Starting /dee2/code/volunteer_pipeline.sh SRR12919344 current disk space = 3050887553024 free memory = 1579220616 SRR12919344 SRAfilesize e370141802f8119553889d7349785887 SRR12919344.sra SRR12919344.sra file validated SRR12919344 is paired end SRR12919344 is conventional basespace SRR12919344 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919344_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.571 37.0 37.0 37.0 37.0 37.0 2 36.40275 37.0 37.0 37.0 37.0 37.0 3 36.5415 37.0 37.0 37.0 37.0 37.0 4 36.583 37.0 37.0 37.0 37.0 37.0 5 36.6485 37.0 37.0 37.0 37.0 37.0 6 36.6225 37.0 37.0 37.0 37.0 37.0 7 36.592 37.0 37.0 37.0 37.0 37.0 8 36.631 37.0 37.0 37.0 37.0 37.0 9 36.613 37.0 37.0 37.0 37.0 37.0 10-14 36.641200000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.622499999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.6023 37.0 37.0 37.0 37.0 37.0 25-29 36.549899999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.5259 37.0 37.0 37.0 37.0 37.0 35-39 36.503099999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.50449999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.4728 37.0 37.0 37.0 37.0 37.0 50-54 36.4517 37.0 37.0 37.0 37.0 37.0 55-59 36.4662 37.0 37.0 37.0 37.0 37.0 60-64 36.4041 37.0 37.0 37.0 37.0 37.0 65-69 36.382600000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.3471 37.0 37.0 37.0 37.0 37.0 75-79 36.3102 37.0 37.0 37.0 37.0 37.0 80-84 36.298199999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.2776 37.0 37.0 37.0 37.0 37.0 90-94 36.2257 37.0 37.0 37.0 37.0 37.0 95-99 36.1968 37.0 37.0 37.0 37.0 37.0 100-104 36.212 37.0 37.0 37.0 37.0 37.0 105-109 36.197500000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.079499999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.117000000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.064099999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.9593 37.0 37.0 37.0 37.0 37.0 130-134 35.9822 37.0 37.0 37.0 37.0 37.0 135-139 35.852700000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.6915 37.0 37.0 37.0 37.0 37.0 145-149 35.661199999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.436499999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 2.0 22 0.0 23 1.0 24 0.0 25 3.0 26 5.0 27 8.0 28 16.0 29 14.0 30 21.0 31 28.0 32 41.0 33 85.0 34 118.0 35 283.0 36 2926.0 37 448.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.800000000000004 12.25 4.65 38.3 2 19.784082349987447 12.578458448405724 36.203866432337435 31.433592769269396 3 17.474999999999998 16.5 27.85 38.175 4 21.775 24.95 24.925 28.349999999999998 5 23.325000000000003 31.35 24.575 20.75 6 20.025000000000002 35.65 23.1 21.224999999999998 7 15.5 27.325 40.225 16.950000000000003 8 16.900000000000002 26.200000000000003 32.7 24.2 9 16.775000000000002 26.0 33.875 23.35 10-14 19.689999999999998 29.630000000000003 27.865000000000002 22.814999999999998 15-19 20.18 27.66 27.99 24.169999999999998 20-24 19.695 28.79 27.87 23.645 25-29 20.075000000000003 28.689999999999998 27.625 23.61 30-34 19.88 28.18 28.115000000000002 23.825 35-39 20.205000000000002 28.215 27.815 23.765 40-44 20.125 28.410000000000004 27.675 23.79 45-49 20.055 28.610000000000003 26.650000000000002 24.685000000000002 50-54 19.919999999999998 27.92 28.015 24.145 55-59 19.99 28.28 