Starting /dee2/code/volunteer_pipeline.sh SRR12919340 current disk space = 3050888048640 free memory = 1580186492 SRR12919340 SRAfilesize bc67cbd6b409aa6acf448709e3ba79e6 SRR12919340.sra SRR12919340.sra file validated SRR12919340 is paired end SRR12919340 is conventional basespace SRR12919340 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919340_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5735 37.0 37.0 37.0 37.0 37.0 2 36.423 37.0 37.0 37.0 37.0 37.0 3 36.67 37.0 37.0 37.0 37.0 37.0 4 36.7165 37.0 37.0 37.0 37.0 37.0 5 36.7635 37.0 37.0 37.0 37.0 37.0 6 36.6695 37.0 37.0 37.0 37.0 37.0 7 36.6495 37.0 37.0 37.0 37.0 37.0 8 36.6835 37.0 37.0 37.0 37.0 37.0 9 36.7015 37.0 37.0 37.0 37.0 37.0 10-14 36.6854 37.0 37.0 37.0 37.0 37.0 15-19 36.6774 37.0 37.0 37.0 37.0 37.0 20-24 36.65990000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.5655 37.0 37.0 37.0 37.0 37.0 30-34 36.608999999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.5493 37.0 37.0 37.0 37.0 37.0 40-44 36.5315 37.0 37.0 37.0 37.0 37.0 45-49 36.53529999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.476299999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.4998 37.0 37.0 37.0 37.0 37.0 60-64 36.4096 37.0 37.0 37.0 37.0 37.0 65-69 36.4514 37.0 37.0 37.0 37.0 37.0 70-74 36.4237 37.0 37.0 37.0 37.0 37.0 75-79 36.3455 37.0 37.0 37.0 37.0 37.0 80-84 36.338800000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.2738 37.0 37.0 37.0 37.0 37.0 90-94 36.307100000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.290200000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.2342 37.0 37.0 37.0 37.0 37.0 105-109 36.2247 37.0 37.0 37.0 37.0 37.0 110-114 36.1905 37.0 37.0 37.0 37.0 37.0 115-119 36.1519 37.0 37.0 37.0 37.0 37.0 120-124 36.137899999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.0332 37.0 37.0 37.0 37.0 37.0 130-134 36.0437 37.0 37.0 37.0 37.0 37.0 135-139 35.947 37.0 37.0 37.0 37.0 37.0 140-144 35.906400000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.8709 37.0 37.0 37.0 37.0 37.0 150-151 35.728 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 2.0 25 3.0 26 0.0 27 6.0 28 4.0 29 14.0 30 29.0 31 29.0 32 29.0 33 65.0 34 110.0 35 277.0 36 3004.0 37 426.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.525 13.375 5.075 41.025 2 18.834756403817178 13.360120542440985 37.192365645404315 30.612757408337522 3 15.775 18.35 27.85 38.025 4 22.2 24.7 23.3 29.799999999999997 5 22.2 30.5 25.3 22.0 6 19.950000000000003 35.099999999999994 24.85 20.1 7 16.05 25.85 40.949999999999996 17.150000000000002 8 17.175 25.1 32.550000000000004 25.174999999999997 9 15.55 24.55 35.525 24.375 10-14 19.585 30.240000000000002 27.29 22.884999999999998 15-19 19.75 28.17 28.03 24.05 20-24 19.29 28.605000000000004 27.665 24.44 25-29 19.31 28.985 28.115000000000002 23.59 30-34 19.29 28.835 27.43 24.445 35-39 20.015 29.26 26.805 23.919999999999998 40-44 19.895 28.000000000000004 28.565 23.54 45-49 19.564999999999998 27.975 28.01 24.45 50-54 20.200000000000003 28.310000000000002 27.315 24.175 55-59 19.814999999999998 29.26 27.375 23.549999999999997 60-64 19.75 28.610000000000003 28.23 23.41 65-69 19.634999999999998 28.24 28.065 24.060000000000002 70-74 19.189999999999998 29.24 27.395000000000003 24.175 75-79 19.925 28.105000000000004 27.71 24.26 80-84 20.29 28.494999999999997 27.250000000000004 23.965 85-89 20.07 28.005000000000003 28.32 23.605 90-94 20.465 27.83 27.939999999999998 23.765 