Starting /dee2/code/volunteer_pipeline.sh SRR12919346 current disk space = 3051017957376 free memory = 992492056 SRR12919346 SRAfilesize 79d751e2fc6583f40f2e1428a06ae217 SRR12919346.sra SRR12919346.sra file validated SRR12919346 is paired end SRR12919346 is conventional basespace SRR12919346 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919346_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5425 37.0 37.0 37.0 37.0 37.0 2 36.12025 37.0 37.0 37.0 37.0 37.0 3 36.53 37.0 37.0 37.0 37.0 37.0 4 36.6175 37.0 37.0 37.0 37.0 37.0 5 36.6665 37.0 37.0 37.0 37.0 37.0 6 36.6275 37.0 37.0 37.0 37.0 37.0 7 36.575 37.0 37.0 37.0 37.0 37.0 8 36.649 37.0 37.0 37.0 37.0 37.0 9 36.686 37.0 37.0 37.0 37.0 37.0 10-14 36.659299999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.63440000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5686 37.0 37.0 37.0 37.0 37.0 25-29 36.5162 37.0 37.0 37.0 37.0 37.0 30-34 36.5284 37.0 37.0 37.0 37.0 37.0 35-39 36.4761 37.0 37.0 37.0 37.0 37.0 40-44 36.515100000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.463499999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.4464 37.0 37.0 37.0 37.0 37.0 55-59 36.4716 37.0 37.0 37.0 37.0 37.0 60-64 36.385999999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.342499999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.3613 37.0 37.0 37.0 37.0 37.0 75-79 36.28339999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.288599999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.26649999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.1943 37.0 37.0 37.0 37.0 37.0 95-99 36.2733 37.0 37.0 37.0 37.0 37.0 100-104 36.21210000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.133900000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.09780000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.0574 37.0 37.0 37.0 37.0 37.0 120-124 36.0517 37.0 37.0 37.0 37.0 37.0 125-129 35.9628 37.0 37.0 37.0 37.0 37.0 130-134 35.987 37.0 37.0 37.0 37.0 37.0 135-139 35.8815 37.0 37.0 37.0 37.0 37.0 140-144 35.7627 37.0 37.0 37.0 37.0 37.0 145-149 35.7876 37.0 37.0 37.0 37.0 37.0 150-151 35.65875 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 3.0 22 0.0 23 1.0 24 1.0 25 3.0 26 2.0 27 4.0 28 10.0 29 11.0 30 20.0 31 32.0 32 40.0 33 71.0 34 116.0 35 325.0 36 3002.0 37 357.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.225 12.675 6.125 39.975 2 18.046816008054368 12.937326956959478 38.66096149005789 30.35489554492827 3 17.4 18.325 26.8 37.475 4 22.25 24.55 24.4 28.799999999999997 5 21.7 31.075000000000003 24.45 22.775000000000002 6 20.424999999999997 34.0 23.200000000000003 22.375 7 15.325 27.525 40.675 16.475 8 17.275 26.6 31.525 24.6 9 17.075000000000003 24.25 35.55 23.125 10-14 19.865 30.12 27.425 22.59 15-19 19.08 28.849999999999998 27.725 24.345 20-24 19.84 29.104999999999997 27.665 23.39 25-29 20.305 28.705000000000002 27.88 23.11 30-34 19.615 28.549999999999997 28.03 23.805 35-39 20.05 28.26 27.805000000000003 23.885 40-44 20.39 28.78 26.985 23.845 45-49 19.855 28.9 26.810000000000002 24.435000000000002 50-54 19.955000000000002 28.325 27.51 24.21 55-59 20.175 29.25 