Starting /dee2/code/volunteer_pipeline.sh SRR12919348 current disk space = 3050966110208 free memory = 1458586868 SRR12919348 SRAfilesize 7fc981c177eb909ff82ca53689c0421d SRR12919348.sra SRR12919348.sra file validated SRR12919348 is paired end SRR12919348 is conventional basespace SRR12919348 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919348_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5625 37.0 37.0 37.0 37.0 37.0 2 36.366 37.0 37.0 37.0 37.0 37.0 3 36.6335 37.0 37.0 37.0 37.0 37.0 4 36.592 37.0 37.0 37.0 37.0 37.0 5 36.6995 37.0 37.0 37.0 37.0 37.0 6 36.632 37.0 37.0 37.0 37.0 37.0 7 36.6225 37.0 37.0 37.0 37.0 37.0 8 36.687 37.0 37.0 37.0 37.0 37.0 9 36.613 37.0 37.0 37.0 37.0 37.0 10-14 36.6524 37.0 37.0 37.0 37.0 37.0 15-19 36.6594 37.0 37.0 37.0 37.0 37.0 20-24 36.5994 37.0 37.0 37.0 37.0 37.0 25-29 36.5788 37.0 37.0 37.0 37.0 37.0 30-34 36.566199999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.5399 37.0 37.0 37.0 37.0 37.0 40-44 36.54430000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.4926 37.0 37.0 37.0 37.0 37.0 50-54 36.5021 37.0 37.0 37.0 37.0 37.0 55-59 36.434000000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.4046 37.0 37.0 37.0 37.0 37.0 65-69 36.4267 37.0 37.0 37.0 37.0 37.0 70-74 36.3573 37.0 37.0 37.0 37.0 37.0 75-79 36.3245 37.0 37.0 37.0 37.0 37.0 80-84 36.2748 37.0 37.0 37.0 37.0 37.0 85-89 36.294799999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.2886 37.0 37.0 37.0 37.0 37.0 95-99 36.278499999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.2527 37.0 37.0 37.0 37.0 37.0 105-109 36.162000000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.1053 37.0 37.0 37.0 37.0 37.0 115-119 36.0965 37.0 37.0 37.0 37.0 37.0 120-124 36.144400000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.9991 37.0 37.0 37.0 37.0 37.0 130-134 35.9769 37.0 37.0 37.0 37.0 37.0 135-139 35.8846 37.0 37.0 37.0 37.0 37.0 140-144 35.7501 37.0 37.0 37.0 37.0 37.0 145-149 35.7695 37.0 37.0 37.0 37.0 37.0 150-151 35.4295 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 2.0 24 2.0 25 2.0 26 0.0 27 5.0 28 19.0 29 12.0 30 22.0 31 27.0 32 42.0 33 72.0 34 111.0 35 302.0 36 2935.0 37 446.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.3 12.75 4.7 39.25 2 18.47662141779789 12.996480643539469 37.7325289089995 30.794369029663148 3 16.6 17.299999999999997 28.375 37.724999999999994 4 21.375 25.55 24.625 28.449999999999996 5 21.9 32.074999999999996 24.175 21.85 6 19.05 33.825 25.6 21.525 7 14.299999999999999 27.1 42.475 16.125 8 15.85 27.175 33.074999999999996 23.9 9 16.900000000000002 24.275 34.625 24.2 10-14 19.725 29.315 27.839999999999996 23.119999999999997 15-19 20.0 28.505000000000003 27.595 23.9 20-24 19.66 28.725 28.055000000000003 23.56 25-29 19.43 28.175 28.465 23.93 30-34 19.195 28.754999999999995 27.755000000000003 24.295 35-39 19.49 28.49 27.705000000000002 24.315 40-44 19.855 28.79 28.08 23.275000000000002 45-49 19.689999999999998 28.92 27.229999999999997 24.16 50-54 20.14 28.23 27.785 23.845 55-59 20.035 29.525000000000002 27.245 23.195 60-64 20.32 28.04 27.88 23.76 65-69 20.150000000000002 28.050000000000004 28.08 23.72 70-74 20.65 