Starting /dee2/code/volunteer_pipeline.sh SRR12919343 current disk space = 3051158888448 free memory = 986076212 SRR12919343 SRAfilesize b4d864ef8c4363dde1ea97434711cbc9 SRR12919343.sra SRR12919343.sra file validated SRR12919343 is paired end SRR12919343 is conventional basespace SRR12919343 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919343_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.512 37.0 37.0 37.0 37.0 37.0 2 36.28625 37.0 37.0 37.0 37.0 37.0 3 36.6255 37.0 37.0 37.0 37.0 37.0 4 36.618 37.0 37.0 37.0 37.0 37.0 5 36.6635 37.0 37.0 37.0 37.0 37.0 6 36.6305 37.0 37.0 37.0 37.0 37.0 7 36.66 37.0 37.0 37.0 37.0 37.0 8 36.605 37.0 37.0 37.0 37.0 37.0 9 36.622 37.0 37.0 37.0 37.0 37.0 10-14 36.634699999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.6182 37.0 37.0 37.0 37.0 37.0 20-24 36.6074 37.0 37.0 37.0 37.0 37.0 25-29 36.5668 37.0 37.0 37.0 37.0 37.0 30-34 36.533500000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.5247 37.0 37.0 37.0 37.0 37.0 40-44 36.539699999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4908 37.0 37.0 37.0 37.0 37.0 50-54 36.4702 37.0 37.0 37.0 37.0 37.0 55-59 36.41760000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.4133 37.0 37.0 37.0 37.0 37.0 65-69 36.377599999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.380399999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.31739999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.3494 37.0 37.0 37.0 37.0 37.0 85-89 36.2453 37.0 37.0 37.0 37.0 37.0 90-94 36.2392 37.0 37.0 37.0 37.0 37.0 95-99 36.2556 37.0 37.0 37.0 37.0 37.0 100-104 36.178000000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.1765 37.0 37.0 37.0 37.0 37.0 110-114 36.112300000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.1091 37.0 37.0 37.0 37.0 37.0 120-124 36.0925 37.0 37.0 37.0 37.0 37.0 125-129 36.036699999999996 37.0 37.0 37.0 37.0 37.0 130-134 36.0553 37.0 37.0 37.0 37.0 37.0 135-139 35.8762 37.0 37.0 37.0 37.0 37.0 140-144 35.7728 37.0 37.0 37.0 37.0 37.0 145-149 35.736200000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.4095 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 6.0 27 13.0 28 12.0 29 22.0 30 22.0 31 25.0 32 26.0 33 85.0 34 119.0 35 283.0 36 2943.0 37 441.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.425000000000004 12.8 5.175 39.6 2 19.144654088050313 15.169811320754716 36.42767295597484 29.257861635220127 3 16.400000000000002 19.725 29.175 34.699999999999996 4 21.875 25.7 24.275 28.15 5 21.2 32.625 23.65 22.525000000000002 6 20.575 35.099999999999994 22.625 21.7 7 14.75 27.150000000000002 41.675000000000004 16.425 8 16.475 26.200000000000003 32.6 24.725 9 17.675 24.025 34.875 23.425 10-14 19.68 29.535 27.584999999999997 23.200000000000003 15-19 20.18 28.12 27.025 24.675 20-24 20.085 28.88 27.589999999999996 23.445 25-29 20.395 28.18 27.500000000000004 23.925 30-34 19.64 28.63 27.045 24.685000000000002 35-39 20.755000000000003 28.325 27.185 23.735 40-44 20.555 29.085 26.955000000000002 23.405 45-49 20.655 28.199999999999996 27.279999999999998 23.865 50-54 20.415 28.845 27.029999999999998 23.71 55-59 20.0 28.689999999999998 27.625 23.685000000000002 60-64 20.62 28.294999999999998 27.339999999999996 23.745 65-69 20.82 27.529999999999998 27.83 23.82 70-74 20.435 28.685 27.46 23.419999999999998 75-79 20.44 28.21 27.355 23.995 80-84 20.75 27.605 27.715 23.93 85-89 21.02 28.194999999999997 27.169999999999998 23.615 90-94 21.075 27.325 27.92 23.68 95-99 21.32 27.63 27.785 23.265 100-104 21.63 28.15 26.655 23.565 105-109 20.865000000000002 28.439999999999998 26.490000000000002 24.205 110-114 20.880000000000003 28.01 27.32 23.79 115-119 20.89 29.4 25.745 23.965 120-124 21.305 28.835 26.145000000000003 23.715 125-129 21.19 28.09 26.655 24.065 130-134 20.93 28.02 26.715 24.335 135-139 21.27 27.785 26.935 24.01 140-144 21.08 26.669999999999998 27.6 24.65 145-149 20.75 27.07 27.255000000000003 24.925 150-151 20.349999999999998 28.6875 26.9625 24.