Starting /dee2/code/volunteer_pipeline.sh SRR12919345 current disk space = 3051163824128 free memory = 1412360108 SRR12919345 SRAfilesize 856bd554859f2787d9b2d2ee256e34a7 SRR12919345.sra SRR12919345.sra file validated SRR12919345 is paired end SRR12919345 is conventional basespace SRR12919345 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919345_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.582 37.0 37.0 37.0 37.0 37.0 2 36.39125 37.0 37.0 37.0 37.0 37.0 3 36.5865 37.0 37.0 37.0 37.0 37.0 4 36.661 37.0 37.0 37.0 37.0 37.0 5 36.663 37.0 37.0 37.0 37.0 37.0 6 36.605 37.0 37.0 37.0 37.0 37.0 7 36.5645 37.0 37.0 37.0 37.0 37.0 8 36.615 37.0 37.0 37.0 37.0 37.0 9 36.613 37.0 37.0 37.0 37.0 37.0 10-14 36.62949999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.6131 37.0 37.0 37.0 37.0 37.0 20-24 36.601 37.0 37.0 37.0 37.0 37.0 25-29 36.5245 37.0 37.0 37.0 37.0 37.0 30-34 36.5227 37.0 37.0 37.0 37.0 37.0 35-39 36.506299999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.513 37.0 37.0 37.0 37.0 37.0 45-49 36.4387 37.0 37.0 37.0 37.0 37.0 50-54 36.4709 37.0 37.0 37.0 37.0 37.0 55-59 36.4209 37.0 37.0 37.0 37.0 37.0 60-64 36.3712 37.0 37.0 37.0 37.0 37.0 65-69 36.367 37.0 37.0 37.0 37.0 37.0 70-74 36.3956 37.0 37.0 37.0 37.0 37.0 75-79 36.3624 37.0 37.0 37.0 37.0 37.0 80-84 36.301300000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.236799999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.239 37.0 37.0 37.0 37.0 37.0 95-99 36.1704 37.0 37.0 37.0 37.0 37.0 100-104 36.1684 37.0 37.0 37.0 37.0 37.0 105-109 36.1143 37.0 37.0 37.0 37.0 37.0 110-114 36.1262 37.0 37.0 37.0 37.0 37.0 115-119 36.0839 37.0 37.0 37.0 37.0 37.0 120-124 35.9929 37.0 37.0 37.0 37.0 37.0 125-129 36.05069999999999 37.0 37.0 37.0 37.0 37.0 130-134 36.0419 37.0 37.0 37.0 37.0 37.0 135-139 35.9268 37.0 37.0 37.0 37.0 37.0 140-144 35.8292 37.0 37.0 37.0 37.0 37.0 145-149 35.8304 37.0 37.0 37.0 37.0 37.0 150-151 35.7285 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 0.0 24 2.0 25 4.0 26 6.0 27 9.0 28 7.0 29 18.0 30 24.0 31 35.0 32 36.0 33 54.0 34 117.0 35 316.0 36 2920.0 37 450.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.05 13.8 4.95 34.2 2 19.067902781257832 13.254823352543221 36.281633675770486 31.395640190428466 3 16.275000000000002 19.400000000000002 30.049999999999997 34.275 4 20.8 26.525 25.25 27.425 5 22.425 33.074999999999996 24.725 19.775000000000002 6 20.525 33.7 25.174999999999997 20.599999999999998 7 13.8 26.55 41.475 18.175 8 16.950000000000003 25.85 31.374999999999996 25.825 9 16.85 23.425 34.625 25.1 10-14 19.45 29.43 27.525 23.595 15-19 19.555 28.815 27.750000000000004 23.880000000000003 20-24 20.25 27.775 28.01 23.965 25-29 19.45 29.17 27.68 23.7 30-34 19.695 29.5 27.084999999999997 23.72 35-39 19.865 29.049999999999997 27.145000000000003 23.94 40-44 20.19 28.544999999999998 27.42 23.845 45-49 20.105 28.860000000000003 27.97 23.064999999999998 50-54 20.560000000000002 28.105000000000004 27.435 23.9 55-59 19.869999999999997 29.23 27.500000000000004 23.400000000000002 60-64 20.474999999999998 28.255000000000003 27.775 23.494999999999997 65-69 20.455000000000002 28.689999999999998 26.945000000000004 23.91 70-74 20.119999999999997 27.855 28.685 23.34 75-79 20.53 28.02 27.775 23.674999999999997 80-84 19.965 28.439999999999998 27.96 23.635 85-89 20.805 27.605 27.6 23.990000000000002 90-94 20.655 28.355000000000004 27.77 23.22 95-99 20.57 27.465 28.16 23.805 100-104 20.119999999999997 28.525 27.505000000000003 23.849999999999998 105-109 20.89 27.785 28.01 23.315 110-114 20.75 28.16 27.145000000000003 23.945 115-119 21.05 28.084999999999997 28.044999999999998 22.82 120-124 20.845 28.595 26.935 23.625 125-129 20.91 27.900000000000002 27.22 23.97 130-134 20.76 28.449999999999996 27.250000000000004 23.54 135-139 21.395 27.68 27.310000000000002 23.615 140-144 20.555 28.194999999999997 27.095000000000002 24.154999999999998 145-149 21.015 28.415000000000003 26.715 23.855 150-151 20.9 28.249999999999996 27.187499999999996 23.