27.615000000000002 24.115000000000002 60-64 19.794999999999998 27.994999999999997 27.965 24.245 65-69 20.26 28.67 27.21 23.86 70-74 20.595 28.59 27.785 23.03 75-79 20.015 28.565 27.534999999999997 23.885 80-84 19.950000000000003 28.58 27.825 23.645 85-89 20.985 28.139999999999997 27.644999999999996 23.23 90-94 20.82 28.395 26.86 23.925 95-99 20.775 28.115000000000002 27.155 23.955000000000002 100-104 20.94 28.804999999999996 27.57 22.685 105-109 21.07 27.855 27.384999999999998 23.69 110-114 20.36 28.134999999999998 27.315 24.19 115-119 21.63 28.03 27.435 22.905 120-124 20.215 27.889999999999997 27.27 24.625 125-129 21.185000000000002 28.04 26.69 24.085 130-134 20.635 28.285 26.93 24.15 135-139 20.54 27.994999999999997 27.060000000000002 24.404999999999998 140-144 21.445 28.02 26.33 24.205 145-149 21.235 27.975 26.57 24.22 150-151 20.4 29.037499999999998 25.624999999999996 24.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 1.0 22 2.0 23 2.0 24 1.0 25 2.5 26 4.5 27 3.5 28 5.0 29 9.5 30 13.5 31 19.5 32 36.5 33 50.0 34 50.5 35 63.5 36 86.5 37 105.5 38 125.5 39 149.5 40 181.5 41 220.0 42 222.5 43 233.5 44 269.0 45 275.5 46 256.5 47 250.5 48 242.5 49 210.0 50 194.0 51 161.5 52 124.0 53 107.5 54 86.0 55 61.0 56 47.5 57 38.5 58 26.0 59 20.5 60 12.5 61 4.5 62 4.5 63 5.0 64 3.5 65 2.5 66 2.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.42500000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.0 #Duplication Level Percentage of deduplicated Percentage of total 1 90.36111111111111 81.325 2 8.333333333333332 15.0 3 1.1944444444444444 3.225 4 0.05555555555555555 0.2 5 0.05555555555555555 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTACTGTCAATCTTGGATGGGGGTAGGTTTCTTCGTGATGTATACATTGG 5 0.125 No Hit TCCAGAGGCTCCGAGCGCCAATGCCTTGAAGACATCAGTTCCACGCCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.44999999999999996 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.725 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.1124999999999998 0.0 0.0 0.0 0.0 98-99 1.2999999999999998 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.7000000000000002 0.0 0.0 0.0 0.0 104-105 1.975 0.0 0.0 0.0 0.0 106-107 2.2625 0.0 0.0 0.0 0.0 108-109 2.5250000000000004 0.0 0.0 0.0 0.0 110-111 2.9 0.0 0.0 0.0 0.0 112-113 3.4125 0.0 0.0 0.0 0.0 114-115 3.7249999999999996 0.0 0.0 0.0 0.0 116-117 4.1 0.0 0.0 0.0 0.0 118-119 4.575 0.0 0.0 0.0 0.0 120-121 5.012499999999999 0.0 0.0 0.0 0.0 122-123 5.762499999999999 0.0 0.0 0.0 0.0 124-125 6.2625 0.0 0.0 0.0 0.0 126-127 6.75 0.0 0.0 0.0 0.0 128-129 7.262499999999999 0.0 0.0 0.0 0.0 130-131 7.8125 0.0 0.0 0.0 0.0 132-133 8.5625 0.0 0.0 0.0 0.0 134-135 9.15 0.0 0.0 0.0 0.0 136-137 9.8875 0.0 0.0 0.0 0.0 138-139 10.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919344 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919344_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3215 37.0 37.0 37.0 37.0 37.0 2 36.3165 37.0 37.0 37.0 37.0 37.0 3 36.2435 37.0 37.0 37.0 37.0 37.0 4 36.325 37.0 37.0 37.0 37.0 37.0 5 36.44 37.0 37.0 37.0 37.0 37.0 6 36.4235 37.0 37.0 37.0 37.0 37.0 7 36.2805 37.0 37.0 37.0 37.0 37.0 8 36.4335 37.0 37.0 37.0 37.0 37.0 9 36.501 37.0 37.0 37.0 37.0 37.0 10-14 36.406 37.0 37.0 37.0 37.0 37.0 15-19 36.3767 37.0 37.0 37.0 37.0 37.0 20-24 