Starting /dee2/code/volunteer_pipeline.sh SRR12919349 current disk space = 3050903724032 free memory = 1579849616 SRR12919349 SRAfilesize cb01825c75c66ea1600c488175ac67be SRR12919349.sra SRR12919349.sra file validated SRR12919349 is paired end SRR12919349 is conventional basespace SRR12919349 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919349_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6505 37.0 37.0 37.0 37.0 37.0 2 36.26425 37.0 37.0 37.0 37.0 37.0 3 36.5765 37.0 37.0 37.0 37.0 37.0 4 36.6235 37.0 37.0 37.0 37.0 37.0 5 36.7485 37.0 37.0 37.0 37.0 37.0 6 36.6885 37.0 37.0 37.0 37.0 37.0 7 36.584 37.0 37.0 37.0 37.0 37.0 8 36.6025 37.0 37.0 37.0 37.0 37.0 9 36.677 37.0 37.0 37.0 37.0 37.0 10-14 36.69350000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.665499999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.6256 37.0 37.0 37.0 37.0 37.0 25-29 36.6003 37.0 37.0 37.0 37.0 37.0 30-34 36.56079999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.5635 37.0 37.0 37.0 37.0 37.0 40-44 36.5741 37.0 37.0 37.0 37.0 37.0 45-49 36.5295 37.0 37.0 37.0 37.0 37.0 50-54 36.553 37.0 37.0 37.0 37.0 37.0 55-59 36.5218 37.0 37.0 37.0 37.0 37.0 60-64 36.4485 37.0 37.0 37.0 37.0 37.0 65-69 36.486200000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.4207 37.0 37.0 37.0 37.0 37.0 75-79 36.3467 37.0 37.0 37.0 37.0 37.0 80-84 36.3713 37.0 37.0 37.0 37.0 37.0 85-89 36.3195 37.0 37.0 37.0 37.0 37.0 90-94 36.338300000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.2967 37.0 37.0 37.0 37.0 37.0 100-104 36.2649 37.0 37.0 37.0 37.0 37.0 105-109 36.2 37.0 37.0 37.0 37.0 37.0 110-114 36.169599999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.187400000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.146 37.0 37.0 37.0 37.0 37.0 125-129 36.0945 37.0 37.0 37.0 37.0 37.0 130-134 36.032 37.0 37.0 37.0 37.0 37.0 135-139 35.985499999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.926500000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.9431 37.0 37.0 37.0 37.0 37.0 150-151 35.7535 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 3.0 26 5.0 27 6.0 28 5.0 29 12.0 30 20.0 31 21.0 32 35.0 33 70.0 34 106.0 35 274.0 36 3004.0 37 438.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.475 12.275 7.199999999999999 42.05 2 18.93729539158902 14.253336691009821 36.036262906069 30.77310501133216 3 16.325 18.075 29.825000000000003 35.775 4 20.45 25.825 25.2 28.525 5 22.125 31.4 23.925 22.55 6 21.099999999999998 35.699999999999996 22.625 20.575 7 14.75 28.075 39.925 17.25 8 16.55 25.3 32.074999999999996 26.075 9 17.675 23.025000000000002 35.099999999999994 24.2 10-14 19.575 30.209999999999997 27.405 22.81 15-19 19.74 28.18 27.500000000000004 24.58 20-24 19.84 28.015 28.205000000000002 23.94 25-29 19.835 28.665000000000003 27.3 24.2 30-34 19.79 29.270000000000003 27.625 23.315 35-39 20.07 29.225 26.825 23.880000000000003 40-44 20.185 28.64 27.839999999999996 23.335 45-49 19.634999999999998 28.575 27.839999999999996 23.95 50-54 20.32 28.98 27.265 23.435 55-59 20.285 28.384999999999998 27.61 23.72 60-64 19.985 28.415000000000003 27.625 23.974999999999998 65-69 20.47 28.610000000000003 26.955000000000002 23.965 70-74 19.905 28.665000000000003 27.58 23.849999999999998 75-79 20.205000000000002 28.255000000000003 27.88 23.66 80-84 20.21 28.205000000000002 28.050000000000004 23.535 85-89 19.89 28.73 27.73 23.65 90-94 19.99 28.03 27.705000000000002 24.275 95-99 20.185 28.375 27.82 23.62 100-104 19.919999999999998 28.599999999999998 27.505000000000003 23.974999999999998 105-109 20.785 27.560000000000002 28.82 22.835 110-114 21.18 28.21 27.650000000000002 22.96 115-119 20.855 28.21 27.415 23.52 120-124 