Starting /dee2/code/volunteer_pipeline.sh SRR12919350 current disk space = 3050941853696 free memory = 1466231852 SRR12919350 SRAfilesize 48e9a0f76ef7c59e9080dd59c6391254 SRR12919350.sra SRR12919350.sra file validated SRR12919350 is paired end SRR12919350 is conventional basespace SRR12919350 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919350_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.482 37.0 37.0 37.0 37.0 37.0 2 36.208 37.0 37.0 37.0 37.0 37.0 3 36.65 37.0 37.0 37.0 37.0 37.0 4 36.6235 37.0 37.0 37.0 37.0 37.0 5 36.6625 37.0 37.0 37.0 37.0 37.0 6 36.6585 37.0 37.0 37.0 37.0 37.0 7 36.596 37.0 37.0 37.0 37.0 37.0 8 36.651 37.0 37.0 37.0 37.0 37.0 9 36.664 37.0 37.0 37.0 37.0 37.0 10-14 36.644400000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.6298 37.0 37.0 37.0 37.0 37.0 20-24 36.6031 37.0 37.0 37.0 37.0 37.0 25-29 36.5701 37.0 37.0 37.0 37.0 37.0 30-34 36.4918 37.0 37.0 37.0 37.0 37.0 35-39 36.4776 37.0 37.0 37.0 37.0 37.0 40-44 36.481500000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.482 37.0 37.0 37.0 37.0 37.0 50-54 36.4437 37.0 37.0 37.0 37.0 37.0 55-59 36.4551 37.0 37.0 37.0 37.0 37.0 60-64 36.399 37.0 37.0 37.0 37.0 37.0 65-69 36.4325 37.0 37.0 37.0 37.0 37.0 70-74 36.373900000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.325599999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.3891 37.0 37.0 37.0 37.0 37.0 85-89 36.2891 37.0 37.0 37.0 37.0 37.0 90-94 36.231 37.0 37.0 37.0 37.0 37.0 95-99 36.2303 37.0 37.0 37.0 37.0 37.0 100-104 36.2106 37.0 37.0 37.0 37.0 37.0 105-109 36.1515 37.0 37.0 37.0 37.0 37.0 110-114 36.1084 37.0 37.0 37.0 37.0 37.0 115-119 36.1122 37.0 37.0 37.0 37.0 37.0 120-124 36.1151 37.0 37.0 37.0 37.0 37.0 125-129 35.995 37.0 37.0 37.0 37.0 37.0 130-134 35.926 37.0 37.0 37.0 37.0 37.0 135-139 35.889700000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.852199999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.751999999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.62575 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 2.0 25 2.0 26 7.0 27 8.0 28 13.0 29 17.0 30 15.0 31 24.0 32 43.0 33 60.0 34 115.0 35 317.0 36 2963.0 37 412.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.1 13.5 6.675000000000001 36.725 2 20.362903225806452 12.525201612903224 37.247983870967744 29.86391129032258 3 17.05 20.05 28.499999999999996 34.4 4 20.95 28.299999999999997 25.05 25.7 5 22.375 31.424999999999997 24.175 22.025 6 20.65 34.65 24.5 20.200000000000003 7 14.725 26.724999999999998 41.449999999999996 17.1 8 18.525 25.474999999999998 30.9 25.1 9 18.025 23.925 34.025 24.025 10-14 19.465 29.645 27.405 23.485 15-19 19.8 28.349999999999998 27.93 23.919999999999998 20-24 19.35 28.76 27.96 23.93 25-29 19.955000000000002 28.849999999999998 27.91 23.285 30-34 20.16 28.875 27.415 23.549999999999997 35-39 19.685 27.310000000000002 28.51 24.495 40-44 19.985 28.78 27.775 23.46 45-49 20.21 28.1 27.38 24.310000000000002 50-54 20.155 27.88 28.065 23.9 55-59 20.285 28.115000000000002 28.294999999999998 23.305 60-64 20.915 28.375 27.29 