Starting /dee2/code/volunteer_pipeline.sh SRR12919347 current disk space = 3051009380352 free memory = 1410182032 SRR12919347 SRAfilesize 5d7348a73f61a6c53ddc0c32ae6419cc SRR12919347.sra SRR12919347.sra file validated SRR12919347 is paired end SRR12919347 is conventional basespace SRR12919347 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919347_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.529 37.0 37.0 37.0 37.0 37.0 2 36.30775 37.0 37.0 37.0 37.0 37.0 3 36.6025 37.0 37.0 37.0 37.0 37.0 4 36.6335 37.0 37.0 37.0 37.0 37.0 5 36.671 37.0 37.0 37.0 37.0 37.0 6 36.606 37.0 37.0 37.0 37.0 37.0 7 36.608 37.0 37.0 37.0 37.0 37.0 8 36.6015 37.0 37.0 37.0 37.0 37.0 9 36.6065 37.0 37.0 37.0 37.0 37.0 10-14 36.621300000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.57620000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5919 37.0 37.0 37.0 37.0 37.0 25-29 36.547399999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.5154 37.0 37.0 37.0 37.0 37.0 35-39 36.4827 37.0 37.0 37.0 37.0 37.0 40-44 36.45559999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.4529 37.0 37.0 37.0 37.0 37.0 50-54 36.42960000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.418400000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.4262 37.0 37.0 37.0 37.0 37.0 65-69 36.3524 37.0 37.0 37.0 37.0 37.0 70-74 36.3806 37.0 37.0 37.0 37.0 37.0 75-79 36.317400000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.3332 37.0 37.0 37.0 37.0 37.0 85-89 36.2478 37.0 37.0 37.0 37.0 37.0 90-94 36.297599999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.2708 37.0 37.0 37.0 37.0 37.0 100-104 36.2425 37.0 37.0 37.0 37.0 37.0 105-109 36.1656 37.0 37.0 37.0 37.0 37.0 110-114 36.1279 37.0 37.0 37.0 37.0 37.0 115-119 36.125 37.0 37.0 37.0 37.0 37.0 120-124 36.103300000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.9924 37.0 37.0 37.0 37.0 37.0 130-134 35.91940000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.885400000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.7725 37.0 37.0 37.0 37.0 37.0 145-149 35.7012 37.0 37.0 37.0 37.0 37.0 150-151 35.547 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 2.0 24 1.0 25 4.0 26 3.0 27 7.0 28 8.0 29 18.0 30 28.0 31 35.0 32 48.0 33 68.0 34 105.0 35 276.0 36 2976.0 37 419.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.475 11.924999999999999 5.875 33.725 2 20.492833794317324 12.798591903444809 36.05732964546141 30.651244656776466 3 18.075 18.775 28.975 34.175 4 23.1 25.374999999999996 23.025000000000002 28.499999999999996 5 23.599999999999998 30.925000000000004 23.799999999999997 21.675 6 20.424999999999997 33.2 24.325 22.05 7 15.55 26.075 40.625 17.75 8 17.1 26.375 32.625 23.9 9 19.425 23.05 33.800000000000004 23.724999999999998 10-14 20.135 29.675 26.965 23.225 15-19 19.79 28.165000000000003 28.455000000000002 23.59 20-24 20.61 28.32 27.515 23.555 25-29 20.165 28.515 27.805000000000003 23.515 30-34 19.49 28.310000000000002 27.595 24.605 35-39 20.119999999999997 28.139999999999997 28.144999999999996 23.595 40-44 20.205000000000002 28.51 27.72 23.565 45-49 20.474999999999998 28.560000000000002 27.005000000000003 23.96 50-54 20.615 27.97 27.85 23.565 55-59 20.169999999999998 28.634999999999998 27.055 24.14 60-64 19.925 27.91 27.894999999999996 24.27 65-69 20.064999999999998 28.105000000000004 27.98 23.849999999999998 70-74 21.044999999999998 28.22 27.465 23.27 75-79 20.025000000000002 28.125 27.139999999999997 24.709999999999997 80-84 20.495 28.365000000000002 27.384999999999998 23.755000000000003 85-89 20.71 27.755000000000003 27.41 24.125 90-94 20.645 28.065 27.544999999999998 23.745 95-99 21.26 28.110000000000003 27.189999999999998 23.44 100-104 20.979999999999997 28.67 27.025 