20.95 28.555000000000003 27.115000000000002 23.380000000000003 125-129 20.665 28.24 27.345000000000002 23.75 130-134 20.985 28.685 27.005000000000003 23.325000000000003 135-139 21.415 27.99 26.229999999999997 24.365000000000002 140-144 21.09 28.505000000000003 26.56 23.845 145-149 21.029999999999998 28.005000000000003 26.915 24.05 150-151 20.45 28.762500000000003 27.325 23.4625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 2.0 21 3.0 22 2.0 23 3.0 24 6.5 25 7.5 26 4.5 27 4.5 28 10.0 29 12.5 30 18.5 31 26.0 32 36.0 33 40.5 34 51.0 35 77.0 36 93.0 37 99.5 38 125.0 39 159.0 40 182.5 41 206.5 42 219.0 43 229.5 44 253.5 45 268.5 46 271.0 47 272.5 48 257.0 49 215.5 50 177.5 51 151.0 52 122.0 53 98.5 54 78.0 55 60.5 56 47.5 57 33.5 58 20.5 59 16.0 60 13.5 61 9.5 62 4.5 63 1.5 64 1.5 65 1.0 66 2.0 67 2.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.7250000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.85 #Duplication Level Percentage of deduplicated Percentage of total 1 90.03895381190874 80.9 2 8.820255982192544 15.85 3 0.9738452977184197 2.625 4 0.13912075681691707 0.5 5 0.02782415136338342 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCAAAGCATGACCAAAGTACAAAAACGTTGGATCGGTGGCACCTTCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.8625 0.0 0.0 0.0 0.0 116-117 2.0999999999999996 0.0 0.0 0.0 0.0 118-119 2.5 0.0 0.0 0.0 0.0 120-121 2.825 0.0 0.0 0.0 0.0 122-123 3.0 0.0 0.0 0.0 0.0 124-125 3.45 0.0 0.0 0.0 0.0 126-127 3.9375 0.0 0.0 0.0 0.0 128-129 4.25 0.0 0.0 0.0 0.0 130-131 4.6375 0.0 0.0 0.0 0.0 132-133 5.0625 0.0 0.0 0.0 0.0 134-135 5.45 0.0 0.0 0.0 0.0 136-137 5.775 0.0 0.0 0.0 0.0 138-139 6.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACATG 10 0.006830828 145.0 9 >>END_MODULE SRR12919349 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919349_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.284 37.0 37.0 37.0 37.0 37.0 2 36.208 37.0 37.0 37.0 37.0 37.0 3 36.278 37.0 37.0 37.0 37.0 37.0 4 36.3365 37.0 37.0 37.0 37.0 37.0 5 36.32 37.0 37.0 37.0 37.0 37.0 6 36.3745 37.0 37.0 37.0 37.0 37.0 7 36.278 37.0 37.0 37.0 37.0 37.0 8 36.3565 37.0 37.0 37.0 37.0 37.0 9 36.3165 37.0 37.0 37.0 37.0 37.0 10-14 36.364999999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.32180000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.317099999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.225300000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.1886 37.0 37.0 37.0 37.0 37.0 35-39 36.28680000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.1382 37.0 37.0 37.0 37.0 37.0 45-49 36.16270000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.0923 37.0 37.0 37.0 37.0 37.0 55-59 36.0813 37.0 37.0 37.0 37.0 37.0 60-64 36.0189 37.0 37.0 37.0 37.0 37.0 65-69 36.0733 37.0 37.0 37.0 37.0 37.0 70-74 35.9484 37.0 37.0 37.0 37.0 37.0 75-79 35.9379 37.0 37.0 37.0 37.0 37.0 80-84 35.970400000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.9272 37.0 37.0 37.0 37.0 37.0 90-94 35.8125 37.0 37.0 37.0 37.0 37.0 95-99 35.9265 37.0 37.0 37.0 37.0 37.0 100-104 35.8065 37.0 37.0 37.0 37.0 37.0 105-109 35.739200000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.6864 37.0 37.0 37.0 37.0 37.0 115-119 35.7523 37.0 37.0 37.0 37.0 37.0 120-124 35.6486 37.0 37.0 37.0 37.0 37.0 125-129 35.5869 37.0 37.0 37.0 37.0 37.0 130-134 35.5394 37.0 37.0 37.0 37.0 37.0 135-139 35.4403 37.0 37.0 37.0 37.0 37.0 140-144 35.3017 37.0 37.0 37.0 32.2 37.0 145-149 35.174099999999996 37.0 37.0 37.0 29.8 37.0 150-151 34.95925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 2.0 16 1.0 17 1.0 18 0.0 19 4.0 20 3.0 21 1.0 22 7.0 23 3.0 24 3.0 25 5.0 26 7.0 27 10.0 28 14.0 29 16.0 30 28.0 31 45.0 32 50.0 33 84.0 34 235.0 35 576.0 36 2647.0 37 256.