28.415000000000003 27.275 23.66 75-79 20.36 28.694999999999997 27.405 23.54 80-84 19.74 28.725 27.715 23.82 85-89 19.900000000000002 28.375 27.925 23.799999999999997 90-94 19.97 28.389999999999997 27.284999999999997 24.355 95-99 20.14 28.694999999999997 27.265 23.9 100-104 20.535 28.64 27.115000000000002 23.71 105-109 20.76 29.330000000000002 26.674999999999997 23.235 110-114 20.57 28.694999999999997 26.935 23.799999999999997 115-119 20.495 28.65 27.355 23.5 120-124 20.985 28.785 26.86 23.369999999999997 125-129 20.985 28.000000000000004 26.955000000000002 24.060000000000002 130-134 20.27 28.575 27.3 23.855 135-139 21.015 27.92 27.515 23.549999999999997 140-144 20.655 28.32 27.145000000000003 23.880000000000003 145-149 20.7 27.73 26.729999999999997 24.84 150-151 21.15 27.425 26.875 24.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 1.5 23 3.0 24 4.5 25 4.0 26 6.0 27 7.5 28 6.0 29 13.0 30 18.0 31 24.0 32 37.0 33 41.5 34 56.0 35 79.0 36 91.5 37 108.5 38 134.5 39 146.0 40 180.0 41 220.5 42 234.0 43 257.0 44 269.5 45 267.5 46 254.5 47 231.0 48 234.0 49 228.5 50 195.0 51 157.0 52 121.5 53 91.5 54 74.5 55 55.0 56 35.5 57 31.0 58 21.0 59 15.5 60 14.0 61 9.5 62 6.0 63 3.5 64 1.0 65 1.0 66 1.0 67 1.5 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5499999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.17500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.49071250346549 81.6 2 8.317161075686167 15.0 3 0.99805932908234 2.7 4 0.19406709176601053 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.36250000000000004 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.3624999999999998 0.0 0.0 0.0 0.0 102-103 1.5750000000000002 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.1375 0.0 0.0 0.0 0.0 108-109 2.525 0.0 0.0 0.0 0.0 110-111 2.9375 0.0 0.0 0.0 0.0 112-113 3.25 0.0 0.0 0.0 0.0 114-115 3.7125 0.0 0.0 0.0 0.0 116-117 4.1625 0.0 0.0 0.0 0.0 118-119 4.6125 0.0 0.0 0.0 0.0 120-121 5.1625 0.0 0.0 0.0 0.0 122-123 5.6 0.0 0.0 0.0 0.0 124-125 5.975 0.0 0.0 0.0 0.0 126-127 6.5 0.0 0.0 0.0 0.0 128-129 7.0 0.0 0.0 0.0 0.0 130-131 7.475 0.0 0.0 0.0 0.0 132-133 8.212499999999999 0.0 0.0 0.0 0.0 134-135 8.825 0.0 0.0 0.0 0.0 136-137 9.55 0.0 0.0 0.0 0.0 138-139 10.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCTCA 10 0.006830828 145.0 3 CTGCTCA 10 0.006830828 145.0 4 >>END_MODULE SRR12919348 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919348_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.095 37.0 37.0 37.0 37.0 37.0 2 35.8505 37.0 37.0 37.0 37.0 37.0 3 35.934 37.0 37.0 37.0 37.0 37.0 4 35.9535 37.0 37.0 37.0 37.0 37.0 5 36.132 37.0 37.0 37.0 37.0 37.0 6 36.105 37.0 37.0 37.0 37.0 37.0 7 36.0455 37.0 37.0 37.0 37.0 37.0 8 36.1185 37.0 37.0 37.0 37.0 37.0 9 36.169 37.0 37.0 37.0 37.0 37.0 10-14 36.103100000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.0918 37.0 37.0 37.0 37.0 37.0 20-24 36.0647 37.0 37.0 37.0 37.0 37.0 25-29 36.0111 37.0 37.0 37.0 37.0 37.0 30-34 35.996300000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.9919 37.0 37.0 37.0 37.0 37.0 40-44 35.922000000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.860699999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.8508 