23.325000000000003 105-109 20.979999999999997 27.91 27.16 23.95 110-114 21.185000000000002 27.800000000000004 27.77 23.244999999999997 115-119 21.060000000000002 28.355000000000004 27.22 23.365 120-124 21.18 27.894999999999996 26.965 23.96 125-129 20.74 27.685 27.52 24.055 130-134 20.990000000000002 28.349999999999998 27.12 23.54 135-139 21.42 28.189999999999998 26.424999999999997 23.965 140-144 21.63 27.794999999999998 26.555 24.02 145-149 21.84 28.095 26.265 23.799999999999997 150-151 21.337500000000002 28.3375 25.8625 24.462500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 3.0 20 2.5 21 1.0 22 2.5 23 2.5 24 2.5 25 2.5 26 6.5 27 8.5 28 9.0 29 13.0 30 18.0 31 21.0 32 29.0 33 42.5 34 49.0 35 56.5 36 75.0 37 90.0 38 111.5 39 157.0 40 177.0 41 202.5 42 229.0 43 230.5 44 236.0 45 238.5 46 269.0 47 273.5 48 252.5 49 242.0 50 201.0 51 167.0 52 133.5 53 104.0 54 87.0 55 72.0 56 54.5 57 31.5 58 22.5 59 22.0 60 21.5 61 10.0 62 4.5 63 4.0 64 2.5 65 1.5 66 1.0 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.025 #Duplication Level Percentage of deduplicated Percentage of total 1 90.39155790058318 81.375 2 8.358789225215219 15.049999999999999 3 1.0552624271035824 2.85 4 0.1666203832268814 0.6 5 0.027770063871146906 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAATGATGCACTTCTCACGCTTTCCACTGCAGACAGCAGGAGGAATGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.1749999999999998 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 2.0625 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.5999999999999996 0.0 0.0 0.0 0.0 116-117 2.9 0.0 0.0 0.0 0.0 118-119 3.2375 0.0 0.0 0.0 0.0 120-121 3.6624999999999996 0.0 0.0 0.0 0.0 122-123 4.112500000000001 0.0 0.0 0.0 0.0 124-125 4.5 0.0 0.0 0.0 0.0 126-127 4.8875 0.0 0.0 0.0 0.0 128-129 5.325 0.0 0.0 0.0 0.0 130-131 5.9125 0.0 0.0 0.0 0.0 132-133 6.2625 0.0 0.0 0.0 0.0 134-135 6.762499999999999 0.0 0.0 0.0 0.0 136-137 7.15 0.0 0.0 0.0 0.0 138-139 7.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTTA 10 0.006830828 145.0 3 AAAATTT 10 0.006830828 145.0 2 >>END_MODULE SRR12919347 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919347_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.084 37.0 37.0 37.0 37.0 37.0 2 36.1345 37.0 37.0 37.0 37.0 37.0 3 36.1215 37.0 37.0 37.0 37.0 37.0 4 36.1805 37.0 37.0 37.0 37.0 37.0 5 36.264 37.0 37.0 37.0 37.0 37.0 6 36.2055 37.0 37.0 37.0 37.0 37.0 7 36.2655 37.0 37.0 37.0 37.0 37.0 8 36.1945 37.0 37.0 37.0 37.0 37.0 9 36.214 37.0 37.0 37.0 37.0 37.0 10-14 36.20020000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.1708 37.0 37.0 37.0 37.0 37.0 20-24 36.104499999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.0949 37.0 37.0 37.0 37.0 37.0 30-34 36.0897 37.0 37.0 37.0 37.0 37.0 35-39 36.03959999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.0296 37.0 37.0 37.0 37.0 37.0 45-49 35.9876 37.0 37.0 37.0 37.0 37.0 50-54 35.935900000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.914500000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.928000000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.8437 37.0 37.0 37.0 37.0 37.0 70-74 35.7885 37.0 37.0 37.0 37.0 37.0 75-79 35.7653 37.0 37.0 37.0 37.0 37.0 80-84 35.7177 37.0 37.0 37.0 37.0 37.0 85-89 35.755199999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.7185 37.0 37.0 37.0 37.0 37.0 95-99 35.6726 37.0 37.0 37.0 37.0 37.0 100-104 35.6169 37.0 37.0 37.0 37.0 37.0 105-109 35.6348 37.0 37.0 37.0 37.0 37.0 110-114 35.575 37.0 37.0 37.0 37.0 37.0 115-119 35.566100000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.4697 37.0 37.0 37.0 37.0 37.0 125-129 35.429700000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.4485 37.0 37.0 37.0 37.0 37.0 135-139 35.25 37.0 37.0 37.0 32.2 37.0 140-144 35.22689999999999 37.0 37.0 37.0 29.8 37.0 145-149 35.0908 37.0 37.0 37.0 25.0 37.0 150-151 34.76375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 8.0 15 5.0 16 4.0 17 4.0 18 3.0 19 4.0 20 1.0 21 4.0 22 9.0 23 9.0 24 5.0 25 11.0 26 5.0 27 11.0 28 14.0 29 25.0 30 30.0 31 42.0 32 48.0 33 132.0 34 163.0 35 518.0 36 2680.0 37 262.