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 2.0 21 2.5 22 1.5 23 1.5 24 3.0 25 4.0 26 3.5 27 4.0 28 6.0 29 14.5 30 20.5 31 18.5 32 31.0 33 49.5 34 55.0 35 61.0 36 89.0 37 120.0 38 144.5 39 163.0 40 184.5 41 203.5 42 222.0 43 240.5 44 251.5 45 259.5 46 257.0 47 250.0 48 247.5 49 227.5 50 176.5 51 144.5 52 130.0 53 106.0 54 86.0 55 66.5 56 42.5 57 32.0 58 25.5 59 18.0 60 13.5 61 7.0 62 1.5 63 1.5 64 1.5 65 2.5 66 2.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.875 #Duplication Level Percentage of deduplicated Percentage of total 1 90.81155433287483 82.525 2 8.390646492434662 15.25 3 0.7427785419532325 2.025 4 0.055020632737276476 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.36250000000000004 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.1375 0.0 0.0 0.0 0.0 116-117 2.5375 0.0 0.0 0.0 0.0 118-119 2.7625 0.0 0.0 0.0 0.0 120-121 3.0875 0.0 0.0 0.0 0.0 122-123 3.375 0.0 0.0 0.0 0.0 124-125 3.8375 0.0 0.0 0.0 0.0 126-127 4.2625 0.0 0.0 0.0 0.0 128-129 4.6 0.0 0.0 0.0 0.0 130-131 4.95 0.0 0.0 0.0 0.0 132-133 5.4125 0.0 0.0 0.0 0.0 134-135 5.75 0.0 0.0 0.0 0.0 136-137 6.275 0.0 0.0 0.0 0.0 138-139 6.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919345 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919345_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.144 37.0 37.0 37.0 37.0 37.0 2 36.2775 37.0 37.0 37.0 37.0 37.0 3 36.226 37.0 37.0 37.0 37.0 37.0 4 36.2815 37.0 37.0 37.0 37.0 37.0 5 36.3195 37.0 37.0 37.0 37.0 37.0 6 36.323 37.0 37.0 37.0 37.0 37.0 7 36.2255 37.0 37.0 37.0 37.0 37.0 8 36.257 37.0 37.0 37.0 37.0 37.0 9 36.373 37.0 37.0 37.0 37.0 37.0 10-14 36.2688 37.0 37.0 37.0 37.0 37.0 15-19 36.2087 37.0 37.0 37.0 37.0 37.0 20-24 36.1964 37.0 37.0 37.0 37.0 37.0 25-29 36.201800000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.1774 37.0 37.0 37.0 37.0 37.0 35-39 36.09010000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.073 37.0 37.0 37.0 37.0 37.0 45-49 36.0715 37.0 37.0 37.0 37.0 37.0 50-54 36.0034 37.0 37.0 37.0 37.0 37.0 55-59 35.9781 37.0 37.0 37.0 37.0 37.0 60-64 35.9704 37.0 37.0 37.0 37.0 37.0 65-69 35.9467 37.0 37.0 37.0 37.0 37.0 70-74 35.881299999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.829 37.0 37.0 37.0 37.0 37.0 80-84 35.7975 37.0 37.0 37.0 37.0 37.0 85-89 35.8121 37.0 37.0 37.0 37.0 37.0 90-94 35.731700000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.7414 37.0 37.0 37.0 37.0 37.0 100-104 35.750299999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.6603 37.0 37.0 37.0 37.0 37.0 110-114 35.658500000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.6514 37.0 37.0 37.0 37.0 37.0 120-124 35.524899999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.5195 37.0 37.0 37.0 37.0 37.0 130-134 35.4171 37.0 37.0 37.0 37.0 37.0 135-139 35.3277 37.0 37.0 37.0 34.6 37.0 140-144 35.2641 37.0 37.0 37.0 29.8 37.0 145-149 35.2455 37.0 37.0 37.0 32.2 37.0 150-151 34.953 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 4.0 14 3.0 15 2.0 16 0.0 17 0.0 18 1.0 19 2.0 20 5.0 21 2.0 22 1.0 23 3.0 24 4.0 25 13.0 26 10.0 27 18.0 28 17.0 29 21.0 30 34.0 31 36.0 32 64.0 33 92.0 34 213.0 35 557.0 36 2640.0 37 255.