36.37650000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.36710000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.338499999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.285000000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.2316 37.0 37.0 37.0 37.0 37.0 45-49 36.250800000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.196000000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.1827 37.0 37.0 37.0 37.0 37.0 60-64 36.14190000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.153999999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.0783 37.0 37.0 37.0 37.0 37.0 75-79 36.0612 37.0 37.0 37.0 37.0 37.0 80-84 36.052099999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.0509 37.0 37.0 37.0 37.0 37.0 90-94 35.9904 37.0 37.0 37.0 37.0 37.0 95-99 35.976 37.0 37.0 37.0 37.0 37.0 100-104 35.9471 37.0 37.0 37.0 37.0 37.0 105-109 35.94349999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.9075 37.0 37.0 37.0 37.0 37.0 115-119 35.832800000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.783500000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.8239 37.0 37.0 37.0 37.0 37.0 130-134 35.7053 37.0 37.0 37.0 37.0 37.0 135-139 35.5023 37.0 37.0 37.0 37.0 37.0 140-144 35.4489 37.0 37.0 37.0 37.0 37.0 145-149 35.3035 37.0 37.0 37.0 34.6 37.0 150-151 35.048 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 3.0 15 2.0 16 0.0 17 0.0 18 0.0 19 3.0 20 3.0 21 0.0 22 0.0 23 8.0 24 4.0 25 7.0 26 9.0 27 9.0 28 10.0 29 15.0 30 23.0 31 23.0 32 50.0 33 84.0 34 181.0 35 493.0 36 2739.0 37 331.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.5 25.025 8.0 24.474999999999998 2 27.525 25.775 30.8 15.9 3 21.325 27.900000000000002 33.425 17.349999999999998 4 24.775 34.449999999999996 22.55 18.224999999999998 5 24.55 36.199999999999996 22.650000000000002 16.6 6 19.525000000000002 40.075 22.725 17.675 7 20.875 22.95 38.05 18.125 8 22.35 26.05 27.375 24.224999999999998 9 21.15 25.35 30.85 22.650000000000002 10-14 23.52 28.939999999999998 26.755000000000003 20.785 15-19 22.57 28.49 27.644999999999996 21.295 20-24 22.509999999999998 28.27 28.275 20.945 25-29 22.58 28.04 27.925 21.455 30-34 23.135 28.185 27.705000000000002 20.974999999999998 35-39 22.535 28.194999999999997 27.66 21.61 40-44 22.505 28.299999999999997 28.035 21.16 45-49 22.650000000000002 27.634999999999998 28.96 20.755000000000003 50-54 23.025000000000002 27.750000000000004 28.005000000000003 21.22 55-59 23.18 27.689999999999998 27.575 21.555 60-64 22.805 27.284999999999997 28.715000000000003 21.195 65-69 23.255 27.47 28.000000000000004 21.275 70-74 22.925 28.189999999999998 27.250000000000004 21.634999999999998 75-79 23.169999999999998 27.750000000000004 28.17 20.91 80-84 23.3 27.685 27.584999999999997 21.43 85-89 23.57 27.750000000000004 27.224999999999998 21.455 90-94 23.830000000000002 27.74 27.384999999999998 21.044999999999998 95-99 23.580000000000002 27.85 27.650000000000002 20.919999999999998 100-104 24.69 27.315 27.334999999999997 20.66 105-109 23.805 27.685 27.994999999999997 20.515 110-114 23.875 27.77 27.305 21.05 115-119 24.13 28.51 27.025 20.335 120-124 25.240000000000002 27.644999999999996 26.745 20.369999999999997 125-129 25.374999999999996 27.939999999999998 26.61 20.075000000000003 130-134 25.345000000000002 27.575 27.125 19.955000000000002 135-139 25.35 28.035 26.645000000000003 19.97 140-144 25.44 28.139999999999997 26.695 19.725 145-149 25.665 27.93 26.435 19.97 150-151 25.8125 28.875 26.1625 19.