Starting /dee2/code/volunteer_pipeline.sh SRR12919342 current disk space = 3050888392704 free memory = 1581896532 SRR12919342 SRAfilesize 6249b8baac35cfe2c86e1621b44495c1 SRR12919342.sra SRR12919342.sra file validated SRR12919342 is paired end SRR12919342 is conventional basespace SRR12919342 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919342_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5695 37.0 37.0 37.0 37.0 37.0 2 36.12775 37.0 37.0 37.0 37.0 37.0 3 36.585 37.0 37.0 37.0 37.0 37.0 4 36.554 37.0 37.0 37.0 37.0 37.0 5 36.696 37.0 37.0 37.0 37.0 37.0 6 36.6715 37.0 37.0 37.0 37.0 37.0 7 36.648 37.0 37.0 37.0 37.0 37.0 8 36.7005 37.0 37.0 37.0 37.0 37.0 9 36.66 37.0 37.0 37.0 37.0 37.0 10-14 36.637800000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.660900000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.626400000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5693 37.0 37.0 37.0 37.0 37.0 30-34 36.5601 37.0 37.0 37.0 37.0 37.0 35-39 36.5736 37.0 37.0 37.0 37.0 37.0 40-44 36.5366 37.0 37.0 37.0 37.0 37.0 45-49 36.522200000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.4476 37.0 37.0 37.0 37.0 37.0 55-59 36.4697 37.0 37.0 37.0 37.0 37.0 60-64 36.4077 37.0 37.0 37.0 37.0 37.0 65-69 36.4009 37.0 37.0 37.0 37.0 37.0 70-74 36.4063 37.0 37.0 37.0 37.0 37.0 75-79 36.3306 37.0 37.0 37.0 37.0 37.0 80-84 36.3756 37.0 37.0 37.0 37.0 37.0 85-89 36.213499999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.207100000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.2042 37.0 37.0 37.0 37.0 37.0 100-104 36.147000000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.1405 37.0 37.0 37.0 37.0 37.0 110-114 36.084 37.0 37.0 37.0 37.0 37.0 115-119 36.0705 37.0 37.0 37.0 37.0 37.0 120-124 36.02579999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.939099999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.9577 37.0 37.0 37.0 37.0 37.0 135-139 35.8565 37.0 37.0 37.0 37.0 37.0 140-144 35.756299999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.727999999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.553 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 2.0 26 7.0 27 4.0 28 9.0 29 20.0 30 21.0 31 33.0 32 39.0 33 59.0 34 134.0 35 306.0 36 2992.0 37 373.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.525 12.9 6.25 41.325 2 17.98234552332913 13.215636822194199 39.36948297604035 29.43253467843632 3 15.725 16.975 29.4 37.9 4 20.65 25.3 24.525 29.525000000000002 5 21.825 32.675 23.150000000000002 22.35 6 19.825 34.625 24.474999999999998 21.075 7 15.575 26.025 40.325 18.075 8 15.925 25.900000000000002 32.4 25.775 9 17.75 24.3 34.75 23.200000000000003 10-14 19.2 29.849999999999998 27.98 22.97 15-19 18.695 28.735 27.685 24.884999999999998 20-24 20.135 28.43 27.675 23.76 25-29 19.305 28.999999999999996 27.71 23.985 30-34 19.28 27.985 27.894999999999996 24.84 35-39 19.6 28.785 27.339999999999996 24.275 40-44 19.145 29.439999999999998 27.72 23.695 45-49 19.685 28.07 27.62 24.625 50-54 19.685 29.21 27.305 23.799999999999997 55-59 19.445 27.889999999999997 28.53 24.135 60-64 19.63 28.249999999999996 27.725 24.395 65-69 19.54 28.849999999999998 27.38 24.23 70-74 19.42 28.955 27.68 23.945 75-79 19.57 28.275 27.825 24.33 80-84 20.01 28.815 27.74 23.435 85-89 20.11 28.585 27.82 23.485 90-94 20.380000000000003 28.325 27.33 23.965 95-99 19.950000000000003 28.634999999999998 28.005000000000003 23.41 100-104 20.244999999999997 28.48 27.47 23.805 105-109 19.794999999999998 28.9 27.205000000000002 24.099999999999998 110-114 19.950000000000003 27.855 28.15 24.044999999999998 115-119 20.13 28.715000000000003 27.229999999999997 23.925 120-124 20.330000000000002 28.275 27.55 23.845 125-129 20.235 28.749999999999996 26.805 24.21 130-134 20.34 