23.419999999999998 65-69 20.395 28.165000000000003 27.175 24.265 70-74 19.575 29.125 27.005000000000003 24.295 75-79 20.29 28.62 27.79 23.3 80-84 19.97 28.08 28.415000000000003 23.535 85-89 20.4 28.384999999999998 27.62 23.595 90-94 20.415 28.565 26.855 24.165 95-99 20.885 27.77 27.51 23.835 100-104 20.49 28.754999999999995 27.61 23.145 105-109 20.935000000000002 28.16 26.889999999999997 24.015 110-114 20.525 28.405 27.62 23.45 115-119 20.005 28.465 27.275 24.255 120-124 20.68 28.415000000000003 26.700000000000003 24.205 125-129 19.97 28.060000000000002 28.02 23.95 130-134 20.855 27.779999999999998 27.52 23.845 135-139 20.91 27.834999999999997 26.775 24.48 140-144 21.175 27.405 27.47 23.95 145-149 20.915 28.48 26.995 23.61 150-151 21.2375 27.4125 26.650000000000002 24.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 3.0 22 2.5 23 0.5 24 2.5 25 4.5 26 5.5 27 6.0 28 6.0 29 11.5 30 17.0 31 27.5 32 40.0 33 44.0 34 58.5 35 79.0 36 96.0 37 107.0 38 133.5 39 164.0 40 175.5 41 196.0 42 221.5 43 234.0 44 240.5 45 259.5 46 274.5 47 253.0 48 231.5 49 203.5 50 174.5 51 157.0 52 135.0 53 111.5 54 83.0 55 64.5 56 45.0 57 35.5 58 31.0 59 20.0 60 14.0 61 12.0 62 8.0 63 3.0 64 1.0 65 0.5 66 0.0 67 1.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.8 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.675 #Duplication Level Percentage of deduplicated Percentage of total 1 91.20485249517507 82.69999999999999 2 7.719878687620624 14.000000000000002 3 0.7995588640749932 2.175 4 0.19299696719051557 0.7000000000000001 5 0.055141990625861594 0.25 6 0.0 0.0 7 0.027570995312930797 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGCCCACGTTATCAGAACCTCTACACTAGGAACCTGCCCTGCATACTTAC 7 0.17500000000000002 No Hit CAGCAAAAACACACATGAAGACACTGAGGTACTTGTACTGAGTAAACAGG 5 0.125 No Hit GTCGCTGATATCCGAAAGGATCTAGCTGAGCCCACCATTGTTCTGTCCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.7250000000000001 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.9749999999999999 0.0 0.0 0.0 0.0 116-117 2.225 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.5625 0.0 0.0 0.0 0.0 122-123 2.7875 0.0 0.0 0.0 0.0 124-125 3.2125 0.0 0.0 0.0 0.0 126-127 3.5250000000000004 0.0 0.0 0.0 0.0 128-129 4.012499999999999 0.0 0.0 0.0 0.0 130-131 4.325 0.0 0.0 0.0 0.0 132-133 4.7375 0.0 0.0 0.0 0.0 134-135 5.15 0.0 0.0 0.0 0.0 136-137 5.725 0.0 0.0 0.0 0.0 138-139 6.237500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAGACA 10 0.006830828 145.0 9 TTGATGG 10 0.006830828 145.0 8 >>END_MODULE SRR12919350 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919350_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.123 37.0 37.0 37.0 37.0 37.0 2 35.771 37.0 37.0 37.0 37.0 37.0 3 35.8355 37.0 37.0 37.0 37.0 37.0 4 35.7895 37.0 37.0 37.0 37.0 37.0 5 36.0025 37.0 37.0 37.0 37.0 37.0 6 35.988 37.0 37.0 37.0 37.0 37.0 7 36.0535 37.0 37.0 37.0 37.0 37.0 8 36.134 37.0 37.0 37.0 37.0 37.0 9 36.0615 37.0 37.0 37.0 37.0 37.0 10-14 36.123400000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.1111 37.0 37.0 37.0 37.0 37.0 20-24 36.1021 37.0 