTAACGATAATTTTGATGCAAAAATTGCCGATACAGCAAGTGCTTCTGTAGCTTTGACATCTCTGTCAAATGAAAAGCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=169.46 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=13.0 sequence=AGAGAAAAGATAAGCTAGGCAAGATGGTTTTACTAGACAAGATGTGGGATGATGTTGTTGCTGGACCTCAGCCAGAACGTGGCCTTGGCAAGCTTAGAAAGATCAGCACCAGACCACTTAACATCAAAGATATTGACGTCGGAGAGGGGAGCAGTCCTGTTAATAAGTTTCAGAGGTCCATGACTATGCCAGGAACTCCAGGGACACCGACGACACCAGTGACCCCTACAACCCCAGTGTCGGCGCGTAGCAATGTTTGGAGGAGCGTGTTCCACCCTGGTAGCAACCTTGCTACTAAGAATATTGGTGCTCATGTTTTTGACAAGCCACAGCCTAACACACCCACTGTCTATGACTGGATGTACAGTGGAGAGACGAAGAGCGAGCATCGTTGATGAGGTTGCCTTCAACCAAGGTTGCCCATGTAAATACGTACTGTGTTTTGTTTTTCAGTACTCATCTGCAATATGTCTCTTGTTGTTATGGTTCTACGGTTCTACCGTGCCTGGAA SRR12919339 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:03:47 Started mapping on | Feb 12 19:03:47 Finished on | Feb 12 19:06:58 Mapping speed, Million of reads per hour | 309.96 Number of input reads | 16445333 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15121183 Uniquely mapped reads % | 91.95% Average mapped length | 295.53 Number of splices: Total | 14435579 Number of splices: Annotated (sjdb) | 14098174 Number of splices: GT/AG | 14169092 Number of splices: GC/AG | 207715 Number of splices: AT/AC | 16839 Number of splices: Non-canonical | 41933 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 396493 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 180439 % of reads mapped to too many loci | 1.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.22% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 927657 927657 927657 N_multimapping 396493 396493 396493 N_noFeature 633025 14948807 711268 N_ambiguous 189693 1303 94651 UnstrandedReadsAssigned:14298465 PositiveStrandReadsAssigned:171073 NegativeStrandReadsAssigned:14315264 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919339 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919339-trimmed-pair1.fastq SRR12919339-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,445,333 reads, 14,479,616 reads pseudoaligned [quant] estimated average fragment length: 261.811 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR12919339.ke.tsv 34699 SRR12919339.se.tsv 87100 total ==> SRR12919339.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.19 913 34.4905 Potri.005G024800.1.v4.1 1035 774.189 631 54.104 Potri.004G059700.1.v4.1 961 700.333 16 1.51657 Potri.007G009000.2.v4.1 1416 1155.19 0 0 Potri.003G141000.2.v4.1 2943 2682.19 379.359 9.38876 Potri.016G087400.1.v4.1 270 85.0269 1148.89 896.95 Potri.015G069301.1.v4.1 564 316.957 0 0 Potri.010G195200.1.v4.1 1773 1512.19 45 1.97539 Potri.012G127500.1.v4.1 977 716.267 9064 840.024 ==> SRR12919339.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 26 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 173 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 35 SRR12919339 completed mapping pipeline successfully