26.705000000000002 23.87 60-64 19.89 28.43 27.339999999999996 24.34 65-69 20.115 27.875 28.075 23.935000000000002 70-74 20.13 28.65 27.165 24.055 75-79 20.599999999999998 28.315 26.955000000000002 24.13 80-84 20.695 28.48 27.05 23.775 85-89 20.335 29.005 26.995 23.665 90-94 20.849999999999998 27.845 27.265 24.04 95-99 20.36 27.87 27.51 24.26 100-104 20.7 28.754999999999995 27.084999999999997 23.46 105-109 20.595 28.705000000000002 26.76 23.94 110-114 21.044999999999998 28.475 27.27 23.21 115-119 21.16 28.470000000000002 26.479999999999997 23.89 120-124 21.044999999999998 27.389999999999997 27.884999999999998 23.68 125-129 20.580000000000002 28.02 27.365000000000002 24.035 130-134 21.185000000000002 28.585 26.665 23.565 135-139 21.345 27.794999999999998 26.685 24.175 140-144 20.76 28.08 26.495 24.665 145-149 20.66 28.305000000000003 26.884999999999998 24.15 150-151 21.3625 27.3375 26.724999999999998 24.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 3.0 25 4.5 26 3.0 27 5.5 28 9.5 29 13.5 30 17.5 31 25.0 32 37.5 33 42.0 34 59.0 35 82.0 36 90.5 37 100.5 38 117.5 39 152.5 40 176.5 41 186.5 42 221.0 43 239.0 44 247.0 45 261.0 46 266.5 47 261.0 48 226.0 49 206.0 50 196.0 51 163.5 52 137.0 53 118.0 54 87.5 55 69.5 56 59.5 57 40.5 58 28.0 59 18.5 60 10.0 61 4.0 62 3.0 63 2.5 64 2.0 65 1.5 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.675 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.375 #Duplication Level Percentage of deduplicated Percentage of total 1 91.14799446749655 82.375 2 7.496542185338866 13.55 3 1.0511756569847857 2.85 4 0.19363762102351315 0.7000000000000001 5 0.08298755186721991 0.375 6 0.027662517289073305 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAAGGTGTATATGAATCCACAATCAATGCATATGTGAGTTGCTCTAG 6 0.15 No Hit GGCCAAAACTGCCACTACATATCATAAAGAACATCACATGCCCCAACTAC 5 0.125 No Hit CTTTATATTTGATCAATTCCTTCAATCTGTCAACGATGAAAAGCTCATCA 5 0.125 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.5125000000000002 0.0 0.0 0.0 0.0 110-111 1.7625000000000002 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.3 0.0 0.0 0.0 0.0 116-117 2.575 0.0 0.0 0.0 0.0 118-119 2.9375 0.0 0.0 0.0 0.0 120-121 3.2 0.0 0.0 0.0 0.0 122-123 3.4375 0.0 0.0 0.0 0.0 124-125 3.85 0.0 0.0 0.0 0.0 126-127 4.225 0.0 0.0 0.0 0.0 128-129 4.5125 0.0 0.0 0.0 0.0 130-131 4.925 0.0 0.0 0.0 0.0 132-133 5.237500000000001 0.0 0.0 0.0 0.0 134-135 5.4375 0.0 0.0 0.0 0.0 136-137 5.725 0.0 0.0 0.0 0.0 138-139 6.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCAAAC 10 0.006830828 145.0 2 GCAAACA 10 0.006830828 145.0 3 TATCACC 10 0.006830828 145.0 9 >>END_MODULE SRR12919346 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919346_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.1235 37.0 37.0 37.0 25.0 37.0 2 34.538 37.0 37.0 37.0 25.0 37.0 3 34.919 37.0 37.0 37.0 25.0 37.0 4 34.874 37.0 37.0 37.0 25.0 37.0 5 35.047 37.0 37.0 37.0 25.0 37.0 6 35.173 37.0 37.0 37.0 25.0 37.0 7 35.0955 37.0 37.0 37.0 25.0 37.0 8 35.146 37.0 37.0 37.0 25.0 37.0 9 35.426 37.0 37.0 37.0 37.0 37.0 10-14 35.3395 37.0 37.0 37.0 34.6 37.0 15-19 35.408 37.0 37.0 37.0 37.0 37.0 20-24 35.383799999999994 