95-99 20.395 28.205000000000002 27.91 23.49 100-104 20.724999999999998 27.675 27.584999999999997 24.015 105-109 20.93 28.345 27.694999999999997 23.03 110-114 20.59 28.060000000000002 27.389999999999997 23.96 115-119 21.060000000000002 27.845 27.185 23.91 120-124 20.080000000000002 28.67 27.54 23.71 125-129 20.745 28.735 26.655 23.865 130-134 20.735 27.845 27.48 23.94 135-139 20.54 28.610000000000003 27.11 23.74 140-144 21.265 27.36 27.11 24.265 145-149 20.979999999999997 28.38 27.01 23.630000000000003 150-151 20.7625 27.6375 26.8125 24.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 3.0 24 4.0 25 3.0 26 3.5 27 5.5 28 8.0 29 12.5 30 17.0 31 21.0 32 25.5 33 36.0 34 48.0 35 61.5 36 88.5 37 115.5 38 130.0 39 166.0 40 193.5 41 221.0 42 263.0 43 267.5 44 272.0 45 273.0 46 267.0 47 244.0 48 225.5 49 211.5 50 173.5 51 147.0 52 127.0 53 104.5 54 71.0 55 52.5 56 44.0 57 28.0 58 20.0 59 13.0 60 5.0 61 4.0 62 6.0 63 6.5 64 4.0 65 2.5 66 2.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.775 #Duplication Level Percentage of deduplicated Percentage of total 1 89.9192425508215 80.72500000000001 2 9.022556390977442 16.2 3 0.835421888053467 2.25 4 0.1949317738791423 0.7000000000000001 5 0.0278473962684489 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGGTTTAGCCAATTCATCTGTTTGTAAGCAGAAGTATGTCCCCTTCAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.775 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.475 0.0 0.0 0.0 0.0 104-105 1.8 0.0 0.0 0.0 0.0 106-107 1.9874999999999998 0.0 0.0 0.0 0.0 108-109 2.1375 0.0 0.0 0.0 0.0 110-111 2.4125 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 2.9375 0.0 0.0 0.0 0.0 116-117 3.375 0.0 0.0 0.0 0.0 118-119 3.7 0.0 0.0 0.0 0.0 120-121 4.1625 0.0 0.0 0.0 0.0 122-123 4.5 0.0 0.0 0.0 0.0 124-125 4.8625 0.0 0.0 0.0 0.0 126-127 5.4625 0.0 0.0 0.0 0.0 128-129 6.0875 0.0 0.0 0.0 0.0 130-131 6.6 0.0 0.0 0.0 0.0 132-133 6.975 0.0 0.0 0.0 0.0 134-135 7.4125 0.0 0.0 0.0 0.0 136-137 8.3 0.0 0.0 0.0 0.0 138-139 8.962499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAATGC 10 0.006830828 145.0 4 GTCCGAA 10 0.006830828 145.0 1 GCCAATG 10 0.006830828 145.0 3 >>END_MODULE SRR12919340 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919340_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2935 37.0 37.0 37.0 37.0 37.0 2 36.286 37.0 37.0 37.0 37.0 37.0 3 36.3875 37.0 37.0 37.0 37.0 37.0 4 36.323 37.0 37.0 37.0 37.0 37.0 5 36.343 37.0 37.0 37.0 37.0 37.0 6 36.328 37.0 37.0 37.0 37.0 37.0 7 36.4115 37.0 37.0 37.0 37.0 37.0 8 36.3485 37.0 37.0 37.0 37.0 37.0 9 36.396 37.0 37.0 37.0 37.0 37.0 10-14 36.3627 37.0 37.0 37.0 37.0 37.0 15-19 36.397800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.3355 37.0 37.0 37.0 37.0 37.0 25-29 36.30219999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.265499999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.2158 37.0 37.0 37.0 37.0 37.0 40-44 36.1882 37.0 37.0 37.0 37.0 37.0 45-49 36.1794 37.0 37.0 37.0 37.0 37.0 50-54 36.1688 37.0 37.0 37.0 37.0 37.0 55-59 36.126999999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.1219 37.0 37.0 37.0 37.0 37.0 65-69 36.0826 37.0 37.0 37.0 37.0 37.0 70-74 36.062 37.0 37.0 37.0 37.0 37.0 75-79 36.012 37.0 37.0 37.0 37.0 37.0 80-84 36.07170000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.961400000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.897 37.0 37.0 37.0 37.0 37.0 95-99 35.9131 37.0 37.0 37.0 37.0 37.0 100-104 35.9271 37.0 37.0 37.0 