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.25 23.325000000000003 7.425 23.0 2 25.6 26.650000000000002 31.35 16.400000000000002 3 20.3 27.474999999999998 33.925 18.3 4 23.0 33.4 24.125 19.475 5 23.150000000000002 37.5 22.3 17.05 6 21.75 37.55 22.650000000000002 18.05 7 20.599999999999998 21.95 38.475 18.975 8 21.25 25.074999999999996 27.975 25.7 9 21.15 24.85 30.2 23.799999999999997 10-14 23.82 29.25 25.53 21.4 15-19 23.044999999999998 28.084999999999997 27.54 21.33 20-24 23.06 28.455000000000002 27.18 21.305 25-29 22.695 28.285 28.015 21.005 30-34 23.395 27.63 28.060000000000002 20.915 35-39 23.1 27.994999999999997 27.79 21.115000000000002 40-44 23.215 28.134999999999998 27.85 20.8 45-49 23.34 28.205000000000002 27.625 20.830000000000002 50-54 22.875 28.235 28.035 20.855 55-59 23.169999999999998 28.475 27.534999999999997 20.82 60-64 22.695 28.335 27.66 21.310000000000002 65-69 23.505000000000003 27.134999999999998 28.044999999999998 21.315 70-74 23.205000000000002 27.96 28.235 20.599999999999998 75-79 23.09 27.994999999999997 28.01 20.905 80-84 22.73 27.66 27.91 21.7 85-89 22.965 28.04 27.82 21.175 90-94 24.22 28.205000000000002 27.089999999999996 20.485 95-99 23.580000000000002 27.18 28.125 21.115000000000002 100-104 23.25 27.79 28.310000000000002 20.65 105-109 24.23 27.384999999999998 27.62 20.765 110-114 23.595 28.02 28.01 20.375 115-119 23.995 28.26 27.24 20.505000000000003 120-124 24.42 28.384999999999998 27.08 20.115 125-129 23.785 27.485 28.38 20.349999999999998 130-134 24.755 27.83 27.33 20.085 135-139 25.485000000000003 27.77 26.75 19.994999999999997 140-144 25.215 28.07 26.86 19.855 145-149 26.045 28.01 26.340000000000003 19.605 150-151 25.7875 28.1625 26.2875 19.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 2.5 23 3.5 24 5.0 25 4.5 26 6.0 27 7.0 28 6.0 29 9.5 30 16.0 31 18.0 32 20.5 33 36.0 34 50.5 35 69.0 36 87.5 37 110.0 38 130.0 39 161.0 40 207.5 41 224.0 42 239.0 43 256.0 44 261.0 45 258.0 46 249.5 47 243.0 48 237.0 49 219.0 50 181.5 51 148.0 52 118.5 53 96.5 54 81.0 55 60.0 56 44.0 57 32.0 58 21.0 59 17.5 60 16.5 61 13.0 62 9.5 63 6.0 64 3.5 65 1.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.025 #Duplication Level Percentage of deduplicated Percentage of total 1 91.15627574842077 82.975 2 8.019774787146389 14.6 3 0.6591595715462785 1.7999999999999998 4 0.137324910738808 0.5 5 0.027464982147761604 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.7625000000000002 0.0 0.0 0.0 0.0 112-113 1.925 0.0 0.0 0.0 0.0 114-115 2.1875 0.0 0.0 0.0 0.0 116-117 2.5875 0.0 0.0 0.0 0.0 118-119 2.8125 0.0 0.0 0.0 0.0 120-121 3.1375 0.0 0.0 0.0 0.0 122-123 3.425 0.0 0.0 0.0 0.0 124-125 3.9125 0.0 0.0 0.0 0.0 126-127 4.3625 0.0 0.0 0.0 0.0 128-129 4.7 0.0 0.0 0.0 0.0 130-131 5.05 0.0 0.0 0.0 0.0 132-133 5.5625 0.0 0.0 0.0 0.0 134-135 5.9 0.0 0.0 0.0 0.0 136-137 6.425 0.0 0.0 0.0 0.0 138-139 6.