37.0 37.0 37.0 37.0 37.0 25-29 35.2575 37.0 37.0 37.0 34.6 37.0 30-34 35.187599999999996 37.0 37.0 37.0 29.8 37.0 35-39 35.2236 37.0 37.0 37.0 32.2 37.0 40-44 35.138999999999996 37.0 37.0 37.0 27.4 37.0 45-49 35.1952 37.0 37.0 37.0 32.2 37.0 50-54 35.1124 37.0 37.0 37.0 25.0 37.0 55-59 35.0572 37.0 37.0 37.0 25.0 37.0 60-64 35.0253 37.0 37.0 37.0 25.0 37.0 65-69 35.0514 37.0 37.0 37.0 25.0 37.0 70-74 34.992200000000004 37.0 37.0 37.0 25.0 37.0 75-79 34.92 37.0 37.0 37.0 25.0 37.0 80-84 34.93320000000001 37.0 37.0 37.0 25.0 37.0 85-89 34.9046 37.0 37.0 37.0 25.0 37.0 90-94 34.791000000000004 37.0 37.0 37.0 25.0 37.0 95-99 34.7935 37.0 37.0 37.0 25.0 37.0 100-104 34.7042 37.0 37.0 37.0 25.0 37.0 105-109 34.713 37.0 37.0 37.0 25.0 37.0 110-114 34.720000000000006 37.0 37.0 37.0 25.0 37.0 115-119 34.6383 37.0 37.0 37.0 25.0 37.0 120-124 34.5585 37.0 37.0 37.0 25.0 37.0 125-129 34.5222 37.0 37.0 37.0 25.0 37.0 130-134 34.4615 37.0 37.0 37.0 25.0 37.0 135-139 34.2495 37.0 37.0 37.0 25.0 37.0 140-144 34.1806 37.0 37.0 37.0 25.0 37.0 145-149 34.00940000000001 37.0 37.0 37.0 25.0 37.0 150-151 33.85975 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 2.0 15 2.0 16 4.0 17 1.0 18 6.0 19 11.0 20 10.0 21 17.0 22 10.0 23 12.0 24 17.0 25 21.0 26 28.0 27 32.0 28 30.0 29 59.0 30 83.0 31 97.0 32 123.0 33 211.0 34 388.0 35 821.0 36 1955.0 37 57.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.625 26.924999999999997 7.725 26.724999999999998 2 27.875 26.825 29.799999999999997 15.5 3 21.65 27.175 31.7 19.475 4 22.8 34.275 23.200000000000003 19.725 5 25.7 36.6 20.724999999999998 16.975 6 21.475 39.5 20.525 18.5 7 21.025 23.1 38.35 17.525 8 21.325 25.900000000000002 28.075 24.7 9 22.35 24.625 28.825 24.2 10-14 23.745 28.865000000000002 26.0 21.39 15-19 23.9 27.615000000000002 27.555000000000003 20.93 20-24 23.65 27.589999999999996 27.500000000000004 21.26 25-29 23.69 28.134999999999998 27.18 20.995 30-34 23.66 27.855 27.384999999999998 21.099999999999998 35-39 23.150000000000002 27.900000000000002 27.750000000000004 21.2 40-44 24.015 27.185 27.375 21.425 45-49 23.44 27.805000000000003 27.37 21.385 50-54 23.794999999999998 27.565 27.29 21.349999999999998 55-59 23.885 27.57 27.639999999999997 20.905 60-64 23.655 27.500000000000004 27.345000000000002 21.5 65-69 23.23 27.365000000000002 28.02 21.385 70-74 23.68 27.339999999999996 27.57 21.41 75-79 23.23 27.115000000000002 27.639999999999997 22.015 80-84 23.45 28.4 26.745 21.404999999999998 85-89 23.605 27.74 27.169999999999998 21.485000000000003 90-94 23.76 27.295 27.215 21.73 95-99 23.72 27.355 27.48 21.445 100-104 23.72 27.555000000000003 27.33 21.395 105-109 23.925 26.86 27.97 21.245 110-114 24.435000000000002 27.534999999999997 27.16 20.87 115-119 25.074999999999996 27.439999999999998 27.1 20.385 120-124 24.945 27.650000000000002 26.939999999999998 20.465 125-129 25.06 27.785 26.595000000000002 20.560000000000002 130-134 25.31 27.560000000000002 26.490000000000002 20.64 135-139 25.415 26.915 27.35 20.32 140-144 25.785000000000004 26.784999999999997 27.310000000000002 20.119999999999997 145-149 26.61 27.305 26.1 19.985 150-151 