29.049999999999997 27.02 23.59 135-139 20.53 28.27 27.134999999999998 24.065 140-144 20.145 28.345 27.400000000000002 24.11 145-149 21.435000000000002 27.765 26.865 23.935000000000002 150-151 20.0875 27.5875 28.000000000000004 24.325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.0 24 0.0 25 2.5 26 4.0 27 7.5 28 13.0 29 16.0 30 19.0 31 26.5 32 29.0 33 36.5 34 54.0 35 59.5 36 77.0 37 114.0 38 135.5 39 159.5 40 202.5 41 238.5 42 258.5 43 245.5 44 256.5 45 284.5 46 270.0 47 267.5 48 247.5 49 203.5 50 171.0 51 132.0 52 104.5 53 88.5 54 72.5 55 54.0 56 36.5 57 29.5 58 24.0 59 14.5 60 9.0 61 7.0 62 6.5 63 4.0 64 2.5 65 3.5 66 3.0 67 2.0 68 0.5 69 0.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.8750000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.55 #Duplication Level Percentage of deduplicated Percentage of total 1 90.72335726118168 82.15 2 8.19988956377692 14.85 3 0.9939260077305356 2.7 4 0.08282716731087797 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 1.8625 0.0 0.0 0.0 0.0 108-109 1.975 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.475 0.0 0.0 0.0 0.0 114-115 2.75 0.0 0.0 0.0 0.0 116-117 3.125 0.0 0.0 0.0 0.0 118-119 3.325 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 3.95 0.0 0.0 0.0 0.0 124-125 4.3875 0.0 0.0 0.0 0.0 126-127 4.7625 0.0 0.0 0.0 0.0 128-129 5.2125 0.0 0.0 0.0 0.0 130-131 5.7 0.0 0.0 0.0 0.0 132-133 6.15 0.0 0.0 0.0 0.0 134-135 6.449999999999999 0.0 0.0 0.0 0.0 136-137 6.9875 0.0 0.0 0.0 0.0 138-139 7.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTCAG 10 0.006830828 145.0 9 GCCGAGT 10 0.006830828 145.0 1 >>END_MODULE SRR12919342 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919342_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2225 37.0 37.0 37.0 37.0 37.0 2 36.1515 37.0 37.0 37.0 37.0 37.0 3 36.244 37.0 37.0 37.0 37.0 37.0 4 36.1865 37.0 37.0 37.0 37.0 37.0 5 36.333 37.0 37.0 37.0 37.0 37.0 6 36.3225 37.0 37.0 37.0 37.0 37.0 7 36.252 37.0 37.0 37.0 37.0 37.0 8 36.385 37.0 37.0 37.0 37.0 37.0 9 36.2945 37.0 37.0 37.0 37.0 37.0 10-14 36.3214 37.0 37.0 37.0 37.0 37.0 15-19 36.302499999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.3003 37.0 37.0 37.0 37.0 37.0 25-29 36.2145 37.0 37.0 37.0 37.0 37.0 30-34 36.221900000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.1474 37.0 37.0 37.0 37.0 37.0 40-44 36.1539 37.0 37.0 37.0 37.0 37.0 45-49 36.120599999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.0197 37.0 37.0 37.0 37.0 37.0 55-59 36.0882 37.0 37.0 37.0 37.0 37.0 60-64 36.0775 37.0 37.0 37.0 37.0 37.0 65-69 36.029 37.0 37.0 37.0 37.0 37.0 70-74 35.94670000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.9678 37.0 37.0 37.0 37.0 37.0 80-84 35.9563 37.0 37.0 37.0 37.0 37.0 85-89 35.9288 37.0 37.0 37.0 37.0 37.0 90-94 35.86 37.0 37.0 37.0 37.0 37.0 95-99 35.8207 37.0 37.0 37.0 37.0 37.0 100-104 35.75939999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.858 37.0 37.0 37.0 37.0 37.0 110-114 35.799400000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.761 37.0 37.0 37.0 37.0 37.0 120-124 35.728699999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.6652 37.0 37.0 37.0 37.0 37.0 130-134 35.529700000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.46470000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.283500000000004 37.0 37.0 37.0 32.2 37.0 145-149 35.2039 37.0 37.0 37.0 29.8 37.0 150-151 35.00975 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 6.0 14 4.0 15 2.0 16 0.0 17 0.0 18 0.0 19 3.0 20 1.0 21 0.0 22 4.0 23 3.0 24 7.0 25 6.0 26 6.0 27 5.0 28 13.0 29 17.0 30 24.0 31 35.0 32 66.0 33 114.0 34 203.0 35 562.0 36 2610.0 37 309.