Starting /dee2/code/volunteer_pipeline.sh SRR12919341 current disk space = 3051051773952 free memory = 1464075820 SRR12919341 SRAfilesize 3931532bd34fa17739d61c6f957383d6 SRR12919341.sra SRR12919341.sra file validated SRR12919341 is paired end SRR12919341 is conventional basespace SRR12919341 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919341_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.534 37.0 37.0 37.0 37.0 37.0 2 36.23925 37.0 37.0 37.0 37.0 37.0 3 36.5965 37.0 37.0 37.0 37.0 37.0 4 36.666 37.0 37.0 37.0 37.0 37.0 5 36.6705 37.0 37.0 37.0 37.0 37.0 6 36.6985 37.0 37.0 37.0 37.0 37.0 7 36.5415 37.0 37.0 37.0 37.0 37.0 8 36.695 37.0 37.0 37.0 37.0 37.0 9 36.6755 37.0 37.0 37.0 37.0 37.0 10-14 36.6796 37.0 37.0 37.0 37.0 37.0 15-19 36.6392 37.0 37.0 37.0 37.0 37.0 20-24 36.6427 37.0 37.0 37.0 37.0 37.0 25-29 36.57430000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.563500000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.519999999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.5123 37.0 37.0 37.0 37.0 37.0 45-49 36.5113 37.0 37.0 37.0 37.0 37.0 50-54 36.464 37.0 37.0 37.0 37.0 37.0 55-59 36.4405 37.0 37.0 37.0 37.0 37.0 60-64 36.4409 37.0 37.0 37.0 37.0 37.0 65-69 36.3957 37.0 37.0 37.0 37.0 37.0 70-74 36.3524 37.0 37.0 37.0 37.0 37.0 75-79 36.309000000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.3135 37.0 37.0 37.0 37.0 37.0 85-89 36.228899999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.217 37.0 37.0 37.0 37.0 37.0 95-99 36.248000000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.213 37.0 37.0 37.0 37.0 37.0 105-109 36.109500000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.025099999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.0688 37.0 37.0 37.0 37.0 37.0 120-124 36.051700000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.9902 37.0 37.0 37.0 37.0 37.0 130-134 35.948699999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.8521 37.0 37.0 37.0 37.0 37.0 140-144 35.6893 37.0 37.0 37.0 37.0 37.0 145-149 35.689099999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.446 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 1.0 25 6.0 26 7.0 27 4.0 28 8.0 29 14.0 30 20.0 31 40.0 32 44.0 33 69.0 34 116.0 35 296.0 36 2987.0 37 387.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.125 12.475 6.0 44.4 2 18.540880503144656 13.0062893081761 36.276729559748425 32.17610062893081 3 17.4 15.65 25.8 41.15 4 21.224999999999998 23.599999999999998 25.6 29.575000000000003 5 23.474999999999998 29.975 24.025 22.525000000000002 6 20.125 35.075 22.8 22.0 7 14.924999999999999 27.200000000000003 40.825 17.05 8 18.35 25.474999999999998 31.75 24.425 9 17.349999999999998 24.9 33.675 24.075 10-14 20.05 29.985 27.68 22.285 15-19 19.465 28.425 28.26 23.849999999999998 20-24 19.515 28.804999999999996 27.365000000000002 24.315 25-29 19.535 28.27 28.51 23.685000000000002 30-34 19.8 28.9 27.48 23.82 35-39 19.82 27.99 27.925 24.265 40-44 19.375 27.915 28.470000000000002 24.240000000000002 45-49 19.6 28.57 27.639999999999997 24.19 50-54 20.525 28.535 27.205000000000002 23.735 55-59 20.26 28.225 27.505000000000003 24.01 60-64 20.044999999999998 28.655 27.534999999999997 23.765 65-69 