26.674999999999997 27.5125 25.8625 19.950000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 1.5 23 1.5 24 1.0 25 1.0 26 1.5 27 1.0 28 6.0 29 11.0 30 13.5 31 17.0 32 19.5 33 30.0 34 50.5 35 57.5 36 69.5 37 98.0 38 122.5 39 154.0 40 193.0 41 214.5 42 231.0 43 252.5 44 251.5 45 261.0 46 250.5 47 241.0 48 242.5 49 211.5 50 174.5 51 157.5 52 145.5 53 116.0 54 94.5 55 69.5 56 48.0 57 41.0 58 30.5 59 26.5 60 20.5 61 9.0 62 11.0 63 10.0 64 4.5 65 2.5 66 2.0 67 2.0 68 1.5 69 1.5 70 2.0 71 1.5 72 1.0 73 0.5 74 1.0 75 1.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 1.0 90 0.5 91 0.0 92 0.5 93 1.5 94 1.0 95 0.5 96 0.5 97 0.5 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.425 #Duplication Level Percentage of deduplicated Percentage of total 1 92.04265791632486 84.15 2 6.918238993710692 12.65 3 0.8203445447087777 2.25 4 0.10937927262783702 0.4 5 0.05468963631391851 0.25 6 0.05468963631391851 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTACTAAAACTGCCATCCAAGCAAAGCCAGATTCTATTTATTTTGTTG 6 0.15 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit CTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATCA 5 0.125 No Hit AGCAGTTTGCACATCTTGAGGAAAATGGTGGTAAAAGTGGGCCTGTAATT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.7374999999999998 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.2750000000000004 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.8875 0.0 0.0 0.0 0.0 120-121 3.1500000000000004 0.0 0.0 0.0 0.0 122-123 3.3875 0.0 0.0 0.0 0.0 124-125 3.775 0.0 0.0 0.0 0.0 126-127 4.15 0.0 0.0 0.0 0.0 128-129 4.4375 0.0 0.0 0.0 0.0 130-131 4.875 0.0 0.0 0.0 0.0 132-133 5.225 0.0 0.0 0.0 0.0 134-135 5.4375 0.0 0.0 0.0 0.0 136-137 5.725 0.0 0.0 0.0 0.0 138-139 6.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACTCC 10 0.006830828 145.0 8 >>END_MODULE Read 1076530 spots for SRR12919346.sra Written 1076530 spots for SRR12919346.sra Read 1076530 spots for SRR12919346.sra Written 1076530 spots for SRR12919346.sra Read 1076530 spots for SRR12919346.sra Written 1076530 spots for SRR12919346.sra Read 1076530 spots for SRR12919346.sra Written 1076530 spots for SRR12919346.sra Read 1076530 spots for SRR12919346.sra Written 1076530 spots for SRR12919346.sra Read 1076530 spots for SRR12919346.sra Written 1076530 spots for SRR12919346.sra Read 1076530 spots for SRR12919346.sra Written 1076530 spots for SRR12919346.sra Read 1076530 spots for SRR12919346.sra Written 1076530 spots for SRR12919346.sra Read 1076530 spots for SRR12919346.sra Written 1076530 spots for SRR12919346.sra Read 1076530 spots for SRR12919346.sra Written 1076530 spots for SRR12919346.sra Read 1076530 spots for SRR12919346.sra Written 1076530 spots for SRR12919346.sra Read 1076530 spots for SRR12919346.sra Written 1076530 spots for SRR12919346.sra Read 1076530 spots for SRR12919346.sra Written 1076530 spots for SRR12919346.sra Read 1076546 spots for SRR12919346.sra Written 1076546 spots for SRR12919346.sra Read 1076530 spots for SRR12919346.sra Written 1076530 spots for SRR12919346.sra Read 1076530 spots for SRR12919346.sra Written 1076530 spots for SRR12919346.sra Read 1076530 spots for SRR12919346.sra Written 1076530 spots for SRR12919346.sra Read 1076530 spots for SRR12919346.sra Written 1076530 spots for SRR12919346.sra Read 1076530 spots for SRR12919346.sra Written 1076530 spots for SRR12919346.sra Read 1076530 spots for SRR12919346.sra Written 1076530 spots for SRR12919346.sra SRR ids: ['SRR12919346.