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.0 22 2.5 23 4.0 24 6.0 25 5.0 26 4.0 27 6.0 28 7.5 29 12.5 30 23.0 31 24.5 32 22.0 33 33.5 34 50.5 35 59.5 36 76.5 37 111.0 38 133.0 39 160.0 40 200.5 41 218.5 42 233.5 43 256.0 44 275.5 45 283.0 46 260.0 47 246.0 48 236.0 49 200.0 50 168.0 51 145.5 52 111.0 53 91.0 54 83.0 55 58.5 56 47.0 57 39.5 58 25.5 59 18.5 60 16.0 61 11.0 62 9.0 63 7.0 64 1.5 65 0.0 66 0.0 67 0.5 68 0.5 69 0.5 70 1.5 71 2.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.55 #Duplication Level Percentage of deduplicated Percentage of total 1 90.03350083752095 80.625 2 8.486878838637631 15.2 3 1.340033500837521 3.5999999999999996 4 0.08375209380234507 0.3 5 0.02791736460078169 0.125 6 0.02791736460078169 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCAAGGTTGGGCCGCAGGGAGGCTGACATCAAGAACAGATTTACTCTG 6 0.15 No Hit CATTGCTTCAATGGGAGTGTATGTCTTCAAGAAGGAGATACTTTTGAACC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.44999999999999996 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.725 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.1124999999999998 0.0 0.0 0.0 0.0 98-99 1.2999999999999998 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 2.0 0.0 0.0 0.0 0.0 106-107 2.2875 0.0 0.0 0.0 0.0 108-109 2.55 0.0 0.0 0.0 0.0 110-111 2.925 0.0 0.0 0.0 0.0 112-113 3.4625 0.0 0.0 0.0 0.0 114-115 3.7750000000000004 0.0 0.0 0.0 0.0 116-117 4.15 0.0 0.0 0.0 0.0 118-119 4.5875 0.0 0.0 0.0 0.0 120-121 5.0 0.0 0.0 0.0 0.0 122-123 5.775 0.0 0.0 0.0 0.0 124-125 6.2875 0.0 0.0 0.0 0.0 126-127 6.775 0.0 0.0 0.0 0.0 128-129 7.2875 0.0 0.0 0.0 0.0 130-131 7.8625 0.0 0.0 0.0 0.0 132-133 8.6125 0.0 0.0 0.0 0.0 134-135 9.212499999999999 0.0 0.0 0.0 0.0 136-137 9.962499999999999 0.0 0.0 0.0 0.0 138-139 10.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 40 0.0076550315 18.125 125-129 >>END_MODULE Read 732154 spots for SRR12919344.sra Written 732154 spots for SRR12919344.sra Read 732154 spots for SRR12919344.sra Written 732154 spots for SRR12919344.sra Read 732154 spots for SRR12919344.sra Written 732154 spots for SRR12919344.sra Read 732154 spots for SRR12919344.sra Written 732154 spots for SRR12919344.sra Read 732154 spots for SRR12919344.sra Written 732154 spots for SRR12919344.sra Read 732154 spots for SRR12919344.sra Written 732154 spots for SRR12919344.sra Read 732154 spots for SRR12919344.sra Written 732154 spots for SRR12919344.sra Read 732154 spots for SRR12919344.sra Written 732154 spots for SRR12919344.sra Read 732154 spots for SRR12919344.sra Written 732154 spots for SRR12919344.sra Read 732154 spots for SRR12919344.sra Written 732154 spots for SRR12919344.sra Read 732154 spots for SRR12919344.sra Written 732154 spots for SRR12919344.sra Read 732154 spots for SRR12919344.sra Written 732154 spots for SRR12919344.sra Read 732154 spots for SRR12919344.sra Written 732154 spots for SRR12919344.sra Read 732154 spots for SRR12919344.sra Written 732154 spots for SRR12919344.sra Read 732154 spots for SRR12919344.sra Written 732154 spots for SRR12919344.sra Read 732154 spots for SRR12919344.sra Written 732154 spots for SRR12919344.sra Read 732154 spots for SRR12919344.sra Written 732154 spots for SRR12919344.sra Read 732172 spots for SRR12919344.sra Written 732172 spots for SRR12919344.sra Read 732154 spots for SRR12919344.sra Written 732154 spots for SRR12919344.sra Read 732154 spots for SRR12919344.sra Written 732154 spots for SRR12919344.sra SRR ids: ['SRR12919344.