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.975 26.724999999999998 8.649999999999999 28.65 2 25.924999999999997 27.3 31.900000000000002 14.875 3 19.85 27.375 33.725 19.05 4 21.224999999999998 35.675000000000004 24.55 18.55 5 24.575 37.35 21.55 16.525000000000002 6 22.2 38.4 21.6 17.8 7 20.225 24.325 37.3 18.15 8 20.3 25.575 29.45 24.675 9 20.8 24.85 31.05 23.3 10-14 23.31 29.235 26.83 20.625 15-19 22.884999999999998 28.13 28.08 20.905 20-24 22.655 28.64 27.465 21.240000000000002 25-29 23.345 27.935 28.65 20.07 30-34 23.150000000000002 28.79 27.655 20.405 35-39 23.025000000000002 28.144999999999996 27.894999999999996 20.935000000000002 40-44 23.16 28.7 27.794999999999998 20.345 45-49 23.775 27.73 27.965 20.53 50-54 23.175 28.74 28.084999999999997 20.0 55-59 23.41 27.544999999999998 27.925 21.12 60-64 23.485 27.815 28.144999999999996 20.555 65-69 23.085 27.49 28.904999999999998 20.52 70-74 23.45 27.92 28.575 20.055 75-79 24.12 27.925 27.915 20.04 80-84 23.555 28.38 27.650000000000002 20.415 85-89 23.91 28.194999999999997 27.584999999999997 20.31 90-94 23.805 28.035 28.050000000000004 20.11 95-99 24.02 28.249999999999996 27.939999999999998 19.79 100-104 24.03 28.255000000000003 27.125 20.59 105-109 23.95 27.74 28.345 19.965 110-114 23.89 28.355000000000004 27.765 19.99 115-119 24.11 28.51 27.474999999999998 19.905 120-124 25.180000000000003 27.875 27.084999999999997 19.86 125-129 24.48 27.755000000000003 27.805000000000003 19.96 130-134 24.795 28.7 27.255000000000003 19.25 135-139 25.380000000000003 27.42 27.810000000000002 19.39 140-144 24.795 28.1 27.400000000000002 19.705000000000002 145-149 25.905 27.725 27.295 19.075 150-151 26.025 26.8 27.712500000000002 19.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 1.5 25 1.5 26 3.0 27 3.5 28 8.5 29 17.5 30 20.5 31 26.5 32 32.5 33 41.0 34 56.0 35 62.5 36 82.0 37 123.5 38 148.5 39 173.5 40 213.0 41 236.5 42 263.0 43 301.0 44 289.5 45 250.0 46 250.5 47 248.0 48 227.0 49 190.0 50 153.5 51 130.5 52 106.5 53 78.5 54 60.0 55 50.5 56 32.0 57 25.5 58 24.0 59 14.0 60 7.5 61 9.5 62 8.0 63 4.0 64 2.5 65 2.0 66 1.0 67 0.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 1.5 83 1.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.8 #Duplication Level Percentage of deduplicated Percentage of total 1 90.94162995594714 82.575 2 8.122246696035242 14.75 3 0.8259911894273128 2.25 4 0.08259911894273128 0.3 5 0.027533039647577095 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAAGCCATGGGAGAGATCAAGCACTTAGTGGTTGTTAAGTTCAAGGAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.2625000000000002 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.85 0.0 0.0 0.0 0.0 108-109 1.975 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.475 0.0 0.0 0.0 0.0 114-115 2.75 0.0 0.0 0.0 0.0 116-117 3.125 0.0 0.0 0.0 0.0 118-119 3.325 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 3.925 0.0 0.0 0.0 0.0 124-125 4.375 0.0 0.0 0.0 0.0 126-127 4.7375 0.0 0.0 0.0 0.0 128-129 5.2125 0.0 0.0 0.0 0.0 130-131 5.7 0.0 0.0 0.0 0.0 132-133 6.15 0.0 0.0 0.0 0.0 134-135 6.449999999999999 0.0 0.0 0.0 0.0 136-137 7.0125 0.0 0.0 0.0 0.0 138-139 7.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCTCT 10 0.006830828 145.0 3 >>END_MODULE Read 1079163 spots for SRR12919342.sra Written 1079163 spots for SRR12919342.sra Read 1079163 spots for SRR12919342.sra Written 1079163 spots for SRR12919342.sra Read 1079163 spots for SRR12919342.sra Written 1079163 spots for SRR12919342.sra Read 1079163 spots for SRR12919342.sra Written 1079163 spots for SRR12919342.sra Read 1079163 spots for SRR12919342.sra Written 1079163 spots for SRR12919342.sra Read 1079163 spots for SRR12919342.sra Written 1079163 spots for SRR12919342.sra Read 1079163 spots for SRR12919342.sra Written 1079163 spots for SRR12919342.sra Read 1079163 spots for SRR12919342.sra Written 1079163 spots for SRR12919342.sra