37.0 37.0 37.0 37.0 25-29 36.0092 37.0 37.0 37.0 37.0 37.0 30-34 36.0117 37.0 37.0 37.0 37.0 37.0 35-39 36.0043 37.0 37.0 37.0 37.0 37.0 40-44 35.933 37.0 37.0 37.0 37.0 37.0 45-49 35.92229999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.91180000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.9072 37.0 37.0 37.0 37.0 37.0 60-64 35.83669999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.8692 37.0 37.0 37.0 37.0 37.0 70-74 35.8574 37.0 37.0 37.0 37.0 37.0 75-79 35.7368 37.0 37.0 37.0 37.0 37.0 80-84 35.6862 37.0 37.0 37.0 37.0 37.0 85-89 35.7072 37.0 37.0 37.0 37.0 37.0 90-94 35.6635 37.0 37.0 37.0 37.0 37.0 95-99 35.6483 37.0 37.0 37.0 37.0 37.0 100-104 35.5989 37.0 37.0 37.0 37.0 37.0 105-109 35.59400000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.523199999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.4653 37.0 37.0 37.0 37.0 37.0 120-124 35.4295 37.0 37.0 37.0 37.0 37.0 125-129 35.4145 37.0 37.0 37.0 37.0 37.0 130-134 35.329899999999995 37.0 37.0 37.0 34.6 37.0 135-139 35.144 37.0 37.0 37.0 27.4 37.0 140-144 35.1561 37.0 37.0 37.0 29.8 37.0 145-149 35.0706 37.0 37.0 37.0 27.4 37.0 150-151 34.83775 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 4.0 15 2.0 16 3.0 17 0.0 18 0.0 19 1.0 20 1.0 21 4.0 22 5.0 23 6.0 24 7.0 25 9.0 26 11.0 27 12.0 28 22.0 29 32.0 30 24.0 31 49.0 32 69.0 33 132.0 34 246.0 35 671.0 36 2499.0 37 189.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.675000000000004 26.05 8.55 23.724999999999998 2 27.85 24.925 31.125000000000004 16.1 3 20.075000000000003 27.6 33.675 18.65 4 22.7 35.225 24.45 17.625 5 24.025 36.3 20.875 18.8 6 22.075 38.45 21.7 17.775 7 20.150000000000002 23.125 37.225 19.5 8 23.275000000000002 25.775 25.275 25.674999999999997 9 22.05 25.275 29.799999999999997 22.875 10-14 24.11 29.099999999999998 26.0 20.79 15-19 23.635 28.785 27.375 20.205000000000002 20-24 23.785 28.77 26.810000000000002 20.635 25-29 24.14 27.595 27.200000000000003 21.065 30-34 23.54 28.095 27.67 20.695 35-39 23.14 27.889999999999997 27.955000000000002 21.015 40-44 22.985 28.110000000000003 27.67 21.235 45-49 23.35 28.18 27.560000000000002 20.91 50-54 23.105 27.935 28.415000000000003 20.544999999999998 55-59 22.650000000000002 27.93 27.955000000000002 21.465 60-64 23.26 27.42 28.134999999999998 21.185000000000002 65-69 23.425 28.035 27.439999999999998 21.099999999999998 70-74 23.71 27.935 27.37 20.985 75-79 22.975 28.244999999999997 27.384999999999998 21.395 80-84 23.625 27.650000000000002 27.625 21.099999999999998 85-89 23.935000000000002 28.005000000000003 27.13 20.93 90-94 23.355 27.589999999999996 27.534999999999997 21.52 95-99 23.155 27.889999999999997 27.625 21.33 100-104 23.91 28.475 26.86 20.755000000000003 105-109 24.09 28.22 27.345000000000002 20.345 110-114 23.35 27.575 27.384999999999998 21.69 115-119 23.43 28.01 27.900000000000002 20.66 120-124 24.4 28.410000000000004 27.415 19.775000000000002 125-129 25.14 27.3 27.46 20.1 130-134 24.89 27.735 27.18 20.195 135-139 24.92 28.235 26.985 19.86 140-144 25.205 27.55 27.065 20.18 145-149 25.305 27.395000000000003 26.93 20.369999999999997 150-151 26.737499999999997 27.725 25.362499999999997 20.