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bbtcc1qj SRR12919344.sra spots: 14643098 blocks: [[1, 732154], [732155, 1464308], [1464309, 2196462], [2196463, 2928616], [2928617, 3660770], [3660771, 4392924], [4392925, 5125078], [5125079, 5857232], [5857233, 6589386], [6589387, 7321540], [7321541, 8053694], [8053695, 8785848], [8785849, 9518002], [9518003, 10250156], [10250157, 10982310], [10982311, 11714464], [11714465, 12446618], [12446619, 13178772], [13178773, 13910926], [13910927, 14643098]] SRR12919344 file size 4954664 SRR12919344 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919344 SRR12919344_1.fastq SRR12919344_2.fastq Input file: SRR12919344_1.fastq Paired file: SRR12919344_2.fastq trimmed: SRR12919344-trimmed-pair1.fastq, SRR12919344-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:52:50 2025 >> started Wed Feb 12 19:53:08 2025 >> done (18.224s) 14643098 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 490 ( 0.00%) empty read pairs filtered out after trimming by size control 14642589 (100.00%) read pairs available; of these: 2374462 (16.22%) trimmed read pairs available after processing 12268127 (83.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 4 0.00% 21 5 0.00% 22 4 0.00% 23 4 0.00% 24 2 0.00% 25 12 0.00% 26 4 0.00% 27 5 0.00% 28 6 0.00% 29 6 0.00% 30 6 0.00% 31 9 0.00% 32 13 0.00% 33 12 0.00% 34 5 0.00% 35 8 0.00% 36 9 0.00% 37 11 0.00% 38 10 0.00% 39 15 0.00% 40 16 0.00% 41 16 0.00% 42 12 0.00% 43 13 0.00% 44 25 0.00% 45 34 0.00% 46 24 0.00% 47 37 0.00% 48 57 0.00% 49 56 0.00% 50 66 0.00% 51 68 0.00% 52 86 0.00% 53 95 0.00% 54 97 0.00% 55 81 0.00% 56 100 0.00% 57 115 0.00% 58 134 0.00% 59 191 0.00% 60 235 0.00% 61 260 0.00% 62 278 0.00% 63 386 0.00% 64 418 0.00% 65 427 0.00% 66 454 0.00% 67 572 0.00% 68 675 0.00% 69 831 0.01% 70 979 0.01% 71 1115 0.01% 72 1356 0.01% 73 1561 0.01% 74 1816 0.01% 75 1978 0.01% 76 2207 0.02% 77 2393 0.02% 78 2744 0.02% 79 3046 0.02% 80 3580 0.02% 81 4105 0.03% 82 4698 0.03% 83 5506 0.04% 84 6140 0.04% 85 6666 0.05% 86 7056 0.05% 87 7687 0.05% 88 8271 0.06% 89 8749 0.06% 90 9695 0.07% 91 10672 0.07% 92 11866 0.08% 93 13174 0.09% 94 14245 0.10% 95 15398 0.11% 96 16164 0.11% 97 16597 0.11% 98 17044 0.12% 99 18046 0.12% 100 19331 0.13% 101 20480 0.14% 102 21538 0.15% 103 23294 0.16% 104 24566 0.17% 105 25519 0.17% 106 26451 0.18% 107 27833 0.19% 108 27398 0.19% 109 28655 0.20% 110 29046 0.20% 111 30261 0.21% 112 32230 0.22% 113 32766 0.22% 114 34747 0.24% 115 35929 0.25% 116 36915 0.25% 117 37409 0.26% 118 37933 0.26% 119 37857 0.26% 120 38776 0.26% 121 39589 0.27% 122 40388 0.28% 123 42066 0.29% 124 43681 0.30% 125 44360 0.30% 126 45595 0.31% 127 46361 0.32% 128 46396 0.32% 129 47252 0.32% 130 47283 0.32% 131 47140 0.32% 132 48539 0.33% 133 50092 0.34% 134 50294 0.34% 135 51535 0.35% 136 52721 0.36% 137 52331 0.36% 138 52547 0.36% 139 53443 0.36% 140 53598 0.37% 141 52728 0.36% 142 54284 0.37% 143 54646 0.37% 144 55601 0.38% 