37.0 37.0 37.0 37.0 37.0 55-59 35.81529999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.8115 37.0 37.0 37.0 37.0 37.0 65-69 35.810500000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.7855 37.0 37.0 37.0 37.0 37.0 75-79 35.71329999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.693000000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.668400000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.5885 37.0 37.0 37.0 37.0 37.0 95-99 35.64190000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.5303 37.0 37.0 37.0 37.0 37.0 105-109 35.560500000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.511 37.0 37.0 37.0 37.0 37.0 115-119 35.5068 37.0 37.0 37.0 37.0 37.0 120-124 35.397299999999994 37.0 37.0 37.0 34.6 37.0 125-129 35.4029 37.0 37.0 37.0 37.0 37.0 130-134 35.237700000000004 37.0 37.0 37.0 32.2 37.0 135-139 35.166700000000006 37.0 37.0 37.0 27.4 37.0 140-144 35.0851 37.0 37.0 37.0 25.0 37.0 145-149 34.918400000000005 37.0 37.0 37.0 25.0 37.0 150-151 34.798500000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 2.0 15 2.0 16 2.0 17 1.0 18 3.0 19 4.0 20 2.0 21 4.0 22 5.0 23 12.0 24 4.0 25 11.0 26 13.0 27 12.0 28 17.0 29 28.0 30 37.0 31 50.0 32 71.0 33 105.0 34 253.0 35 636.0 36 2519.0 37 202.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.475 24.725 8.4 26.400000000000002 2 27.450000000000003 28.325 29.275000000000002 14.95 3 20.825 27.375 31.775 20.025000000000002 4 23.549999999999997 33.5 24.175 18.775 5 25.0 36.025 22.05 16.925 6 20.95 38.975 22.650000000000002 17.424999999999997 7 19.925 22.75 38.550000000000004 18.775 8 20.325 25.0 29.349999999999998 25.324999999999996 9 22.0 24.425 31.025000000000002 22.55 10-14 23.91 28.975 26.205000000000002 20.91 15-19 22.97 28.82 27.565 20.645 20-24 23.175 28.689999999999998 27.82 20.315 25-29 23.24 27.794999999999998 28.325 20.64 30-34 23.555 28.754999999999995 27.750000000000004 19.939999999999998 35-39 22.66 28.18 27.98 21.18 40-44 23.669999999999998 27.755000000000003 27.685 20.89 45-49 23.035 27.229999999999997 28.505000000000003 21.23 50-54 23.044999999999998 27.915 28.810000000000002 20.23 55-59 23.26 27.47 28.485 20.785 60-64 23.47 27.025 28.705000000000002 20.8 65-69 23.115 27.705000000000002 27.860000000000003 21.32 70-74 23.645 27.634999999999998 27.455000000000002 21.265 75-79 23.275000000000002 27.92 28.000000000000004 20.805 80-84 23.599999999999998 28.205000000000002 27.544999999999998 20.65 85-89 23.45 27.185 28.22 21.145 90-94 23.68 26.965 28.48 20.875 95-99 23.885 28.395 27.11 20.61 100-104 23.915 28.1 27.11 20.875 105-109 24.12 27.295 28.439999999999998 20.145 110-114 23.695 27.900000000000002 27.800000000000004 20.605 115-119 24.82 27.889999999999997 27.66 19.63 120-124 25.080000000000002 28.02 26.884999999999998 20.015 125-129 24.505 27.860000000000003 27.43 20.205000000000002 130-134 24.94 27.894999999999996 27.395000000000003 19.77 135-139 25.869999999999997 26.805 27.395000000000003 19.93 140-144 25.575 27.939999999999998 26.915 19.57 145-149 25.8 27.485 26.86 19.855 150-151 26.525 26.924999999999997 26.9125 19.