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o1xy08eo SRR12919346.sra spots: 21530616 blocks: [[1, 1076530], [1076531, 2153060], [2153061, 3229590], [3229591, 4306120], [4306121, 5382650], [5382651, 6459180], [6459181, 7535710], [7535711, 8612240], [8612241, 9688770], [9688771, 10765300], [10765301, 11841830], [11841831, 12918360], [12918361, 13994890], [13994891, 15071420], [15071421, 16147950], [16147951, 17224480], [17224481, 18301010], [18301011, 19377540], [19377541, 20454070], [20454071, 21530616]] SRR12919346 file size 7295344 SRR12919346 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919346 SRR12919346_1.fastq SRR12919346_2.fastq Input file: SRR12919346_1.fastq Paired file: SRR12919346_2.fastq trimmed: SRR12919346-trimmed-pair1.fastq, SRR12919346-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:31:34 2025 >> started Wed Feb 12 19:32:02 2025 >> done (27.957s) 21530616 read pairs processed; of these: 28 ( 0.00%) short read pairs filtered out after trimming by size control 530 ( 0.00%) empty read pairs filtered out after trimming by size control 21530058 (100.00%) read pairs available; of these: 2316266 (10.76%) trimmed read pairs available after processing 19213792 (89.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 1 0.00% 21 3 0.00% 22 4 0.00% 23 4 0.00% 24 6 0.00% 25 6 0.00% 26 4 0.00% 27 3 0.00% 28 12 0.00% 29 10 0.00% 30 8 0.00% 31 4 0.00% 32 12 0.00% 33 8 0.00% 34 13 0.00% 35 11 0.00% 36 12 0.00% 37 13 0.00% 38 16 0.00% 39 12 0.00% 40 20 0.00% 41 11 0.00% 42 29 0.00% 43 17 0.00% 44 20 0.00% 45 24 0.00% 46 32 0.00% 47 28 0.00% 48 35 0.00% 49 43 0.00% 50 41 0.00% 51 50 0.00% 52 65 0.00% 53 63 0.00% 54 66 0.00% 55 88 0.00% 56 85 0.00% 57 120 0.00% 58 125 0.00% 59 144 0.00% 60 180 0.00% 61 199 0.00% 62 231 0.00% 63 260 0.00% 64 303 0.00% 65 294 0.00% 66 346 0.00% 67 423 0.00% 68 454 0.00% 69 522 0.00% 70 583 0.00% 71 814 0.00% 72 899 0.00% 73 1067 0.00% 74 1264 0.01% 75 1300 0.01% 76 1446 0.01% 77 1550 0.01% 78 1815 0.01% 79 2106 0.01% 80 2413 0.01% 81 2747 0.01% 82 3249 0.02% 83 3664 0.02% 84 4303 0.02% 85 4807 0.02% 86 5055 0.02% 87 5561 0.03% 88 5810 0.03% 89 6415 0.03% 90 7274 0.03% 91 7860 0.04% 92 8912 0.04% 93 9945 0.05% 94 10999 0.05% 95 11801 0.05% 96 12554 0.06% 97 13294 0.06% 98 13654 0.06% 99 14519 0.07% 100 15418 0.07% 101 16508 0.08% 102 17592 0.08% 103 19154 0.09% 104 20705 0.10% 105 22334 0.10% 106 22704 0.11% 107 23620 0.11% 108 24189 0.11% 109 24546 0.11% 110 25587 0.12% 111 26628 0.12% 112 28413 0.13% 113 29538 0.14% 114 31482 0.15% 115 32979 0.15% 116 33658 0.16% 117 34938 0.16% 118 35545 0.17% 119 35792 0.17% 120 36462 0.17% 121 37673 0.17% 122 39035 0.18% 123 40406 0.19% 124 41930 0.19% 125 43496 0.20% 126 45377 0.21% 127 45383 0.21% 128 46089 0.21% 129 45988 0.21% 130 47037 0.22% 131 47504 0.22% 