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 1.5 25 5.0 26 8.5 27 7.0 28 9.0 29 11.5 30 15.0 31 23.0 32 32.5 33 43.0 34 53.0 35 64.0 36 81.0 37 108.0 38 120.0 39 138.0 40 180.5 41 194.5 42 213.0 43 239.0 44 261.5 45 276.5 46 256.5 47 245.5 48 241.5 49 210.5 50 179.5 51 161.5 52 134.5 53 116.0 54 99.0 55 68.5 56 47.5 57 40.0 58 30.5 59 24.5 60 21.5 61 12.5 62 6.5 63 6.0 64 2.5 65 0.5 66 0.5 67 1.0 68 1.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.625 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.05 #Duplication Level Percentage of deduplicated Percentage of total 1 91.37836353651839 83.2 2 7.57825370675453 13.8 3 0.8786381109280615 2.4 4 0.16474464579901155 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.2999999999999998 0.0 0.0 0.0 0.0 100-101 1.4625 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.9125 0.0 0.0 0.0125 0.0 106-107 2.2375 0.0 0.0 0.025 0.0 108-109 2.675 0.0 0.0 0.025 0.0 110-111 3.1375 0.0 0.0 0.025 0.0 112-113 3.4875 0.0 0.0 0.025 0.0 114-115 3.85 0.0 0.0 0.025 0.0 116-117 4.5 0.0 0.0 0.025 0.0 118-119 5.0 0.0 0.0 0.025 0.0 120-121 5.5375 0.0 0.0 0.025 0.0 122-123 6.1375 0.0 0.0 0.025 0.0 124-125 6.612500000000001 0.0 0.0 0.025 0.0 126-127 7.125 0.0 0.0 0.025 0.0 128-129 7.7875 0.0 0.0 0.025 0.0 130-131 8.225 0.0 0.0 0.025 0.0 132-133 8.7375 0.0 0.0 0.025 0.0 134-135 9.15 0.0 0.0 0.025 0.0 136-137 9.925 0.0 0.0 0.025 0.0 138-139 10.525 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACATA 10 0.006830828 145.0 9 AACCAGG 10 0.006830828 145.0 1 ACCAGGT 10 0.006830828 145.0 2 >>END_MODULE SRR12919343 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919343_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.29 37.0 37.0 37.0 37.0 37.0 2 36.209 37.0 37.0 37.0 37.0 37.0 3 36.2445 37.0 37.0 37.0 37.0 37.0 4 36.278 37.0 37.0 37.0 37.0 37.0 5 36.4615 37.0 37.0 37.0 37.0 37.0 6 36.45 37.0 37.0 37.0 37.0 37.0 7 36.365 37.0 37.0 37.0 37.0 37.0 8 36.3105 37.0 37.0 37.0 37.0 37.0 9 36.338 37.0 37.0 37.0 37.0 37.0 10-14 36.376400000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.384 37.0 37.0 37.0 37.0 37.0 20-24 36.2981 37.0 37.0 37.0 37.0 37.0 25-29 36.305 37.0 37.0 37.0 37.0 37.0 30-34 36.2156 37.0 37.0 37.0 37.0 37.0 35-39 36.158699999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.1807 37.0 37.0 37.0 37.0 37.0 45-49 36.145799999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.1295 37.0 37.0 37.0 37.0 37.0 55-59 36.1134 37.0 37.0 37.0 37.0 37.0 60-64 36.1023 37.0 37.0 37.0 37.0 37.0 65-69 36.106700000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.029900000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.0144 37.0 37.0 37.0 37.0 37.0 80-84 35.953900000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.948699999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.889 37.0 37.0 37.0 37.0 37.0 95-99 35.9289 37.0 37.0 37.0 37.0 37.0 100-104 35.8771 37.0 37.0 37.0 37.0 37.0 105-109 35.878299999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.8018 37.0 37.0 37.0 37.0 37.0 115-119 35.806799999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.6751 37.0 37.0 37.0 37.0 37.0 125-129 35.6496 37.0 37.0 37.0 37.0 37.0 130-134 35.573899999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.384 37.0 37.0 37.0 37.0 37.0 140-144 35.297000000000004 37.0 37.0 37.0 29.8 37.0 145-149 35.129200000000004 37.0 37.0 37.0 29.8 37.0 150-151 34.9695 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 7.0 15 1.0 16 2.0 17 3.