20.169999999999998 28.16 27.67 24.0 70-74 20.595 28.060000000000002 27.415 23.93 75-79 20.175 27.825 28.125 23.875 80-84 20.05 27.63 28.205000000000002 24.115000000000002 85-89 19.855 27.900000000000002 28.199999999999996 24.044999999999998 90-94 20.23 27.744999999999997 27.224999999999998 24.8 95-99 19.595000000000002 28.904999999999998 27.46 24.04 100-104 20.71 27.155 28.095 24.04 105-109 20.31 28.044999999999998 27.37 24.275 110-114 20.3 27.855 27.67 24.175 115-119 20.830000000000002 27.82 27.1 24.25 120-124 20.46 27.93 27.310000000000002 24.3 125-129 20.5 28.335 26.705000000000002 24.46 130-134 20.294999999999998 28.84 26.66 24.205 135-139 20.9 27.925 26.96 24.215 140-144 20.785 27.63 26.790000000000003 24.795 145-149 20.945 28.24 26.545 24.27 150-151 20.875 27.6125 26.875 24.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.0 22 1.0 23 1.0 24 0.5 25 1.5 26 2.0 27 1.0 28 4.5 29 11.0 30 14.0 31 20.0 32 33.5 33 48.5 34 58.5 35 67.5 36 92.0 37 116.0 38 116.5 39 140.5 40 183.0 41 210.5 42 240.0 43 271.0 44 287.0 45 288.0 46 255.0 47 227.0 48 227.5 49 220.0 50 176.5 51 141.5 52 120.5 53 91.5 54 80.5 55 62.5 56 48.0 57 38.0 58 26.0 59 16.0 60 10.5 61 7.5 62 8.5 63 10.5 64 8.0 65 4.0 66 3.0 67 2.0 68 0.5 69 0.5 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.625 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.825 #Duplication Level Percentage of deduplicated Percentage of total 1 90.69639416460225 82.375 2 8.560418387007983 15.55 3 0.6881365262868153 1.875 4 0.055050922102945224 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.7625000000000002 0.0 0.0 0.0 0.0 106-107 2.1 0.0 0.0 0.0 0.0 108-109 2.45 0.0 0.0 0.0 0.0 110-111 2.6125 0.0 0.0 0.0 0.0 112-113 2.8375 0.0 0.0 0.0 0.0 114-115 3.1 0.0 0.0 0.0 0.0 116-117 3.4875 0.0 0.0 0.0 0.0 118-119 4.2 0.0 0.0 0.0 0.0 120-121 4.7375 0.0 0.0 0.0 0.0 122-123 5.2125 0.0 0.0 0.0 0.0 124-125 5.762499999999999 0.0 0.0 0.0 0.0 126-127 6.1875 0.0 0.0 0.0 0.0 128-129 6.6 0.0 0.0 0.0 0.0 130-131 7.237500000000001 0.0 0.0 0.0 0.0 132-133 7.7625 0.0 0.0 0.0 0.0 134-135 8.1875 0.0 0.0 0.0 0.0 136-137 8.7125 0.0 0.0 0.0 0.0 138-139 9.274999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919341 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919341_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.312 37.0 37.0 37.0 37.0 37.0 2 36.206 37.0 37.0 37.0 37.0 37.0 3 36.125 37.0 37.0 37.0 37.0 37.0 4 36.327 37.0 37.0 37.0 37.0 37.0 5 36.3545 37.0 37.0 37.0 37.0 37.0 6 36.3075 37.0 37.0 37.0 37.0 37.0 7 36.211 37.0 37.0 37.0 37.0 37.0 8 36.3195 37.0 37.0 37.0 37.0 37.0 9 36.317 37.0 37.0 37.0 37.0 37.0 10-14 36.3833 37.0 37.0 37.0 37.0 37.0 15-19 36.3389 37.0 37.0 37.0 37.0 37.0 20-24 36.297900000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.272200000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.2217 37.0 37.0 37.0 37.0 37.0 35-39 36.1999 37.0 37.0 37.0 37.0 37.0 40-44 36.1399 37.0 37.0 37.0 37.0 37.0 45-49 36.163599999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.1142 37.0 37.0 37.0 37.0 37.0 55-59 36.0659 37.0 37.0 37.0 37.0 37.0 60-64 36.064 37.0 37.0 37.0 37.0 37.0 65-69 36.0515 37.0 37.0 37.0 37.0 37.0 70-74 36.048500000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.9234 