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.575 23.25 7.375 21.8 2 26.474999999999998 25.85 30.475 17.2 3 23.200000000000003 26.125 32.225 18.45 4 24.75 33.175 23.5 18.575 5 25.025 36.725 20.8 17.45 6 22.75 37.875 21.15 18.224999999999998 7 22.05 21.675 36.525 19.75 8 22.475 25.525 28.175 23.825 9 23.325000000000003 25.324999999999996 28.975 22.375 10-14 23.945 29.310000000000002 25.775 20.97 15-19 23.995 28.575 27.115000000000002 20.315 20-24 23.285 28.415000000000003 27.22 21.08 25-29 23.715 28.044999999999998 27.705000000000002 20.535 30-34 22.935 28.265 27.465 21.335 35-39 22.96 27.525 27.675 21.84 40-44 22.985 28.43 27.47 21.115000000000002 45-49 22.81 27.82 27.389999999999997 21.98 50-54 23.419999999999998 27.235 27.58 21.765 55-59 23.21 27.955000000000002 27.425 21.41 60-64 23.330000000000002 27.284999999999997 27.860000000000003 21.525 65-69 23.62 28.27 27.425 20.685000000000002 70-74 23.095 27.74 27.275 21.89 75-79 23.155 28.405 26.884999999999998 21.555 80-84 23.674999999999997 28.15 26.735 21.44 85-89 23.655 27.794999999999998 27.3 21.25 90-94 23.28 28.21 27.365000000000002 21.145 95-99 23.5 27.575 27.74 21.185000000000002 100-104 22.99 28.705000000000002 27.33 20.974999999999998 105-109 23.125 28.055000000000003 27.565 21.255 110-114 23.335 28.285 27.375 21.005 115-119 23.974999999999998 27.805000000000003 27.334999999999997 20.885 120-124 23.89 27.735 27.595 20.78 125-129 24.15 27.985 27.139999999999997 20.724999999999998 130-134 24.610000000000003 27.805000000000003 26.66 20.925 135-139 24.775 28.405 26.5 20.32 140-144 25.36 27.875 27.089999999999996 19.675 145-149 25.935000000000002 27.47 27.075 19.52 150-151 25.8125 28.6875 25.7 19.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 1.0 14 0.5 15 1.0 16 1.5 17 1.5 18 1.0 19 1.0 20 2.0 21 1.0 22 2.0 23 3.0 24 1.5 25 2.5 26 5.0 27 6.5 28 6.0 29 7.5 30 14.0 31 23.0 32 26.0 33 29.0 34 41.5 35 45.5 36 69.0 37 99.5 38 119.5 39 151.5 40 175.5 41 201.5 42 240.0 43 255.0 44 268.0 45 276.0 46 272.0 47 274.0 48 238.5 49 210.5 50 188.5 51 137.0 52 114.0 53 107.0 54 87.5 55 69.5 56 49.5 57 38.5 58 30.0 59 24.5 60 17.5 61 13.5 62 13.0 63 7.0 64 6.0 65 2.5 66 0.5 67 2.0 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.84350721420644 81.85 2 7.741398446170922 13.950000000000001 3 1.1653718091009988 3.15 4 0.13873473917869034 0.5 5 0.0832408435072142 0.375 6 0.0 0.0 7 0.02774694783573807 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 5 0.125 No Hit GGAAACTTTTCATCCAGACAATTGATCCTGACCATGAAGCCAGGTTTGAT 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.9625 0.0 0.0 0.0 0.0 104-105 1.2000000000000002 0.0 0.0 0.0 0.0 106-107 1.4874999999999998 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.1 0.0 0.0 0.0 0.0 112-113 2.3375 0.0 0.0 0.0 0.0 114-115 2.625 0.0 0.0 0.0 0.0 116-117 2.925 0.0 0.0 0.0 0.0 118-119 3.3 0.0 0.0 0.0 0.0 120-121 3.7375 0.0 0.0 0.0 0.0 122-123 4.199999999999999 0.0 0.0 0.0 0.0 124-125 4.6 0.0 0.0 0.0 0.0 126-127 5.0 0.0 0.0 0.0 0.0 128-129 5.45 0.0 0.0 0.0 0.0 130-131 6.05 0.0 0.0 0.0 0.0 132-133 6.4375 0.0 0.0 0.0 0.0 134-135 6.9125 0.0 0.0 0.0 0.0 136-137 7.3125 0.0 0.0 0.0 0.0 138-139 7.