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.0 23 2.0 24 4.0 25 8.0 26 11.0 27 9.0 28 15.0 29 20.0 30 25.0 31 31.0 32 44.0 33 95.0 34 208.0 35 487.0 36 2719.0 37 301.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.475 25.1 8.125 26.3 2 27.375 26.174999999999997 30.7 15.75 3 19.675 30.625000000000004 31.424999999999997 18.275 4 22.475 33.45 23.175 20.9 5 25.575 36.125 22.075 16.225 6 20.9 40.400000000000006 20.275000000000002 18.425 7 20.674999999999997 23.65 36.15 19.525000000000002 8 21.15 26.5 28.675 23.674999999999997 9 22.975 23.925 29.625 23.474999999999998 10-14 23.255 29.67 25.569999999999997 21.505 15-19 24.654999999999998 28.815 25.945 20.585 20-24 23.235 29.189999999999998 26.645000000000003 20.93 25-29 23.45 27.839999999999996 27.735 20.974999999999998 30-34 23.165 27.98 27.27 21.584999999999997 35-39 22.814999999999998 27.62 27.83 21.735 40-44 23.674999999999997 28.125 26.97 21.23 45-49 23.51 28.03 27.49 20.97 50-54 23.474999999999998 27.084999999999997 28.29 21.15 55-59 23.69 27.33 27.32 21.66 60-64 23.385 26.97 27.87 21.775 65-69 24.11 27.255000000000003 27.41 21.224999999999998 70-74 23.169999999999998 28.27 27.435 21.125 75-79 23.365 27.52 27.665 21.45 80-84 23.799999999999997 27.46 27.54 21.2 85-89 23.54 28.055000000000003 27.025 21.38 90-94 24.115000000000002 27.74 27.500000000000004 20.645 95-99 23.43 27.405 27.560000000000002 21.605 100-104 23.169999999999998 27.12 28.055000000000003 21.654999999999998 105-109 24.33 26.895000000000003 27.935 20.84 110-114 24.455 27.595 27.305 20.645 115-119 24.45 27.944999999999997 26.755000000000003 20.849999999999998 120-124 24.51 27.650000000000002 26.71 21.13 125-129 25.41 27.465 26.979999999999997 20.145 130-134 25.025 27.029999999999998 27.91 20.035 135-139 26.115 26.939999999999998 27.279999999999998 19.665 140-144 25.865 26.795 27.675 19.665 145-149 27.034999999999997 27.060000000000002 26.490000000000002 19.415 150-151 26.275 26.8 27.237499999999997 19.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 0.5 21 0.5 22 0.0 23 1.0 24 1.0 25 1.0 26 3.0 27 5.5 28 7.5 29 6.0 30 9.0 31 15.5 32 21.0 33 32.5 34 51.0 35 59.5 36 76.5 37 103.0 38 128.5 39 156.5 40 174.0 41 207.0 42 233.0 43 249.5 44 272.0 45 274.5 46 253.0 47 241.0 48 233.0 49 220.0 50 192.5 51 155.5 52 137.5 53 104.5 54 86.0 55 75.0 56 55.5 57 45.5 58 28.0 59 19.5 60 16.0 61 9.5 62 7.5 63 5.5 64 3.5 65 2.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 1.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.725 #Duplication Level Percentage of deduplicated Percentage of total 1 91.31992284375862 82.85 2 7.577845136401212 13.750000000000002 3 0.8266740148801324 2.25 4 0.2204464039680353 0.8 5 0.0 0.0 6 0.027555800496004413 0.15 7 0.0 0.0 8 0.027555800496004413 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 8 0.2 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 1.0499999999999998 0.0 0.0 0.0 0.0 98-99 1.3250000000000002 0.0 0.0 0.0 0.0 100-101 1.4625 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 1.9625 0.0 0.0 0.0 0.0 106-107 2.2875 0.0 0.0 0.0 0.0 108-109 2.725 0.0 0.0 0.0 0.0 110-111 3.1875 0.0 0.0 0.0 0.0 112-113 3.5374999999999996 0.0 0.0 0.0 0.0 114-115 3.9000000000000004 0.0 0.0 0.0 0.0 116-117 4.550000000000001 0.0 0.0 0.0 0.0 118-119 5.05 0.0 0.0 0.0 0.0 120-121 5.5875 0.0 0.0 0.0 0.0 122-123 6.1875 0.0 0.0 0.0 0.0 124-125 6.7125 0.0 0.0 0.0 0.0 126-127 7.225 0.0 0.0 0.0 0.0 128-129 7.9 0.0 0.0 0.0 0.0 130-131 8.35 0.0 0.0 0.0 0.0 132-133 8.8625 0.0 0.0 0.0 0.0 134-135 9.275 0.0 0.0 0.0 0.0 136-137 10.05 0.0 0.0 0.0 0.0 138-139 10.