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTAAGA 10 0.006830828 145.0 1 TTCTCAC 10 0.006830828 145.0 2 GGGGGGG 85 2.822162E-8 25.588236 145 >>END_MODULE Read 880715 spots for SRR12919345.sra Written 880715 spots for SRR12919345.sra Read 880715 spots for SRR12919345.sra Written 880715 spots for SRR12919345.sra Read 880715 spots for SRR12919345.sra Written 880715 spots for SRR12919345.sra Read 880715 spots for SRR12919345.sra Written 880715 spots for SRR12919345.sra Read 880715 spots for SRR12919345.sra Written 880715 spots for SRR12919345.sra Read 880715 spots for SRR12919345.sra Written 880715 spots for SRR12919345.sra Read 880715 spots for SRR12919345.sra Written 880715 spots for SRR12919345.sra Read 880715 spots for SRR12919345.sra Written 880715 spots for SRR12919345.sra Read 880715 spots for SRR12919345.sra Written 880715 spots for SRR12919345.sra Read 880715 spots for SRR12919345.sra Written 880715 spots for SRR12919345.sra Read 880715 spots for SRR12919345.sra Written 880715 spots for SRR12919345.sra Read 880715 spots for SRR12919345.sra Written 880715 spots for SRR12919345.sra Read 880715 spots for SRR12919345.sra Written 880715 spots for SRR12919345.sra Read 880715 spots for SRR12919345.sra Written 880715 spots for SRR12919345.sra Read 880715 spots for SRR12919345.sra Written 880715 spots for SRR12919345.sra Read 880715 spots for SRR12919345.sra Written 880715 spots for SRR12919345.sra Read 880715 spots for SRR12919345.sra Written 880715 spots for SRR12919345.sra Read 880717 spots for SRR12919345.sra Written 880717 spots for SRR12919345.sra Read 880715 spots for SRR12919345.sra Written 880715 spots for SRR12919345.sra Read 880715 spots for SRR12919345.sra Written 880715 spots for SRR12919345.sra SRR ids: ['SRR12919345.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w23bz_15 SRR12919345.sra spots: 17614302 blocks: [[1, 880715], [880716, 1761430], [1761431, 2642145], [2642146, 3522860], [3522861, 4403575], [4403576, 5284290], [5284291, 6165005], [6165006, 7045720], [7045721, 7926435], [7926436, 8807150], [8807151, 9687865], [9687866, 10568580], [10568581, 11449295], [11449296, 12330010], [12330011, 13210725], [13210726, 14091440], [14091441, 14972155], [14972156, 15852870], [15852871, 16733585], [16733586, 17614302]] SRR12919345 file size 5964410 SRR12919345 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919345 SRR12919345_1.fastq SRR12919345_2.fastq Input file: SRR12919345_1.fastq Paired file: SRR12919345_2.fastq trimmed: SRR12919345-trimmed-pair1.fastq, SRR12919345-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:16:39 2025 >> started Wed Feb 12 19:17:09 2025 >> done (29.620s) 17614302 read pairs processed; of these: 29 ( 0.00%) short read pairs filtered out after trimming by size control 464 ( 0.00%) empty read pairs filtered out after trimming by size control 17613809 (100.00%) read pairs available; of these: 1988108 (11.29%) trimmed read pairs available after processing 15625701 (88.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 6 0.00% 21 6 0.00% 22 7 0.00% 23 11 0.00% 24 8 0.00% 25 3 0.00% 26 3 0.00% 27 5 0.00% 28 6 0.00% 29 7 0.00% 30 7 0.00% 31 11 0.00% 32 13 0.00% 33 8 0.00% 34 11 0.00% 35 13 0.00% 36 14 0.00% 37 19 0.00% 38 12 0.00% 39 26 0.00% 40 19 0.00% 41 15 0.00% 42 20 0.00% 43 21 0.00% 44 26 0.00% 45 26 0.00% 46 30 0.00% 47 43 0.00% 48 39 0.00% 49 43 0.00% 50 44 0.00% 51 52 0.00% 52 42 0.00% 53 78 0.00% 54 107 0.00% 55 75 0.00% 56 89 0.00% 57 81 0.00% 58 109 0.00% 59 143 0.00% 60 179 0.00% 61 185 0.00% 62 265 0.00% 63 271 0.00% 64 249 0.00% 65 298 0.00% 66 348 0.00% 67 443 0.00% 68 450 0.00% 69 533 0.00% 70 654 0.00% 71 786 0.00% 72 978 0.01% 73 1104 0.01% 74 1326 0.01% 75 1293 0.01% 76 1517 0.01% 77 1590 0.01% 78 1730 0.01% 79 2109 0.01% 80 2379 0.01% 81 2803 0.02% 82 3366 0.02% 83 3899 0.02% 84 4225 0.02% 85 4704 0.03% 86 4861 0.03% 87 5018 0.03% 88 5399 0.03% 89 5990 0.03% 90 6559 0.04% 91 7540 0.04% 92 8693 0.05% 93 9575 0.05% 94 10633 0.06% 95 11368 0.06% 96 11640 