37.0 37.0 105-109 35.8793 37.0 37.0 37.0 37.0 37.0 110-114 35.881899999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.7764 37.0 37.0 37.0 37.0 37.0 120-124 35.694599999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.6782 37.0 37.0 37.0 37.0 37.0 130-134 35.559900000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.3713 37.0 37.0 37.0 37.0 37.0 140-144 35.3051 37.0 37.0 37.0 34.6 37.0 145-149 35.1389 37.0 37.0 37.0 27.4 37.0 150-151 34.98925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 6.0 14 1.0 15 1.0 16 1.0 17 0.0 18 2.0 19 1.0 20 2.0 21 1.0 22 5.0 23 5.0 24 7.0 25 5.0 26 4.0 27 9.0 28 7.0 29 19.0 30 29.0 31 33.0 32 47.0 33 116.0 34 190.0 35 492.0 36 2677.0 37 338.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.6 25.1 9.625 25.674999999999997 2 27.05 26.55 31.75 14.649999999999999 3 19.5 28.125 33.025 19.35 4 22.875 33.550000000000004 24.25 19.325 5 25.074999999999996 36.85 21.275 16.8 6 21.8 38.95 22.625 16.625 7 20.474999999999998 22.95 37.15 19.425 8 20.0 27.1 28.675 24.224999999999998 9 22.975 23.974999999999998 30.275000000000002 22.775000000000002 10-14 23.419999999999998 29.104999999999997 26.815 20.66 15-19 23.515 27.915 27.965 20.605 20-24 23.57 28.325 27.284999999999997 20.82 25-29 23.150000000000002 28.449999999999996 27.505000000000003 20.895 30-34 23.595 28.255000000000003 27.725 20.424999999999997 35-39 23.16 28.59 28.189999999999998 20.06 40-44 23.59 27.950000000000003 27.54 20.919999999999998 45-49 23.385 28.98 27.26 20.375 50-54 23.810000000000002 27.91 28.115000000000002 20.165 55-59 24.37 28.255000000000003 27.05 20.325 60-64 23.5 27.389999999999997 28.63 20.48 65-69 23.64 27.529999999999998 28.055000000000003 20.775 70-74 23.745 27.98 27.994999999999997 20.28 75-79 23.5 28.305000000000003 27.58 20.615 80-84 23.785 28.595 27.54 20.080000000000002 85-89 24.335 27.365000000000002 27.939999999999998 20.36 90-94 24.04 28.299999999999997 27.37 20.29 95-99 24.47 28.199999999999996 27.025 20.305 100-104 24.45 28.634999999999998 26.825 20.09 105-109 24.295 27.76 27.845 20.1 110-114 24.805 28.035 27.355 19.805 115-119 24.73 28.03 27.435 19.805 120-124 24.915000000000003 28.485 26.729999999999997 19.869999999999997 125-129 24.94 28.7 27.11 19.25 130-134 25.585 27.755000000000003 27.61 19.05 135-139 25.679999999999996 27.529999999999998 27.105 19.685 140-144 26.064999999999998 27.57 26.775 19.59 145-149 26.91 28.189999999999998 26.150000000000002 18.75 150-151 27.6625 27.275 25.974999999999998 19.0875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.5 19 0.5 20 0.5 21 1.5 22 2.0 23 1.5 24 1.0 25 1.5 26 3.0 27 4.5 28 6.0 29 8.0 30 15.0 31 20.0 32 23.5 33 34.5 34 41.0 35 48.0 36 74.5 37 112.5 38 150.5 39 185.0 40 219.0 41 240.5 42 252.5 43 287.0 44 298.5 45 283.0 46 271.5 47 247.0 48 212.5 49 179.5 50 156.0 51 130.0 52 100.5 53 85.0 54 69.0 55 57.0 56 46.0 57 25.0 58 18.0 59 16.0 60 11.0 61 11.0 62 7.5 63 3.5 64 4.0 65 2.0 66 3.0 67 2.