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1147204 spots for SRR12919343.sra Written 1147204 spots for SRR12919343.sra Read 1147204 spots for SRR12919343.sra Written 1147204 spots for SRR12919343.sra Read 1147204 spots for SRR12919343.sra Written 1147204 spots for SRR12919343.sra Read 1147204 spots for SRR12919343.sra Written 1147204 spots for SRR12919343.sra Read 1147204 spots for SRR12919343.sra Written 1147204 spots for SRR12919343.sra Read 1147204 spots for SRR12919343.sra Written 1147204 spots for SRR12919343.sra Read 1147204 spots for SRR12919343.sra Written 1147204 spots for SRR12919343.sra Read 1147204 spots for SRR12919343.sra Written 1147204 spots for SRR12919343.sra Read 1147204 spots for SRR12919343.sra Written 1147204 spots for SRR12919343.sra Read 1147204 spots for SRR12919343.sra Written 1147204 spots for SRR12919343.sra Read 1147204 spots for SRR12919343.sra Written 1147204 spots for SRR12919343.sra Read 1147204 spots for SRR12919343.sra Written 1147204 spots for SRR12919343.sra Read 1147204 spots for SRR12919343.sra Written 1147204 spots for SRR12919343.sra Read 1147204 spots for SRR12919343.sra Written 1147204 spots for SRR12919343.sra Read 1147209 spots for SRR12919343.sra Written 1147209 spots for SRR12919343.sra Read 1147204 spots for SRR12919343.sra Written 1147204 spots for SRR12919343.sra Read 1147204 spots for SRR12919343.sra Written 1147204 spots for SRR12919343.sra Read 1147204 spots for SRR12919343.sra Written 1147204 spots for SRR12919343.sra Read 1147204 spots for SRR12919343.sra Written 1147204 spots for SRR12919343.sra Read 1147204 spots for SRR12919343.sra Written 1147204 spots for SRR12919343.sra SRR ids: ['SRR12919343.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6lvaoq5l SRR12919343.sra spots: 22944085 blocks: [[1, 1147204], [1147205, 2294408], [2294409, 3441612], [3441613, 4588816], [4588817, 5736020], [5736021, 6883224], [6883225, 8030428], [8030429, 9177632], [9177633, 10324836], [10324837, 11472040], [11472041, 12619244], [12619245, 13766448], [13766449, 14913652], [14913653, 16060856], [16060857, 17208060], [17208061, 18355264], [18355265, 19502468], [19502469, 20649672], [20649673, 21796876], [21796877, 22944085]] SRR12919343 file size 7775703 SRR12919343 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919343 SRR12919343_1.fastq SRR12919343_2.fastq Input file: SRR12919343_1.fastq Paired file: SRR12919343_2.fastq trimmed: SRR12919343-trimmed-pair1.fastq, SRR12919343-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:15:02 2025 >> started Wed Feb 12 19:15:32 2025 >> done (29.821s) 22944085 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 1871 ( 0.01%) empty read pairs filtered out after trimming by size control 22942193 (99.99%) read pairs available; of these: 3337485 (14.55%) trimmed read pairs available after processing 19604708 (85.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 7 0.00% 20 1 0.00% 21 4 0.00% 22 9 0.00% 23 5 0.00% 24 13 0.00% 25 5 0.00% 26 4 0.00% 27 7 0.00% 28 11 0.00% 29 4 0.00% 30 4 0.00% 31 7 0.00% 32 15 0.00% 33 8 0.00% 34 14 0.00% 35 10 0.00% 36 14 0.00% 37 13 0.00% 38 13 0.00% 39 18 0.00% 40 22 0.00% 41 22 0.00% 42 32 0.00% 43 31 0.00% 44 23 0.00% 45 17 0.00% 46 32 0.00% 47 38 0.00% 48 59 0.00% 49 63 0.00% 50 77 0.00% 51 86 0.00% 52 88 0.00% 53 98 0.00% 54 141 0.00% 55 134 0.00% 56 132 0.00% 57 160 0.00% 58 172 0.00% 59 246 0.00% 60 239 0.00% 61 359 0.00% 62 422 0.00% 63 502 0.00% 64 523 0.00% 65 527 0.00% 66 624 0.00% 67 639 0.00% 68 797 0.00% 69 921 0.00% 70 1183 0.01% 71 1495 0.01% 72 1754 0.01% 73 1978 0.01% 74 2306 0.01% 75 2444 0.01% 76 2648 0.01% 77 2960 0.01% 78 3148 0.01% 79 3715 0.02% 80 4350 0.02% 81 5005 0.02% 82 6006 0.03% 83 6773 0.03% 84 7790 0.03% 85 8243 0.04% 86 9037 0.04% 