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.025000000000006 25.874999999999996 8.95 28.15 2 27.625 28.249999999999996 29.525000000000002 14.6 3 19.725 29.525000000000002 31.874999999999996 18.875 4 23.7 34.35 23.724999999999998 18.224999999999998 5 24.075 37.675 20.925 17.325 6 20.775 38.95 22.900000000000002 17.375 7 19.650000000000002 23.425 37.824999999999996 19.1 8 20.925 26.1 28.799999999999997 24.175 9 21.8 24.525 29.7 23.974999999999998 10-14 23.375 29.099999999999998 26.14 21.385 15-19 22.68 28.37 27.834999999999997 21.115000000000002 20-24 23.155 29.4 27.325 20.119999999999997 25-29 22.869999999999997 29.13 27.534999999999997 20.465 30-34 23.02 28.23 28.04 20.71 35-39 23.095 28.405 27.715 20.785 40-44 23.06 28.945 27.495000000000005 20.5 45-49 22.99 27.529999999999998 28.13 21.349999999999998 50-54 22.795 27.825 27.61 21.77 55-59 23.32 28.084999999999997 27.325 21.27 60-64 22.98 27.750000000000004 28.449999999999996 20.82 65-69 23.215 27.939999999999998 27.92 20.925 70-74 23.505000000000003 28.060000000000002 27.875 20.560000000000002 75-79 22.919999999999998 28.365000000000002 27.49 21.224999999999998 80-84 22.925 28.13 27.694999999999997 21.25 85-89 23.47 28.249999999999996 26.810000000000002 21.47 90-94 24.275 27.57 27.67 20.485 95-99 23.674999999999997 28.34 27.605 20.380000000000003 100-104 23.84 28.46 27.250000000000004 20.45 105-109 23.995 27.845 27.944999999999997 20.215 110-114 24.455 27.485 27.500000000000004 20.560000000000002 115-119 24.455 27.615000000000002 27.365000000000002 20.565 120-124 24.745 27.55 27.465 20.24 125-129 24.735 27.845 26.935 20.485 130-134 24.605 27.215 27.525 20.655 135-139 25.014999999999997 27.73 27.54 19.715 140-144 25.230000000000004 27.465 26.96 20.345 145-149 25.624999999999996 28.095 26.619999999999997 19.66 150-151 26.137500000000003 27.037499999999998 27.375 19.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 1.5 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.0 23 2.0 24 2.0 25 0.5 26 1.5 27 4.5 28 7.0 29 11.5 30 19.5 31 23.0 32 25.5 33 41.0 34 55.0 35 64.0 36 77.5 37 110.0 38 151.0 39 183.0 40 195.0 41 220.5 42 255.0 43 257.0 44 283.5 45 277.5 46 255.5 47 253.5 48 224.5 49 195.0 50 163.0 51 136.0 52 118.0 53 91.0 54 75.0 55 59.0 56 33.5 57 27.0 58 23.0 59 17.0 60 14.5 61 11.0 62 5.0 63 3.0 64 2.5 65 3.0 66 2.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.5 80 0.5 81 0.5 82 1.0 83 1.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.7 #Duplication Level Percentage of deduplicated Percentage of total 1 90.35674470457079 81.05 2 8.249721293199554 14.799999999999999 3 1.0590858416945375 2.85 4 0.2508361204013378 0.8999999999999999 5 0.055741360089186176 0.25 6 0.027870680044593088 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit CGATGAGGATGAGGGTGTTGATGACCAAACTGTCAAGGTGGTTGACATTG 5 0.125 No Hit CTGCATAGCTTACAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.9624999999999999 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.1749999999999998 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.7375 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.5 0.0 0.0 0.0 0.0 120-121 2.825 0.0 0.0 0.0 0.0 122-123 3.0 0.0 0.0 0.0 0.0 124-125 3.4375 0.0 0.0 0.0 0.0 126-127 3.9375 0.0 0.0 0.0 0.0 128-129 4.2625 0.0 0.0 0.0 0.0 130-131 4.6875 0.0 0.0 0.0 0.0 132-133 5.112500000000001 0.0 0.0 0.0 0.0 134-135 5.5 0.0 0.0 0.0 0.0 136-137 5.825 0.0 0.0 0.0 0.0 138-139 6.