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 1.0 23 1.0 24 2.0 25 3.5 26 6.5 27 8.5 28 10.0 29 15.5 30 19.5 31 25.0 32 30.0 33 44.0 34 59.5 35 63.0 36 81.5 37 104.0 38 132.0 39 170.0 40 197.5 41 220.0 42 236.5 43 246.0 44 263.5 45 283.5 46 270.5 47 245.5 48 216.5 49 198.5 50 171.5 51 132.0 52 117.5 53 95.5 54 71.0 55 56.0 56 46.5 57 35.5 58 22.5 59 19.0 60 17.5 61 11.5 62 8.5 63 6.5 64 5.0 65 2.5 66 1.0 67 1.5 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 1.0 75 1.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.5 81 1.0 82 0.5 83 1.0 84 1.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.275 #Duplication Level Percentage of deduplicated Percentage of total 1 90.80587094987538 81.975 2 7.920243699806148 14.299999999999999 3 1.0800332317917474 2.9250000000000003 4 0.13846579894765992 0.5 5 0.027693159789531983 0.125 6 0.0 0.0 7 0.027693159789531983 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.36250000000000004 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.9750000000000001 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.3875000000000002 0.0 0.0 0.0 0.0 102-103 1.6375000000000002 0.0 0.0 0.0 0.0 104-105 1.95 0.0 0.0 0.0 0.0 106-107 2.2125 0.0 0.0 0.0 0.0 108-109 2.625 0.0 0.0 0.0 0.0 110-111 3.0375 0.0 0.0 0.0 0.0 112-113 3.3499999999999996 0.0 0.0 0.0 0.0 114-115 3.8125 0.0 0.0 0.0 0.0 116-117 4.2625 0.0 0.0 0.0 0.0 118-119 4.725 0.0 0.0 0.0 0.0 120-121 5.2375 0.0 0.0 0.0 0.0 122-123 5.6625 0.0 0.0 0.0 0.0 124-125 6.0375 0.0 0.0 0.0 0.0 126-127 6.5875 0.0 0.0 0.0 0.0 128-129 7.1 0.0 0.0 0.0 0.0 130-131 7.625 0.0 0.0 0.0 0.0 132-133 8.3625 0.0 0.0 0.0 0.0 134-135 8.975000000000001 0.0 0.0 0.0 0.0 136-137 9.675 0.0 0.0 0.0 0.0 138-139 10.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 849086 spots for SRR12919348.sra Written 849086 spots for SRR12919348.sra Read 849086 spots for SRR12919348.sra Read 849086 spots for SRR12919348.sra Written 849086 spots for SRR12919348.sra Written 849086 spots for SRR12919348.sra Read 849086 spots for SRR12919348.sra Written 849086 spots for SRR12919348.sra Read 849086 spots for SRR12919348.sra Written 849086 spots for SRR12919348.sra Read 849086 spots for SRR12919348.sra Written 849086 spots for SRR12919348.sra Read 849086 spots for SRR12919348.sra Written 849086 spots for SRR12919348.sra Read 849086 spots for SRR12919348.sra Written 849086 spots for SRR12919348.sra Read 849086 spots for SRR12919348.sra Written 849086 spots for SRR12919348.sra Read 849086 spots for SRR12919348.sra Written 849086 spots for SRR12919348.sra Read 849086 spots for SRR12919348.sra Written 849086 spots for SRR12919348.sra Read 849086 spots for SRR12919348.sra Written 849086 spots for SRR12919348.sra Read 849086 spots for SRR12919348.sra Written 849086 spots for SRR12919348.sra Read 849086 spots for SRR12919348.sra Written 849086 spots for SRR12919348.sra Read 849086 spots for SRR12919348.sra Written 849086 spots for SRR12919348.sra Read 849086 spots for SRR12919348.sra Written 849086 spots for SRR12919348.sra Read 849086 spots for SRR12919348.sra Written 849086 spots for SRR12919348.sra Read 849086 spots for SRR12919348.sra Written 849086 spots for SRR12919348.sra Read 849086 spots for SRR12919348.sra Written 849086 spots for SRR12919348.sra Read 849089 spots for SRR12919348.sra Written 849089 spots for SRR12919348.sra SRR ids: ['SRR12919348.