145 56430 0.39% 146 56651 0.39% 147 57528 0.39% 148 56992 0.39% 149 57492 0.39% 150 57398 0.39% 151 12268127 83.78% 14642589 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=19 prefix-density=0.66 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=28.19 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.4 sequence=CAGTTTCATTTGAGACTACAAATGAAGGAAGAAAAACTTGGGACAAATTAAATTACATGCTCAGTAACAGTAGAGATAACAATCATAAAATCCACCCCCCCTGCCGGAACACCACCGACGACACAAACAGAAAGAGATCTTATTTAACCGCTAAACTCTTCCTCTTTGTGTGTCTCGATGACAACATCAGACGTAGGATAAGCAACACAGGTGAGAACCCAGCCTTCCTCTATCTGGTCATCATCAAGGAAGCTAGCATCAGACTGATCCACAGTCCCCTTCACAATCTTGCCAAGACATGAAGAGCATGAGCCAGCCCTGCATGAGTAGGGGAGGTCAATCTCTTCTGCCTCCTCAGCATGGTCAAGGATGTAGATGTCATCGGGGCATGCAAACTCCTTCTCACCATCAGGAGTGATGAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCCC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=23 prefix-density=0.51 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=38.95 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.4 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT SRR12919344 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:53:50 Started mapping on | Feb 12 19:53:51 Finished on | Feb 12 19:55:32 Mapping speed, Million of reads per hour | 521.91 Number of input reads | 14642589 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13743993 Uniquely mapped reads % | 93.86% Average mapped length | 292.24 Number of splices: Total | 13633242 Number of splices: Annotated (sjdb) | 13354833 Number of splices: GT/AG | 13338940 Number of splices: GC/AG | 245895 Number of splices: AT/AC | 9399 Number of splices: Non-canonical | 39008 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304029 % of reads mapped to multiple loci | 2.08% Number of reads mapped to too many loci | 32815 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.74% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 594567 594567 594567 N_multimapping 304029 304029 304029 N_noFeature 479435 13570650 550738 N_ambiguous 190708 747 88167 UnstrandedReadsAssigned:13073850 PositiveStrandReadsAssigned:172596 NegativeStrandReadsAssigned:13105088 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919344 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919344-trimmed-pair1.fastq SRR12919344-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,642,589 reads, 13,141,284 reads pseudoaligned [quant] estimated average fragment length: 241.611 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52401 SRR12919344.ke.tsv 34699 SRR12919344.se.tsv 87100 total ==> SRR12919344.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.39 378 17.3218 Potri.005G024800.1.v4.1 1035 794.389 339 34.7576 Potri.004G059700.1.v4.1 961 720.555 69 7.79947 Potri.007G009000.2.v4.1 1416 1175.39 0 0 Potri.003G141000.2.v4.1 2943 2702.39 434.359 13.0914 Potri.016G087400.1.v4.1 270 94.2385 620 535.854 Potri.015G069301.1.v4.1 564 336.535 0 0 Potri.010G195200.1.v4.1 1773 1532.39 12 0.637816 Potri.012G127500.1.v4.1 977 736.487 73 8.07311 ==> SRR12919344.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 173 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 189 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 28 Potri.001G416900.v4.1 7 Potri.001G452600.v4.1 4 SRR12919344 completed mapping pipeline successfully