132 48970 0.23% 133 50436 0.23% 134 51842 0.24% 135 53938 0.25% 136 54514 0.25% 137 54806 0.25% 138 55698 0.26% 139 56929 0.26% 140 56650 0.26% 141 57524 0.27% 142 58650 0.27% 143 59113 0.27% 144 61295 0.28% 145 62256 0.29% 146 63471 0.29% 147 64653 0.30% 148 65128 0.30% 149 64865 0.30% 150 65648 0.30% 151 19213792 89.24% 21530058 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=13 prefix-density=0.77 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=23 fanout-score=89.04 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=14.0 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAACAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATT criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=19 prefix-density=0.77 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=86.74 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.0 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGACTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTA SRR12919346 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:33:18 Started mapping on | Feb 12 19:33:18 Finished on | Feb 12 19:36:25 Mapping speed, Million of reads per hour | 414.48 Number of input reads | 21530058 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19899756 Uniquely mapped reads % | 92.43% Average mapped length | 295.11 Number of splices: Total | 19442446 Number of splices: Annotated (sjdb) | 19098228 Number of splices: GT/AG | 19016193 Number of splices: GC/AG | 366521 Number of splices: AT/AC | 11226 Number of splices: Non-canonical | 48506 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 493280 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 46411 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.93% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1137022 1137022 1137022 N_multimapping 493280 493280 493280 N_noFeature 539220 19611481 636968 N_ambiguous 331496 982 140489 UnstrandedReadsAssigned:19029040 PositiveStrandReadsAssigned:287293 NegativeStrandReadsAssigned:19122299 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919346 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919346-trimmed-pair1.fastq SRR12919346-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,530,058 reads, 19,441,591 reads pseudoaligned [quant] estimated average fragment length: 257.814 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52401 SRR12919346.ke.tsv 34699 SRR12919346.se.tsv 87100 total ==> SRR12919346.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.19 328 9.04003 Potri.005G024800.1.v4.1 1035 778.186 402 25.0752 Potri.004G059700.1.v4.1 961 704.223 73 5.03169 Potri.007G009000.2.v4.1 1416 1159.19 0 0 Potri.003G141000.2.v4.1 2943 2686.19 606.356 10.957 Potri.016G087400.1.v4.1 270 84.8707 919.969 526.158 Potri.015G069301.1.v4.1 564 318.199 0 0 Potri.010G195200.1.v4.1 1773 1516.19 8 0.256117 Potri.012G127500.1.v4.1 977 720.223 504 33.9676 ==> SRR12919346.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 591 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 251 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 10 SRR12919346 completed mapping pipeline successfully