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ytj2t73v SRR12919348.sra spots: 16981723 blocks: [[1, 849086], [849087, 1698172], [1698173, 2547258], [2547259, 3396344], [3396345, 4245430], [4245431, 5094516], [5094517, 5943602], [5943603, 6792688], [6792689, 7641774], [7641775, 8490860], [8490861, 9339946], [9339947, 10189032], [10189033, 11038118], [11038119, 11887204], [11887205, 12736290], [12736291, 13585376], [13585377, 14434462], [14434463, 15283548], [15283549, 16132634], [16132635, 16981723]] SRR12919348 file size 5749432 SRR12919348 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919348 SRR12919348_1.fastq SRR12919348_2.fastq Input file: SRR12919348_1.fastq Paired file: SRR12919348_2.fastq trimmed: SRR12919348-trimmed-pair1.fastq, SRR12919348-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:34:55 2025 >> started Wed Feb 12 19:35:14 2025 >> done (19.411s) 16981723 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 488 ( 0.00%) empty read pairs filtered out after trimming by size control 16981212 (100.00%) read pairs available; of these: 2526080 (14.88%) trimmed read pairs available after processing 14455132 (85.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 9 0.00% 21 1 0.00% 22 4 0.00% 23 5 0.00% 24 7 0.00% 25 7 0.00% 26 6 0.00% 27 5 0.00% 28 6 0.00% 29 6 0.00% 30 5 0.00% 31 5 0.00% 32 13 0.00% 33 14 0.00% 34 11 0.00% 35 13 0.00% 36 22 0.00% 37 16 0.00% 38 22 0.00% 39 16 0.00% 40 36 0.00% 41 25 0.00% 42 29 0.00% 43 34 0.00% 44 32 0.00% 45 30 0.00% 46 46 0.00% 47 48 0.00% 48 55 0.00% 49 59 0.00% 50 90 0.00% 51 89 0.00% 52 125 0.00% 53 94 0.00% 54 129 0.00% 55 131 0.00% 56 134 0.00% 57 180 0.00% 58 212 0.00% 59 213 0.00% 60 312 0.00% 61 360 0.00% 62 406 0.00% 63 466 0.00% 64 509 0.00% 65 526 0.00% 66 626 0.00% 67 657 0.00% 68 753 0.00% 69 939 0.01% 70 1096 0.01% 71 1247 0.01% 72 1484 0.01% 73 1658 0.01% 74 1953 0.01% 75 2164 0.01% 76 2347 0.01% 77 2465 0.01% 78 2877 0.02% 79 3251 0.02% 80 3571 0.02% 81 4235 0.02% 82 4792 0.03% 83 5428 0.03% 84 6089 0.04% 85 6555 0.04% 86 7189 0.04% 87 7594 0.04% 88 8442 0.05% 89 8976 0.05% 90 9976 0.06% 91 10789 0.06% 92 11951 0.07% 93 13098 0.08% 94 14303 0.08% 95 15319 0.09% 96 16300 0.10% 97 16998 0.10% 98 17434 0.10% 99 18484 0.11% 100 19721 0.12% 101 20597 0.12% 102 22062 0.13% 103 23657 0.14% 104 24941 0.15% 105 26245 0.15% 106 26879 0.16% 107 27917 0.16% 108 28283 0.17% 109 29563 0.17% 110 29698 0.17% 111 31280 0.18% 112 32079 0.19% 113 33940 0.20% 114 35398 0.21% 115 37375 0.22% 116 37716 0.22% 117 38779 0.23% 118 39679 0.23% 119 39856 0.23% 120 40746 0.24% 121 41393 0.24% 122 43094 0.25% 123 44049 0.26% 124 45802 0.27% 125 46731 0.28% 126 48212 0.28% 127 49454 0.29% 128 49184 0.29% 129 49962 0.29% 130 50313 0.30% 131 50045 0.29% 132 51670 0.30% 133 53066 0.31% 134 54372 0.32% 135 55817 0.33% 136 56483 0.33% 137 56767 0.33% 138 58059 0.34% 139 58589 0.35% 140 57825 0.34% 141 58393 0.34% 142 59628 0.35% 143 59924 0.35% 144 61825 0.36% 145 62755 0.37% 146 63168 0.37% 147 63691 