37.0 37.0 37.0 37.0 37.0 80-84 35.92909999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.9551 37.0 37.0 37.0 37.0 37.0 90-94 35.8892 37.0 37.0 37.0 37.0 37.0 95-99 35.8446 37.0 37.0 37.0 37.0 37.0 100-104 35.8548 37.0 37.0 37.0 37.0 37.0 105-109 35.848699999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.809 37.0 37.0 37.0 37.0 37.0 115-119 35.7733 37.0 37.0 37.0 37.0 37.0 120-124 35.691500000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.724399999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.559200000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.373900000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.3506 37.0 37.0 37.0 34.6 37.0 145-149 35.2247 37.0 37.0 37.0 27.4 37.0 150-151 35.03775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 2.0 15 2.0 16 0.0 17 1.0 18 0.0 19 1.0 20 1.0 21 4.0 22 5.0 23 3.0 24 6.0 25 6.0 26 3.0 27 17.0 28 11.0 29 21.0 30 17.0 31 34.0 32 59.0 33 97.0 34 200.0 35 559.0 36 2679.0 37 269.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.85 24.175 11.275 28.7 2 25.775 27.575 29.95 16.7 3 20.3 27.750000000000004 31.275 20.674999999999997 4 23.825 34.775 24.325 17.075000000000003 5 26.424999999999997 36.775000000000006 19.925 16.875 6 20.575 38.074999999999996 22.6 18.75 7 20.724999999999998 23.400000000000002 37.0 18.875 8 20.925 26.85 27.925 24.3 9 23.825 24.725 28.95 22.5 10-14 24.055 29.465000000000003 25.805 20.674999999999997 15-19 23.669999999999998 27.97 27.515 20.845 20-24 24.2 27.860000000000003 27.544999999999998 20.395 25-29 23.255 28.67 27.55 20.525 30-34 23.29 28.449999999999996 28.005000000000003 20.255000000000003 35-39 23.64 28.189999999999998 27.49 20.68 40-44 23.875 28.18 27.515 20.43 45-49 23.445 28.33 27.33 20.895 50-54 23.915 28.299999999999997 27.339999999999996 20.445 55-59 24.565 27.965 27.33 20.14 60-64 23.69 28.694999999999997 27.235 20.380000000000003 65-69 23.494999999999997 28.189999999999998 27.77 20.544999999999998 70-74 24.115000000000002 28.01 27.089999999999996 20.785 75-79 23.385 28.255000000000003 27.55 20.810000000000002 80-84 23.77 27.66 27.994999999999997 20.575 85-89 24.67 27.715 26.96 20.655 90-94 24.060000000000002 28.205000000000002 27.33 20.405 95-99 24.185000000000002 28.110000000000003 27.43 20.275000000000002 100-104 24.37 27.675 27.200000000000003 20.755000000000003 105-109 23.745 27.61 27.96 20.685000000000002 110-114 24.935 27.744999999999997 27.37 19.950000000000003 115-119 24.515 28.88 26.400000000000002 20.205000000000002 120-124 24.825 27.939999999999998 27.26 19.975 125-129 25.45 28.305000000000003 26.445 19.8 130-134 25.845000000000002 28.055000000000003 26.58 19.52 135-139 25.580000000000002 27.800000000000004 26.650000000000002 19.97 140-144 26.0 28.060000000000002 26.474999999999998 19.465 145-149 26.655 27.405 26.415 19.525000000000002 150-151 27.2625 27.787499999999998 26.3125 18.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.0 25 0.5 26 2.5 27 4.0 28 4.5 29 8.0 30 14.5 31 19.5 32 26.0 33 35.0 34 46.0 35 58.0 36 71.0 37 100.5 38 126.0 39 157.0 40 207.5 41 231.0 42 257.5 43 267.0 44 266.0 45 285.5 46 281.0 47 270.0 48 239.0 49 195.0 50 164.5 51 140.0 52 110.5 53 86.0 54 76.0 55 58.0 56 40.5 57 33.0 58 26.0 59 24.0 60 18.0 61 8.5 62 7.0 63 6.5 64 5.0 65 3.5 66 3.5 67 3.0 68 2.0 69 1.