87 9585 0.04% 88 10031 0.04% 89 10754 0.05% 90 12289 0.05% 91 13380 0.06% 92 15415 0.07% 93 17144 0.07% 94 18999 0.08% 95 19936 0.09% 96 20868 0.09% 97 21418 0.09% 98 21925 0.10% 99 23473 0.10% 100 24447 0.11% 101 26408 0.12% 102 28487 0.12% 103 31043 0.14% 104 32820 0.14% 105 35217 0.15% 106 35758 0.16% 107 36428 0.16% 108 36796 0.16% 109 38020 0.17% 110 38346 0.17% 111 40430 0.18% 112 42922 0.19% 113 44763 0.20% 114 47501 0.21% 115 49420 0.22% 116 51288 0.22% 117 51986 0.23% 118 51795 0.23% 119 51652 0.23% 120 52993 0.23% 121 54642 0.24% 122 56229 0.25% 123 58985 0.26% 124 60811 0.27% 125 63022 0.27% 126 65124 0.28% 127 65168 0.28% 128 65280 0.28% 129 66001 0.29% 130 66202 0.29% 131 66323 0.29% 132 68014 0.30% 133 70712 0.31% 134 72790 0.32% 135 74995 0.33% 136 76732 0.33% 137 77031 0.34% 138 77813 0.34% 139 78134 0.34% 140 77195 0.34% 141 77319 0.34% 142 78656 0.34% 143 79767 0.35% 144 82450 0.36% 145 84598 0.37% 146 85722 0.37% 147 86209 0.38% 148 87340 0.38% 149 85449 0.37% 150 86786 0.38% 151 19604708 85.45% 22942193 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=14 prefix-density=0.85 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.14 sequence-density-rank=20 fanout-score=10.53 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=4.0 sequence=ACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=19 prefix-density=0.89 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=91.69 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=6.9 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTT SRR12919343 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:16:19 Started mapping on | Feb 12 19:16:19 Finished on | Feb 12 19:18:42 Mapping speed, Million of reads per hour | 577.57 Number of input reads | 22942193 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 21666671 Uniquely mapped reads % | 94.44% Average mapped length | 293.41 Number of splices: Total | 21415417 Number of splices: Annotated (sjdb) | 21037463 Number of splices: GT/AG | 20950127 Number of splices: GC/AG | 392754 Number of splices: AT/AC | 13293 Number of splices: Non-canonical | 59243 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 503981 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 33099 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.13% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 771541 771541 771541 N_multimapping 503981 503981 503981 N_noFeature 547478 21348506 645521 N_ambiguous 375801 1263 154937 UnstrandedReadsAssigned:20743392 PositiveStrandReadsAssigned:316902 NegativeStrandReadsAssigned:20866213 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919343 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919343-trimmed-pair1.fastq SRR12919343-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,942,193 reads, 20,962,591 reads pseudoaligned [quant] estimated average fragment length: 245.783 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR12919343.ke.tsv 34699 SRR12919343.se.tsv 87100 total ==> SRR12919343.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.22 481 11.8933 Potri.005G024800.1.v4.1 1035 790.217 195 10.8195 Potri.004G059700.1.v4.1 961 716.381 50 3.06017 Potri.007G009000.2.v4.1 1416 1171.22 0 0 Potri.003G141000.2.v4.1 2943 2698.22 804.379 13.0708 Potri.016G087400.1.v4.1 270 91.4125 924 443.186 Potri.015G069301.1.v4.1 564 332.514 0 0 Potri.010G195200.1.v4.1 1773 1528.22 13 0.372973 Potri.012G127500.1.v4.1 977 732.305 359 21.4942 ==> SRR12919343.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 326 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 301 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 12 SRR12919343 completed mapping pipeline successfully