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGGGGA 10 0.006830828 145.0 3 TGGGGAA 10 0.006830828 145.0 4 >>END_MODULE Read 833389 spots for SRR12919347.sra Written 833389 spots for SRR12919347.sra Read 833389 spots for SRR12919347.sra Written 833389 spots for SRR12919347.sra Read 833389 spots for SRR12919347.sra Written 833389 spots for SRR12919347.sra Read 833389 spots for SRR12919347.sra Written 833389 spots for SRR12919347.sra Read 833389 spots for SRR12919347.sra Written 833389 spots for SRR12919347.sra Read 833389 spots for SRR12919347.sra Written 833389 spots for SRR12919347.sra Read 833389 spots for SRR12919347.sra Written 833389 spots for SRR12919347.sra Read 833389 spots for SRR12919347.sra Written 833389 spots for SRR12919347.sra Read 833389 spots for SRR12919347.sra Written 833389 spots for SRR12919347.sra Read 833389 spots for SRR12919347.sra Written 833389 spots for SRR12919347.sra Read 833389 spots for SRR12919347.sra Written 833389 spots for SRR12919347.sra Read 833389 spots for SRR12919347.sra Written 833389 spots for SRR12919347.sra Read 833389 spots for SRR12919347.sra Written 833389 spots for SRR12919347.sra Read 833389 spots for SRR12919347.sra Written 833389 spots for SRR12919347.sra Read 833404 spots for SRR12919347.sra Written 833404 spots for SRR12919347.sra Read 833389 spots for SRR12919347.sra Written 833389 spots for SRR12919347.sra Read 833389 spots for SRR12919347.sra Written 833389 spots for SRR12919347.sra Read 833389 spots for SRR12919347.sra Written 833389 spots for SRR12919347.sra Read 833389 spots for SRR12919347.sra Written 833389 spots for SRR12919347.sra Read 833389 spots for SRR12919347.sra Written 833389 spots for SRR12919347.sra SRR ids: ['SRR12919347.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__zdiojot SRR12919347.sra spots: 16667795 blocks: [[1, 833389], [833390, 1666778], [1666779, 2500167], [2500168, 3333556], [3333557, 4166945], [4166946, 5000334], [5000335, 5833723], [5833724, 6667112], [6667113, 7500501], [7500502, 8333890], [8333891, 9167279], [9167280, 10000668], [10000669, 10834057], [10834058, 11667446], [11667447, 12500835], [12500836, 13334224], [13334225, 14167613], [14167614, 15001002], [15001003, 15834391], [15834392, 16667795]] SRR12919347 file size 5642745 SRR12919347 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919347 SRR12919347_1.fastq SRR12919347_2.fastq Input file: SRR12919347_1.fastq Paired file: SRR12919347_2.fastq trimmed: SRR12919347-trimmed-pair1.fastq, SRR12919347-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:31:19 2025 >> started Wed Feb 12 19:31:47 2025 >> done (28.127s) 16667795 read pairs processed; of these: 25 ( 0.00%) short read pairs filtered out after trimming by size control 4792 ( 0.03%) empty read pairs filtered out after trimming by size control 16662978 (99.97%) read pairs available; of these: 1951109 (11.71%) trimmed read pairs available after processing 14711869 (88.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 3 0.00% 22 5 0.00% 23 5 0.00% 24 3 0.00% 25 4 0.00% 26 4 0.00% 27 10 0.00% 28 8 0.00% 29 10 0.00% 30 12 0.00% 31 17 0.00% 32 5 0.00% 33 14 0.00% 34 16 0.00% 35 16 0.00% 36 11 0.00% 37 20 0.00% 38 25 0.00% 39 23 0.00% 40 25 0.00% 41 31 0.00% 42 38 0.00% 43 29 0.00% 44 28 0.00% 45 39 0.00% 46 39 0.00% 47 54 0.00% 48 69 0.00% 49 75 0.00% 50 101 0.00% 51 99 0.00% 52 124 0.00% 53 97 0.00% 54 128 0.00% 55 134 0.00% 56 140 0.00% 57 160 0.00% 58 169 0.00% 59 227 0.00% 60 239 0.00% 61 347 0.00% 62 365 0.00% 63 372 0.00% 64 449 0.00% 65 484 0.00% 66 487 0.00% 67 567 0.00% 68 604 0.00% 69 696 0.00% 70 855 0.01% 71 1001 0.01% 72 1216 0.01% 73 1335 0.01% 74 1515 0.01% 75 1597 0.01% 76 1716 0.01% 77 1733 0.01% 78 2024 0.01% 79 2231 0.01% 80 2621 0.02% 81 3107 0.02% 82 3684 0.02% 83 4146 0.02% 84 4518 0.03% 85 4766 0.03% 86 5024 0.03% 87 5370 0.03% 88 5651 0.03% 89 5988 0.04% 90 6815 0.04% 91 7655 0.05% 92 8631 