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.85 #Duplication Level Percentage of deduplicated Percentage of total 1 90.78150798018713 82.475 2 8.420473307649972 15.299999999999999 3 0.7429829389102918 2.025 4 0.0550357732526142 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.1124999999999998 0.0 0.0 0.0 0.0 100-101 1.3375 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.8125 0.0 0.0 0.0 0.0 106-107 2.15 0.0 0.0 0.0 0.0 108-109 2.5 0.0 0.0 0.0 0.0 110-111 2.6625 0.0 0.0 0.0 0.0 112-113 2.8875 0.0 0.0 0.0 0.0 114-115 3.15 0.0 0.0 0.0 0.0 116-117 3.5375 0.0 0.0 0.0 0.0 118-119 4.275 0.0 0.0 0.0 0.0 120-121 4.824999999999999 0.0 0.0 0.0 0.0 122-123 5.300000000000001 0.0 0.0 0.0 0.0 124-125 5.8375 0.0 0.0 0.0 0.0 126-127 6.262499999999999 0.0 0.0 0.0 0.0 128-129 6.675 0.0 0.0 0.0 0.0 130-131 7.325 0.0 0.0 0.0 0.0 132-133 7.8625 0.0 0.0 0.0 0.0 134-135 8.3125 0.0 0.0 0.0 0.0 136-137 8.8375 0.0 0.0 0.0 0.0 138-139 9.399999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1171859 spots for SRR12919341.sra Written 1171859 spots for SRR12919341.sra Read 1171859 spots for SRR12919341.sra Written 1171859 spots for SRR12919341.sra Read 1171859 spots for SRR12919341.sra Written 1171859 spots for SRR12919341.sra Read 1171859 spots for SRR12919341.sra Written 1171859 spots for SRR12919341.sra Read 1171859 spots for SRR12919341.sra Written 1171859 spots for SRR12919341.sra Read 1171859 spots for SRR12919341.sra Written 1171859 spots for SRR12919341.sra Read 1171859 spots for SRR12919341.sra Written 1171859 spots for SRR12919341.sra Read 1171859 spots for SRR12919341.sra Written 1171859 spots for SRR12919341.sra Read 1171869 spots for SRR12919341.sra Written 1171869 spots for SRR12919341.sra Read 1171859 spots for SRR12919341.sra Written 1171859 spots for SRR12919341.sra Read 1171859 spots for SRR12919341.sra Written 1171859 spots for SRR12919341.sra Read 1171859 spots for SRR12919341.sra Written 1171859 spots for SRR12919341.sra Read 1171859 spots for SRR12919341.sra Written 1171859 spots for SRR12919341.sra Read 1171859 spots for SRR12919341.sra Written 1171859 spots for SRR12919341.sra Read 1171859 spots for SRR12919341.sra Written 1171859 spots for SRR12919341.sra Read 1171859 spots for SRR12919341.sra Written 1171859 spots for SRR12919341.sra Read 1171859 spots for SRR12919341.sra Written 1171859 spots for SRR12919341.sra Read 1171859 spots for SRR12919341.sra Written 1171859 spots for SRR12919341.sra Read 1171859 spots for SRR12919341.sra Written 1171859 spots for SRR12919341.sra Read 1171859 spots for SRR12919341.sra Written 1171859 spots for SRR12919341.sra SRR ids: ['SRR12919341.