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.5 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 89.96095928611267 80.65 2 8.895705521472392 15.950000000000001 3 0.9202453987730062 2.475 4 0.16731734523145567 0.6 5 0.027886224205242612 0.125 6 0.0 0.0 7 0.0 0.0 8 0.027886224205242612 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit TATCTGCCCTCCAATCTCCTTTTCGAGGGCCAGGTGTATCAGAAGTTCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.025 0.0 90-91 0.6375 0.0 0.0 0.025 0.0 92-93 0.775 0.0 0.0 0.025 0.0 94-95 0.875 0.0 0.0 0.025 0.0 96-97 0.9625 0.0 0.0 0.025 0.0 98-99 1.0875 0.0 0.0 0.025 0.0 100-101 1.275 0.0 0.0 0.025 0.0 102-103 1.4874999999999998 0.0 0.0 0.025 0.0 104-105 1.825 0.0 0.0 0.025 0.0 106-107 2.0125 0.0 0.0 0.025 0.0 108-109 2.1625 0.0 0.0 0.025 0.0 110-111 2.4375 0.0 0.0 0.025 0.0 112-113 2.625 0.0 0.0 0.025 0.0 114-115 2.9375 0.0 0.0 0.025 0.0 116-117 3.375 0.0 0.0 0.025 0.0 118-119 3.7 0.0 0.0 0.025 0.0 120-121 4.1625 0.0 0.0 0.025 0.0 122-123 4.5 0.0 0.0 0.025 0.0 124-125 4.8625 0.0 0.0 0.025 0.0 126-127 5.4375 0.0 0.0 0.025 0.0 128-129 6.0625 0.0 0.0 0.025 0.0 130-131 6.6 0.0 0.0 0.025 0.0 132-133 6.975 0.0 0.0 0.025 0.0 134-135 7.425 0.0 0.0 0.025 0.0 136-137 8.3375 0.0 0.0 0.025 0.0 138-139 9.0125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTCGAG 10 0.006830828 145.0 145 >>END_MODULE Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra Read 1173992 spots for SRR12919340.sra Written 1173992 spots for SRR12919340.sra SRR ids: ['SRR12919340.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4ma2xsxx SRR12919340.sra spots: 23479840 blocks: [[1, 1173992], [1173993, 2347984], [2347985, 3521976], [3521977, 4695968], [4695969, 5869960], [5869961, 7043952], [7043953, 8217944], [8217945, 9391936], [9391937, 10565928], [10565929, 11739920], [11739921, 12913912], [12913913, 14087904], [14087905, 15261896], [15261897, 16435888], [16435889, 17609880], [17609881, 18783872], [18783873, 19957864], [19957865, 21131856], [21131857, 22305848], [22305849, 23479840]] SRR12919340 file size 7957776 SRR12919340 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919340 SRR12919340_1.fastq SRR12919340_2.fastq Input file: SRR12919340_1.fastq Paired file: SRR12919340_2.fastq trimmed: SRR12919340-trimmed-pair1.fastq, SRR12919340-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:51:14 2025 >> started Wed Feb 12 19:51:41 2025 >> done (26.776s) 23479840 read pairs processed; of these: 28 ( 0.00%) short read pairs filtered out after trimming by size control 12212 ( 0.05%) empty read pairs filtered out after trimming by size control 23467600 (99.95%) read pairs available; of these: 3118051 (13.29%) trimmed read pairs available after processing 20349549 (86.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 6 0.00% 20 7 0.00% 21 2 0.00% 22 4 0.00% 23 13 0.00% 24 11 0.00% 25 10 0.00% 26 11 0.00% 27 10 0.00% 28 11 0.00% 29 8 0.00% 30 15 0.00% 31 10 0.00% 32 17 0.00% 33 15 0.00% 34 18 0.00% 35 14 0.00% 36 22 0.00% 37 29 0.00% 38 28 0.00% 39 35 0.00% 40 37 0.00% 41 32 0.00% 42 49 0.00% 43 45 0.00% 44 32 0.00% 45 36 0.00% 46 50 0.00% 47 52 0.00% 48 53 0.00% 49 74 0.00% 50 95 0.00% 51 89 0.00% 52 125 0.00% 53 103 0.00% 54 126 0.00% 55 149 0.00% 56 167 0.00% 57 224 0.00% 58 212 0.00% 59 258 0.00% 60 354 0.00% 61 458 0.00% 62 495 0.00% 63 510 0.00% 64 585 0.00% 65 653 0.00% 66 696 0.00% 67 766 0.00% 68 937 0.00% 69 1087 0.00% 70 1348 0.01% 71 1563 0.01% 72 1880 0.01% 73 2195 0.01% 74 2416 0.01% 75 2680 0.01% 76 2844 0.01% 77 3158 0.01% 78 3558 0.02% 79 4105 0.02% 80 4469 0.02% 81 5212 0.02% 82 6226 0.03% 83 6999 0.03% 84 7717 0.03% 85 8637 0.04% 86 8957 0.04% 87 9535 0.04% 88 10415 0.04% 89 11162 0.05% 90 12267 0.05% 91 13453 0.06% 92 14821 0.06% 93 16492 0.07% 94 17748 0.08% 95 18920 0.08% 96 19659 0.08% 97 20556 0.09% 98 21453 0.09% 99 22253 0.09% 100 23466 0.10% 101 24890 0.11% 102 26590 0.11% 103 28768 0.12% 104 30166 0.13% 105 31753 0.14% 106 32882 0.14% 