0.38% 148 64514 0.38% 149 64433 0.38% 150 64841 0.38% 151 14455132 85.12% 16981212 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=15 prefix-density=0.59 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=26.10 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.2 sequence=CAGTTTCATTTGAGACTACAAATGAAGGAAGAAAAACTTGGGACAAATTAAATTACATGCTCAGTAACAGTAGAGATAACAATCATAAAATCCACCCCCCCCTGCCGGAACACCACCGACGACACAAACAGAAAGAGATCTTATTTAACCGCTAAACTCTTCCTCTTTGTGTGTCTCGATGACAACATCAGACGTAGGATAAGCAACACAGGTGAGAACCCAGCCTTCCTCTATCTGGTCATCATCAAGGAAGCTAGCATCAGACTGATCCACAGTCCCCTTCACAATCTTGCCAAGACATGAAGAGCATGAGCCAGCCCTGCATGAGTAGGGGAGGTCAATCTCTTCTGCCTCCTCAGCATGGTCAAGGATGTAGATGTCATCGGGGCATGCAAACTCCTTCTCACCATCAGGAGTGATGAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=25 prefix-density=0.44 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=70.39 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.7 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT SRR12919348 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:35:54 Started mapping on | Feb 12 19:35:54 Finished on | Feb 12 19:37:35 Mapping speed, Million of reads per hour | 605.27 Number of input reads | 16981212 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15909692 Uniquely mapped reads % | 93.69% Average mapped length | 292.86 Number of splices: Total | 15782428 Number of splices: Annotated (sjdb) | 15441505 Number of splices: GT/AG | 15469226 Number of splices: GC/AG | 252524 Number of splices: AT/AC | 10323 Number of splices: Non-canonical | 50355 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 391169 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 32061 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.70% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 680351 680351 680351 N_multimapping 391169 391169 391169 N_noFeature 556337 15696315 647521 N_ambiguous 232843 785 110231 UnstrandedReadsAssigned:15120512 PositiveStrandReadsAssigned:212592 NegativeStrandReadsAssigned:15151940 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919348 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919348-trimmed-pair1.fastq SRR12919348-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,981,212 reads, 15,251,667 reads pseudoaligned [quant] estimated average fragment length: 243.431 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52401 SRR12919348.ke.tsv 34699 SRR12919348.se.tsv 87100 total ==> SRR12919348.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.57 780 29.6582 Potri.005G024800.1.v4.1 1035 792.569 309 26.3214 Potri.004G059700.1.v4.1 961 718.688 32 3.00606 Potri.007G009000.2.v4.1 1416 1173.57 0 0 Potri.003G141000.2.v4.1 2943 2700.57 733 18.3247 Potri.016G087400.1.v4.1 270 91.9859 962 706.06 Potri.015G069301.1.v4.1 564 335.235 0 0 Potri.010G195200.1.v4.1 1773 1530.57 58 2.55837 Potri.012G127500.1.v4.1 977 734.649 195 17.9202 ==> SRR12919348.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 64 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 157 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 57 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 3 SRR12919348 completed mapping pipeline successfully