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j61xfazs SRR12919341.sra spots: 23437190 blocks: [[1, 1171859], [1171860, 2343718], [2343719, 3515577], [3515578, 4687436], [4687437, 5859295], [5859296, 7031154], [7031155, 8203013], [8203014, 9374872], [9374873, 10546731], [10546732, 11718590], [11718591, 12890449], [12890450, 14062308], [14062309, 15234167], [15234168, 16406026], [16406027, 17577885], [17577886, 18749744], [18749745, 19921603], [19921604, 21093462], [21093463, 22265321], [22265322, 23437190]] SRR12919341 file size 7943282 SRR12919341 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919341 SRR12919341_1.fastq SRR12919341_2.fastq Input file: SRR12919341_1.fastq Paired file: SRR12919341_2.fastq trimmed: SRR12919341-trimmed-pair1.fastq, SRR12919341-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:24:54 2025 >> started Wed Feb 12 19:25:33 2025 >> done (38.648s) 23437190 read pairs processed; of these: 25 ( 0.00%) short read pairs filtered out after trimming by size control 1481 ( 0.01%) empty read pairs filtered out after trimming by size control 23435684 (99.99%) read pairs available; of these: 3126185 (13.34%) trimmed read pairs available after processing 20309499 (86.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 1 0.00% 21 6 0.00% 22 5 0.00% 23 6 0.00% 24 5 0.00% 25 6 0.00% 26 8 0.00% 27 8 0.00% 28 6 0.00% 29 10 0.00% 30 12 0.00% 31 11 0.00% 32 6 0.00% 33 11 0.00% 34 15 0.00% 35 16 0.00% 36 16 0.00% 37 24 0.00% 38 22 0.00% 39 24 0.00% 40 27 0.00% 41 31 0.00% 42 23 0.00% 43 19 0.00% 44 35 0.00% 45 27 0.00% 46 29 0.00% 47 47 0.00% 48 43 0.00% 49 48 0.00% 50 53 0.00% 51 64 0.00% 52 73 0.00% 53 66 0.00% 54 80 0.00% 55 109 0.00% 56 107 0.00% 57 124 0.00% 58 153 0.00% 59 218 0.00% 60 198 0.00% 61 287 0.00% 62 339 0.00% 63 365 0.00% 64 407 0.00% 65 432 0.00% 66 507 0.00% 67 587 0.00% 68 689 0.00% 69 798 0.00% 70 999 0.00% 71 1123 0.00% 72 1290 0.01% 73 1582 0.01% 74 1727 0.01% 75 2035 0.01% 76 2252 0.01% 77 2448 0.01% 78 2790 0.01% 79 3082 0.01% 80 3581 0.02% 81 4110 0.02% 82 4776 0.02% 83 5594 0.02% 84 6044 0.03% 85 6968 0.03% 86 7714 0.03% 87 8186 0.03% 88 8815 0.04% 89 9577 0.04% 90 10422 0.04% 91 11552 0.05% 92 12688 0.05% 93 14041 0.06% 94 15653 0.07% 95 17069 0.07% 96 18016 0.08% 97 19186 0.08% 98 19523 0.08% 99 21256 0.09% 100 22184 0.09% 101 23301 0.10% 102 25405 0.11% 103 27214 0.12% 104 28870 0.12% 105 30167 0.13% 106 32116 0.14% 107 32909 0.14% 108 33582 0.14% 109 35407 0.15% 110 35772 0.15% 111 37269 0.16% 112 38945 0.17% 113 40782 0.17% 114 42701 0.18% 115 44888 0.19% 116 46275 0.20% 117 47448 0.20% 118 48894 0.21% 119 49189 0.21% 120 50574 0.22% 121 51945 0.22% 122 52930 0.23% 123 54739 0.23% 124 57006 0.24% 125 58514 0.25% 126 60079 0.26% 127 61508 0.26% 128 62347 0.27% 129 62954 0.27% 130 63917 0.27% 131 64929 0.28% 132 65327 0.28% 133 67202 0.29% 134 68371 0.29% 135 70758 0.30% 136 72124 0.31% 137 72822 0.31% 138 74203 0.32% 139 74824 0.32% 140 74870 0.32% 141 76102 0.32% 142 77449 0.33% 143 77671 0.33% 144 79481 0.34% 145 81162 0.35% 146 82645 0.35% 147 83606 0.36% 148 83466 0.36% 149 83570 0.36% 150 85462 0.36% 151 20309499 86.66% 23435684 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=19 prefix-density=0.36 prefix-fanout=2.4 sequence=GTTCTCTCCATTCTCTGGATAATTGAAATCTCCAAATACCAGTTTACCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=134.91 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=10.8 