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAGAAT 10 0.006830828 145.0 1 >>END_MODULE Read 1175063 spots for SRR12919349.sra Written 1175063 spots for SRR12919349.sra Read 1175063 spots for SRR12919349.sra Written 1175063 spots for SRR12919349.sra Read 1175063 spots for SRR12919349.sra Written 1175063 spots for SRR12919349.sra Read 1175063 spots for SRR12919349.sra Written 1175063 spots for SRR12919349.sra Read 1175063 spots for SRR12919349.sra Written 1175063 spots for SRR12919349.sra Read 1175063 spots for SRR12919349.sra Written 1175063 spots for SRR12919349.sra Read 1175063 spots for SRR12919349.sra Written 1175063 spots for SRR12919349.sra Read 1175063 spots for SRR12919349.sra Written 1175063 spots for SRR12919349.sra Read 1175063 spots for SRR12919349.sra Written 1175063 spots for SRR12919349.sra Read 1175063 spots for SRR12919349.sra Written 1175063 spots for SRR12919349.sra Read 1175063 spots for SRR12919349.sra Written 1175063 spots for SRR12919349.sra Read 1175063 spots for SRR12919349.sra Written 1175063 spots for SRR12919349.sra Read 1175063 spots for SRR12919349.sra Written 1175063 spots for SRR12919349.sra Read 1175063 spots for SRR12919349.sra Written 1175063 spots for SRR12919349.sra Read 1175063 spots for SRR12919349.sra Written 1175063 spots for SRR12919349.sra Read 1175063 spots for SRR12919349.sra Written 1175063 spots for SRR12919349.sra Read 1175063 spots for SRR12919349.sra Written 1175063 spots for SRR12919349.sra Read 1175063 spots for SRR12919349.sra Written 1175063 spots for SRR12919349.sra Read 1175067 spots for SRR12919349.sra Written 1175067 spots for SRR12919349.sra Read 1175063 spots for SRR12919349.sra Written 1175063 spots for SRR12919349.sra SRR ids: ['SRR12919349.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h6j8olgl SRR12919349.sra spots: 23501264 blocks: [[1, 1175063], [1175064, 2350126], [2350127, 3525189], [3525190, 4700252], [4700253, 5875315], [5875316, 7050378], [7050379, 8225441], [8225442, 9400504], [9400505, 10575567], [10575568, 11750630], [11750631, 12925693], [12925694, 14100756], [14100757, 15275819], [15275820, 16450882], [16450883, 17625945], [17625946, 18801008], [18801009, 19976071], [19976072, 21151134], [21151135, 22326197], [22326198, 23501264]] SRR12919349 file size 7965057 SRR12919349 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919349 SRR12919349_1.fastq SRR12919349_2.fastq Input file: SRR12919349_1.fastq Paired file: SRR12919349_2.fastq trimmed: SRR12919349-trimmed-pair1.fastq, SRR12919349-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:39:39 2025 >> started Wed Feb 12 20:40:04 2025 >> done (25.066s) 23501264 read pairs processed; of these: 26 ( 0.00%) short read pairs filtered out after trimming by size control 222 ( 0.00%) empty read pairs filtered out after trimming by size control 23501016 (100.00%) read pairs available; of these: 2318549 ( 9.87%) trimmed read pairs available after processing 21182467 (90.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 9 0.00% 21 2 0.00% 22 4 0.00% 23 11 0.00% 24 2 0.00% 25 8 0.00% 26 4 0.00% 27 4 0.00% 28 10 0.00% 29 8 0.00% 30 6 0.00% 31 4 0.00% 32 11 0.00% 33 7 0.00% 34 13 0.00% 35 14 0.00% 36 14 0.00% 37 10 0.00% 38 19 0.00% 39 10 0.00% 40 18 0.00% 41 22 0.00% 42 24 0.00% 43 27 0.00% 44 16 0.00% 45 32 0.00% 46 35 0.00% 47 21 0.00% 48 31 0.00% 49 33 0.00% 50 43 0.00% 51 85 0.00% 52 47 0.00% 53 56 0.00% 54 57 0.00% 55 58 0.00% 56 88 0.00% 57 85 0.00% 58 106 0.00% 59 140 0.00% 60 178 0.00% 61 216 0.00% 62 203 0.00% 63 236 0.00% 64 235 0.00% 65 308 0.00% 66 344 0.00% 67 411 0.00% 68 428 0.00% 69 533 0.00% 70 653 0.00% 71 667 0.00% 72 896 0.00% 73 1020 0.00% 74 1192 0.01% 75 1238 0.01% 76 1397 0.01% 77 1499 0.01% 78 1620 0.01% 79 1995 0.01% 80 2301 0.01% 81 2600 0.01% 82 3213 0.01% 83 3579 0.02% 84 4036 0.02% 85 4445 0.02% 86 4620 0.02% 87 5179 0.02% 88 5658 0.02% 89 6007 0.03% 90 6724 0.03% 91 7576 0.03% 92 8507 