107 33493 0.14% 108 34256 0.15% 109 34966 0.15% 110 35767 0.15% 111 37331 0.16% 112 39822 0.17% 113 41464 0.18% 114 43441 0.19% 115 45149 0.19% 116 46157 0.20% 117 47411 0.20% 118 48066 0.20% 119 48273 0.21% 120 48656 0.21% 121 50680 0.22% 122 51484 0.22% 123 54149 0.23% 124 55867 0.24% 125 57538 0.25% 126 59059 0.25% 127 60279 0.26% 128 60878 0.26% 129 60925 0.26% 130 62186 0.26% 131 61955 0.26% 132 63719 0.27% 133 65742 0.28% 134 66898 0.29% 135 68991 0.29% 136 70794 0.30% 137 71172 0.30% 138 72320 0.31% 139 72122 0.31% 140 71744 0.31% 141 73141 0.31% 142 73863 0.31% 143 75358 0.32% 144 77819 0.33% 145 79575 0.34% 146 80196 0.34% 147 80755 0.34% 148 82033 0.35% 149 80910 0.34% 150 81588 0.35% 151 20349549 86.71% 23467600 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=20.39 fanout-score-rank=14 prefix-density=0.34 prefix-fanout=6.3 sequence=TTTCTCAATTTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=483.42 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=36.2 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.84 fanout-score-rank=35 prefix-density=0.17 prefix-fanout=3.0 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=390.65 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=33.2 sequence=AAGAAGAAGAAA SRR12919340 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:52:29 Started mapping on | Feb 12 19:52:29 Finished on | Feb 12 19:55:33 Mapping speed, Million of reads per hour | 459.15 Number of input reads | 23467600 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 21828931 Uniquely mapped reads % | 93.02% Average mapped length | 293.98 Number of splices: Total | 21253898 Number of splices: Annotated (sjdb) | 20779170 Number of splices: GT/AG | 20874158 Number of splices: GC/AG | 298710 Number of splices: AT/AC | 20753 Number of splices: Non-canonical | 60277 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 619419 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 59684 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.96% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1019250 1019250 1019250 N_multimapping 619419 619419 619419 N_noFeature 764310 21535434 898545 N_ambiguous 290599 1278 130589 UnstrandedReadsAssigned:20774022 PositiveStrandReadsAssigned:292219 NegativeStrandReadsAssigned:20799797 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919340 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919340-trimmed-pair1.fastq SRR12919340-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,467,600 reads, 20,855,576 reads pseudoaligned [quant] estimated average fragment length: 245.91 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,007 rounds 52401 SRR12919340.ke.tsv 34699 SRR12919340.se.tsv 87100 total ==> SRR12919340.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.09 992 26.0465 Potri.005G024800.1.v4.1 1035 790.09 397 23.3928 Potri.004G059700.1.v4.1 961 716.23 92 5.98004 Potri.007G009000.2.v4.1 1416 1171.09 0 0 Potri.003G141000.2.v4.1 2943 2698.09 678 11.6988 Potri.016G087400.1.v4.1 270 89.4342 1924 1001.54 Potri.015G069301.1.v4.1 564 331.217 0 0 Potri.010G195200.1.v4.1 1773 1528.09 131 3.99109 Potri.012G127500.1.v4.1 977 732.167 12821 815.231 ==> SRR12919340.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 277 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 382 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 7 Potri.001G452600.v4.1 53 SRR12919340 completed mapping pipeline successfully