Read 1079163 spots for SRR12919342.sra Written 1079163 spots for SRR12919342.sra Read 1079163 spots for SRR12919342.sra Written 1079163 spots for SRR12919342.sra Read 1079163 spots for SRR12919342.sra Written 1079163 spots for SRR12919342.sra Read 1079163 spots for SRR12919342.sra Written 1079163 spots for SRR12919342.sra Read 1079163 spots for SRR12919342.sra Written 1079163 spots for SRR12919342.sra Read 1079173 spots for SRR12919342.sra Written 1079173 spots for SRR12919342.sra Read 1079163 spots for SRR12919342.sra Written 1079163 spots for SRR12919342.sra Read 1079163 spots for SRR12919342.sra Written 1079163 spots for SRR12919342.sra Read 1079163 spots for SRR12919342.sra Written 1079163 spots for SRR12919342.sra Read 1079163 spots for SRR12919342.sra Written 1079163 spots for SRR12919342.sra Read 1079163 spots for SRR12919342.sra Written 1079163 spots for SRR12919342.sra Read 1079163 spots for SRR12919342.sra Written 1079163 spots for SRR12919342.sra SRR ids: ['SRR12919342.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qhyf6tlc SRR12919342.sra spots: 21583270 blocks: [[1, 1079163], [1079164, 2158326], [2158327, 3237489], [3237490, 4316652], [4316653, 5395815], [5395816, 6474978], [6474979, 7554141], [7554142, 8633304], [8633305, 9712467], [9712468, 10791630], [10791631, 11870793], [11870794, 12949956], [12949957, 14029119], [14029120, 15108282], [15108283, 16187445], [16187446, 17266608], [17266609, 18345771], [18345772, 19424934], [19424935, 20504097], [20504098, 21583270]] SRR12919342 file size 7313239 SRR12919342 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919342 SRR12919342_1.fastq SRR12919342_2.fastq Input file: SRR12919342_1.fastq Paired file: SRR12919342_2.fastq trimmed: SRR12919342-trimmed-pair1.fastq, SRR12919342-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:54:52 2025 >> started Wed Feb 12 19:55:20 2025 >> done (27.702s) 21583270 read pairs processed; of these: 37 ( 0.00%) short read pairs filtered out after trimming by size control 953 ( 0.00%) empty read pairs filtered out after trimming by size control 21582280 (100.00%) read pairs available; of these: 2255124 (10.45%) trimmed read pairs available after processing 19327156 (89.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 9 0.00% 21 5 0.00% 22 5 0.00% 23 5 0.00% 24 14 0.00% 25 8 0.00% 26 10 0.00% 27 7 0.00% 28 10 0.00% 29 6 0.00% 30 13 0.00% 31 7 0.00% 32 12 0.00% 33 17 0.00% 34 13 0.00% 35 21 0.00% 36 17 0.00% 37 18 0.00% 38 19 0.00% 39 19 0.00% 40 18 0.00% 41 25 0.00% 42 24 0.00% 43 31 0.00% 44 24 0.00% 45 22 0.00% 46 34 0.00% 47 29 0.00% 48 41 0.00% 49 28 0.00% 50 47 0.00% 51 68 0.00% 52 70 0.00% 53 58 0.00% 54 66 0.00% 55 80 0.00% 56 95 0.00% 57 112 0.00% 58 119 0.00% 59 121 0.00% 60 149 0.00% 61 206 0.00% 62 247 0.00% 63 270 0.00% 64 290 0.00% 65 324 0.00% 66 348 0.00% 67 419 0.00% 68 490 0.00% 69 549 0.00% 70 699 0.00% 71 762 0.00% 72 958 0.00% 73 1167 0.01% 74 1285 0.01% 75 1432 0.01% 76 1532 0.01% 77 1737 0.01% 78 1973 0.01% 79 2267 0.01% 80 2637 0.01% 81 2984 0.01% 82 3625 0.02% 83 3994 0.02% 84 4505 0.02% 85 5019 0.02% 86 5435 0.03% 87 5860 0.03% 88 6268 0.03% 89 6910 0.03% 90 7699 0.04% 91 8300 0.04% 92 9520 0.04% 93 10522 0.05% 94 11434 0.05% 95 12326 0.06% 96 13074 0.06% 97 13736 0.06% 98 14295 0.07% 99 14903 0.07% 100 16019 0.07% 101 17016 0.08% 102 18157 0.08% 103 19756 0.09% 104 21091 0.10% 105 22259 0.10% 106 22703 0.11% 107 23367 0.11% 108 24204 0.11% 109 24834 0.12% 110 25474 0.12% 111 26978 0.13% 112 28206 0.13% 113 29103 0.13% 114 30837 0.14% 115 32066 0.15% 116 33133 0.15% 117 33988 0.16% 118 34610 0.16% 119 34898 0.16% 120 35230 0.16% 121 36551 0.17% 122 37526 0.17% 123 39155 0.18% 124 40741 0.19% 125 42115 0.20% 126 43195 0.20% 127 44150 0.20% 