0.05% 93 9759 0.06% 94 10492 0.06% 95 11301 0.07% 96 11676 0.07% 97 11924 0.07% 98 12326 0.07% 99 13080 0.08% 100 13710 0.08% 101 14904 0.09% 102 16189 0.10% 103 17673 0.11% 104 18530 0.11% 105 19623 0.12% 106 20339 0.12% 107 20604 0.12% 108 21086 0.13% 109 21177 0.13% 110 21704 0.13% 111 22765 0.14% 112 24158 0.14% 113 25489 0.15% 114 27141 0.16% 115 28333 0.17% 116 29163 0.18% 117 29148 0.17% 118 29509 0.18% 119 29463 0.18% 120 29979 0.18% 121 31167 0.19% 122 32251 0.19% 123 34184 0.21% 124 35889 0.22% 125 36242 0.22% 126 38126 0.23% 127 37680 0.23% 128 38006 0.23% 129 38530 0.23% 130 38283 0.23% 131 38461 0.23% 132 40220 0.24% 133 41841 0.25% 134 42592 0.26% 135 44484 0.27% 136 44720 0.27% 137 45771 0.27% 138 45928 0.28% 139 46152 0.28% 140 45218 0.27% 141 45779 0.27% 142 46957 0.28% 143 47840 0.29% 144 49608 0.30% 145 50832 0.31% 146 52343 0.31% 147 52653 0.32% 148 52969 0.32% 149 52542 0.32% 150 52764 0.32% 151 14711869 88.29% 16662978 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=19 prefix-density=0.86 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=131.61 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=16.2 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAACAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATT criterion=sequence-density sequence-density=1.30 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=25 prefix-density=1.29 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=98.91 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.2 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACC SRR12919347 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:33:03 Started mapping on | Feb 12 19:33:04 Finished on | Feb 12 19:35:21 Mapping speed, Million of reads per hour | 437.86 Number of input reads | 16662978 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15549631 Uniquely mapped reads % | 93.32% Average mapped length | 294.66 Number of splices: Total | 15459110 Number of splices: Annotated (sjdb) | 15171039 Number of splices: GT/AG | 15130868 Number of splices: GC/AG | 279804 Number of splices: AT/AC | 8708 Number of splices: Non-canonical | 39730 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 368194 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 26191 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.12% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 745153 745153 745153 N_multimapping 368194 368194 368194 N_noFeature 467290 15352814 546773 N_ambiguous 220306 829 102493 UnstrandedReadsAssigned:14862035 PositiveStrandReadsAssigned:195988 NegativeStrandReadsAssigned:14900365 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919347 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919347-trimmed-pair1.fastq SRR12919347-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,662,978 reads, 14,963,588 reads pseudoaligned [quant] estimated average fragment length: 257.712 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR12919347.ke.tsv 34699 SRR12919347.se.tsv 87100 total ==> SRR12919347.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.29 319 12.8501 Potri.005G024800.1.v4.1 1035 778.288 359 32.7266 Potri.004G059700.1.v4.1 961 704.461 24 2.41714 Potri.007G009000.2.v4.1 1416 1159.29 0 0 Potri.003G141000.2.v4.1 2943 2686.29 440 11.6211 Potri.016G087400.1.v4.1 270 87.3592 579.741 470.838 Potri.015G069301.1.v4.1 564 323.329 0 0 Potri.010G195200.1.v4.1 1773 1516.29 4 0.187165 Potri.012G127500.1.v4.1 977 720.367 70 6.8943 ==> SRR12919347.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 189 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 141 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 14 SRR12919347 completed mapping pipeline successfully