0.07% 97 11760 0.07% 98 12038 0.07% 99 12801 0.07% 100 13548 0.08% 101 14831 0.08% 102 16634 0.09% 103 18094 0.10% 104 19178 0.11% 105 19680 0.11% 106 20417 0.12% 107 20084 0.11% 108 20573 0.12% 109 21075 0.12% 110 21421 0.12% 111 23110 0.13% 112 24891 0.14% 113 26605 0.15% 114 28036 0.16% 115 29301 0.17% 116 29630 0.17% 117 29609 0.17% 118 30032 0.17% 119 29874 0.17% 120 30092 0.17% 121 31471 0.18% 122 32821 0.19% 123 34952 0.20% 124 37246 0.21% 125 37750 0.21% 126 39027 0.22% 127 39126 0.22% 128 38444 0.22% 129 39069 0.22% 130 38747 0.22% 131 38927 0.22% 132 41009 0.23% 133 43257 0.25% 134 44583 0.25% 135 46545 0.26% 136 47177 0.27% 137 46964 0.27% 138 47071 0.27% 139 47023 0.27% 140 46289 0.26% 141 46831 0.27% 142 48159 0.27% 143 49370 0.28% 144 51482 0.29% 145 53276 0.30% 146 54725 0.31% 147 54335 0.31% 148 54740 0.31% 149 54444 0.31% 150 53666 0.30% 151 15625701 88.71% 17613809 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=19 prefix-density=0.63 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=20 fanout-score=25.48 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=8.2 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=22 prefix-density=0.76 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=22.19 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=5.3 sequence=CAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12919345 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:18:04 Started mapping on | Feb 12 19:18:04 Finished on | Feb 12 19:21:12 Mapping speed, Million of reads per hour | 337.29 Number of input reads | 17613809 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16284855 Uniquely mapped reads % | 92.46% Average mapped length | 294.99 Number of splices: Total | 15999056 Number of splices: Annotated (sjdb) | 15660142 Number of splices: GT/AG | 15647674 Number of splices: GC/AG | 288957 Number of splices: AT/AC | 11707 Number of splices: Non-canonical | 50718 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 386700 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 28447 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.08% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 942254 942254 942254 N_multimapping 386700 386700 386700 N_noFeature 557797 16061843 646857 N_ambiguous 249765 1089 115154 UnstrandedReadsAssigned:15477293 PositiveStrandReadsAssigned:221923 NegativeStrandReadsAssigned:15522844 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919345 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919345-trimmed-pair1.fastq SRR12919345-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,613,809 reads, 15,627,388 reads pseudoaligned [quant] estimated average fragment length: 262.728 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR12919345.ke.tsv 34699 SRR12919345.se.tsv 87100 total ==> SRR12919345.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1756.27 519 19.0752 Potri.005G024800.1.v4.1 1035 773.272 300 25.0427 Potri.004G059700.1.v4.1 961 699.504 37 3.41432 Potri.007G009000.2.v4.1 1416 1154.27 0 0 Potri.003G141000.2.v4.1 2943 2681.27 599 14.4205 Potri.016G087400.1.v4.1 270 86.8426 818 608.014 Potri.015G069301.1.v4.1 564 320.283 0 0 Potri.010G195200.1.v4.1 1773 1511.27 35 1.49492 Potri.012G127500.1.v4.1 977 715.386 404 36.453 ==> SRR12919345.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 192 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 203 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 10 SRR12919345 completed mapping pipeline successfully