128 44498 0.21% 129 45322 0.21% 130 44896 0.21% 131 46464 0.22% 132 47122 0.22% 133 48432 0.22% 134 49349 0.23% 135 51288 0.24% 136 52177 0.24% 137 53154 0.25% 138 53650 0.25% 139 53812 0.25% 140 54462 0.25% 141 54990 0.25% 142 55768 0.26% 143 56134 0.26% 144 58246 0.27% 145 59812 0.28% 146 60077 0.28% 147 61154 0.28% 148 61576 0.29% 149 61550 0.29% 150 62325 0.29% 151 19327156 89.55% 21582280 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=20.04 fanout-score-rank=14 prefix-density=0.41 prefix-fanout=6.5 sequence=TTCTTGTCAAATGGAGGTTGCTCCTGGAGCCTAAATGTGTCAACGATGTCAACAACCTTGGCAGCTTGGTCATCAACACCCTCATCCTCATCACCTCCTTCAGCTGAAGGATTTGCACCAATGTCTACATCAACGGCTCCTTGAACAACCCACTTTCCTTCAACTTCCCACAGTATCCCATTCTCAATCTCCTTGTATGGGAACGAATCCGAGAGAAGCTCATCACCAGAGAGAAGATCTTGATAGACCAACATGATTGCGCAGAAGAGCTCCTCTCTTTCGGATCGACCCAAAGACAGACAAAGAAGCAGCGATTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=433.57 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=33.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=14.15 fanout-score-rank=16 prefix-density=0.35 prefix-fanout=6.9 sequence=TTTGACAAGAAGCAGTTTCTTACACAGATTAAGAAATTTATCAAGAACCTGTCGGAGAAACTTGATGAGGACCAGAAGGAACATTTTAGAAAGAACATTGAGGGAGCAACCAAGTTCTTGCTTTCAAAAATCAAGGACTTGCAATTCTTTGTGGGGGAGAGCATGCATGATGATGGTTGTTTGGTCTTTGCTTATTACAAAGAAGGTGCTACCGATCCAACATTCTTGTACTTTGCCCCTTCTTTGAAGGAGGTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=654.23 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=15.3 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAGCTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGA SRR12919342 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:56:05 Started mapping on | Feb 12 19:56:06 Finished on | Feb 12 19:58:32 Mapping speed, Million of reads per hour | 532.17 Number of input reads | 21582280 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20068211 Uniquely mapped reads % | 92.98% Average mapped length | 295.57 Number of splices: Total | 18909432 Number of splices: Annotated (sjdb) | 18469796 Number of splices: GT/AG | 18554628 Number of splices: GC/AG | 277223 Number of splices: AT/AC | 21289 Number of splices: Non-canonical | 56292 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 522792 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 58423 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.20% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 991277 991277 991277 N_multimapping 522792 522792 522792 N_noFeature 755000 19844838 858331 N_ambiguous 232358 1139 111670 UnstrandedReadsAssigned:19080853 PositiveStrandReadsAssigned:222234 NegativeStrandReadsAssigned:19098210 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919342 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919342-trimmed-pair1.fastq SRR12919342-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,582,280 reads, 19,174,247 reads pseudoaligned [quant] estimated average fragment length: 266.091 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,223 rounds 52401 SRR12919342.ke.tsv 34699 SRR12919342.se.tsv 87100 total ==> SRR12919342.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.91 831 25.6294 Potri.005G024800.1.v4.1 1035 769.909 223 15.659 Potri.004G059700.1.v4.1 961 696.053 12 0.932044 Potri.007G009000.2.v4.1 1416 1150.91 2 0.0939478 Potri.003G141000.2.v4.1 2943 2677.91 755.855 15.2595 Potri.016G087400.1.v4.1 270 85.9144 1391.49 875.61 Potri.015G069301.1.v4.1 564 316.036 0 0 Potri.010G195200.1.v4.1 1773 1507.91 131 4.69671 Potri.012G127500.1.v4.1 977 711.984 12954 983.628 ==> SRR12919342.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 90 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 306 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12919342 completed mapping pipeline successfully