0.04% 93 9806 0.04% 94 10558 0.04% 95 11381 0.05% 96 11869 0.05% 97 12951 0.06% 98 13274 0.06% 99 13936 0.06% 100 14975 0.06% 101 15832 0.07% 102 17265 0.07% 103 18455 0.08% 104 20059 0.09% 105 21617 0.09% 106 22142 0.09% 107 22512 0.10% 108 23419 0.10% 109 24077 0.10% 110 24315 0.10% 111 26018 0.11% 112 27698 0.12% 113 28920 0.12% 114 30928 0.13% 115 32047 0.14% 116 33423 0.14% 117 34259 0.15% 118 34579 0.15% 119 35083 0.15% 120 36137 0.15% 121 37286 0.16% 122 38466 0.16% 123 40476 0.17% 124 42425 0.18% 125 43313 0.18% 126 44602 0.19% 127 45444 0.19% 128 45589 0.19% 129 46539 0.20% 130 47320 0.20% 131 47814 0.20% 132 48892 0.21% 133 51228 0.22% 134 52356 0.22% 135 53865 0.23% 136 55916 0.24% 137 56552 0.24% 138 56736 0.24% 139 57742 0.25% 140 57858 0.25% 141 58387 0.25% 142 59118 0.25% 143 60692 0.26% 144 62810 0.27% 145 64327 0.27% 146 65402 0.28% 147 65940 0.28% 148 67750 0.29% 149 67089 0.29% 150 68168 0.29% 151 21182467 90.13% 23501016 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=17 prefix-density=0.73 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=19.87 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.6 sequence=GAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=21 prefix-density=0.76 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.23 sequence-density-rank=18 fanout-score=13.34 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=5.3 sequence=AGCAATGGCAGCATACACGGTGAAGCTC SRR12919349 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:41:11 Started mapping on | Feb 12 20:41:14 Finished on | Feb 12 20:43:24 Mapping speed, Million of reads per hour | 650.80 Number of input reads | 23501016 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 22260291 Uniquely mapped reads % | 94.72% Average mapped length | 296.08 Number of splices: Total | 22339657 Number of splices: Annotated (sjdb) | 21900853 Number of splices: GT/AG | 21900983 Number of splices: GC/AG | 363640 Number of splices: AT/AC | 11932 Number of splices: Non-canonical | 63102 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.99 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 480321 % of reads mapped to multiple loci | 2.04% Number of reads mapped to too many loci | 37275 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.99% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 760404 760404 760404 N_multimapping 480321 480321 480321 N_noFeature 672012 21893970 781698 N_ambiguous 419202 1586 161500 UnstrandedReadsAssigned:21169077 PositiveStrandReadsAssigned:364735 NegativeStrandReadsAssigned:21317093 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919349 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919349-trimmed-pair1.fastq SRR12919349-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,501,016 reads, 21,243,491 reads pseudoaligned [quant] estimated average fragment length: 264.442 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52401 SRR12919349.ke.tsv 34699 SRR12919349.se.tsv 87100 total ==> SRR12919349.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1754.56 419 9.69105 Potri.005G024800.1.v4.1 1035 771.558 745 39.1843 Potri.004G059700.1.v4.1 961 697.678 8 0.465329 Potri.007G009000.2.v4.1 1416 1152.56 0 0 Potri.003G141000.2.v4.1 2943 2679.56 934.551 14.1535 Potri.016G087400.1.v4.1 270 83.3124 924.173 450.161 Potri.015G069301.1.v4.1 564 315.408 0 0 Potri.010G195200.1.v4.1 1773 1509.56 49 1.31726 Potri.012G127500.1.v4.1 977 713.624 511 29.0587 ==> SRR12919349.se.tsv <== Potri.001G166300.v4.1 5 Potri.001G448400.v4.1 19 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 163 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 10 SRR12919349 completed mapping pipeline successfully