sequence=CATCACCATCCCTGATTGATCTTTGATTCACAACAAGACCAACCAACCGTACAATGTTTACATAACTTGGGATAATCTCACAAGAAAGAAAGATCAATACAAAACTAGTCAGCTCAGGATGTTCCAGGCACGGTAGAACCGTGGAACCATAACAACAAGAGACATATTGCAGATAAGTACTGAAAAACAAAACACAGTACGTATTTACATGGGCAACCTTGGTTGAAGGCAACCTCATCAACGATGCTCGCTCTTCGTCTCTCCACTGTACATCCAGTCATAGACAGTGGGTGTGTTAGGCTGTGGCTTGTCAAAAACATGAGCACCAATATTCTTAGTAGCAAGGTTGCTACCAGGGTGGAACACGCTCCTCCAAACATTGCTACGCGCCGACACTGGGGTTGTAGGGGTCACTGGTGTCGTCGGTGTCCCTGGAGTTCCTGGCATAGTCATGGACCTCTGAAACTTATTAACAGGACTGCTCCCCTCTCCGACGTCAATATCTTTGATG criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=16 prefix-density=0.39 prefix-fanout=2.5 sequence=AAGTTTTCTGGCTTCCCATCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=345.63 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=16.0 sequence=AGAGAAAAGATAAGCTAGGCAAGATGGTTTTACTAGACAAGATGTGGGATGATGTTGTTGCTGGACCTCAGCCAGAACGTGGCCTTGGCAAGCTTAGAAAGATCAGCACCAGACCACTTAACATCAAAGATATTGACGTCGGAGAGGGGAGCAGTCCTGTTAATAAGTTTCAGAGGTCCATGACTATGCCAGGAACTCCAGGGACACCGACGACACCAGTGACCCCTACAACCCCAGTGTCGGCGCGTAGCAATGTTTGGAGGAGCGTGTTCCACCCTGGTAGCAACCTTGCTACTAAGAATATTGGTGCTCATGTTTTTGACAAGCCACAGCCTAACACACCCACTGTCTATGACTGGATGTACAGTGGAGAGACGAAGAGCGAGCATCGTTGATGAGGTTGCCTTCAACCAAGGTTGCCCATGTAAATACGTACTGTGTTTTGTTTTTCAGTACTTATCTGCAATATGTCTCTTGTTGTTATGGTTCCACGGTTCTACCGTGCCTGGAA SRR12919341 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:26:20 Started mapping on | Feb 12 19:26:20 Finished on | Feb 12 19:30:47 Mapping speed, Million of reads per hour | 315.99 Number of input reads | 23435684 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 21653295 Uniquely mapped reads % | 92.39% Average mapped length | 294.48 Number of splices: Total | 20945118 Number of splices: Annotated (sjdb) | 20480926 Number of splices: GT/AG | 20573321 Number of splices: GC/AG | 289732 Number of splices: AT/AC | 23210 Number of splices: Non-canonical | 58855 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 596821 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 115903 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.43% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1185568 1185568 1185568 N_multimapping 596821 596821 596821 N_noFeature 731748 21422505 849146 N_ambiguous 239053 1463 124615 UnstrandedReadsAssigned:20682494 PositiveStrandReadsAssigned:229327 NegativeStrandReadsAssigned:20679534 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919341 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919341-trimmed-pair1.fastq SRR12919341-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,435,684 reads, 20,774,266 reads pseudoaligned [quant] estimated average fragment length: 247.634 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR12919341.ke.tsv 34699 SRR12919341.se.tsv 87100 total ==> SRR12919341.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.37 1364 35.9737 Potri.005G024800.1.v4.1 1035 788.366 1742 103.229 Potri.004G059700.1.v4.1 961 714.558 39 2.5498 Potri.007G009000.2.v4.1 1416 1169.37 0 0 Potri.003G141000.2.v4.1 2943 2696.37 895.547 15.5163 Potri.016G087400.1.v4.1 270 89.2721 1733.51 907.175 Potri.015G069301.1.v4.1 564 329.849 0 0 Potri.010G195200.1.v4.1 1773 1526.37 134 4.10134 Potri.012G127500.1.v4.1 977 730.457 8127 519.775 ==> SRR12919341.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 125 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 256 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 28 SRR12919341 completed mapping pipeline successfully