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 1.5 23 2.0 24 1.0 25 0.5 26 3.0 27 4.5 28 4.5 29 5.0 30 8.5 31 23.0 32 36.0 33 42.5 34 45.0 35 51.5 36 80.5 37 113.0 38 125.0 39 148.5 40 190.5 41 216.0 42 240.5 43 267.5 44 281.5 45 289.5 46 280.5 47 259.5 48 228.5 49 194.0 50 146.0 51 127.0 52 131.5 53 107.5 54 86.0 55 64.5 56 40.0 57 29.5 58 27.0 59 19.0 60 14.0 61 11.5 62 13.5 63 9.5 64 3.0 65 2.5 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 1.0 72 1.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 1.0 85 1.0 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.675 #Duplication Level Percentage of deduplicated Percentage of total 1 91.45299145299145 82.92500000000001 2 7.30631375792666 13.25 3 0.964984835952578 2.625 4 0.11028398125172319 0.4 5 0.13785497656465398 0.625 6 0.0 0.0 7 0.027570995312930797 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGAACCTTTCGCTATTGGAGGAGCTGCCAATGGCGGTGCGTTTAGTCCT 7 0.17500000000000002 No Hit AGATAACATGGCACTGAGGTTGTGGGCTTCTTCAACGGCCAATGCACTGA 5 0.125 No Hit GGACTGAGTAGAGATCTCAGCAATGTAAGAAAGGCAGCTGGAATGGACTC 5 0.125 No Hit GTTCTGTCTGCATCTGTGCTGGTATAATTCTCACTGTTGAAGAGTCGGAA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.7250000000000001 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.05 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.95 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.5625 0.0 0.0 0.0 0.0 122-123 2.775 0.0 0.0 0.0 0.0 124-125 3.1875 0.0 0.0 0.0 0.0 126-127 3.5 0.0 0.0 0.0 0.0 128-129 3.9875 0.0 0.0 0.0 0.0 130-131 4.3 0.0 0.0 0.0 0.0 132-133 4.7125 0.0 0.0 0.0 0.0 134-135 5.125 0.0 0.0 0.0 0.0 136-137 5.7 0.0 0.0 0.0 0.0 138-139 6.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 939877 spots for SRR12919350.sra Written 939877 spots for SRR12919350.sra Read 939877 spots for SRR12919350.sra Written 939877 spots for SRR12919350.sra Read 939877 spots for SRR12919350.sra Written 939877 spots for SRR12919350.sra Read 939877 spots for SRR12919350.sra Written 939877 spots for SRR12919350.sra Read 939877 spots for SRR12919350.sra Written 939877 spots for SRR12919350.sra Read 939877 spots for SRR12919350.sra Written 939877 spots for SRR12919350.sra Read 939877 spots for SRR12919350.sra Written 939877 spots for SRR12919350.sra Read 939877 spots for SRR12919350.sra Written 939877 spots for SRR12919350.sra Read 939877 spots for SRR12919350.sra Written 939877 spots for SRR12919350.sra Read 939877 spots for SRR12919350.sra Written 939877 spots for SRR12919350.sra Read 939877 spots for SRR12919350.sra Written 939877 spots for SRR12919350.sra Read 939877 spots for SRR12919350.sra Written 939877 spots for SRR12919350.sra Read 939877 spots for SRR12919350.sra Written 939877 spots for SRR12919350.sra Read 939877 spots for SRR12919350.sra Written 939877 spots for SRR12919350.sra Read 939877 spots for SRR12919350.sra Written 939877 spots for SRR12919350.sra Read 939877 spots for SRR12919350.sra Written 939877 spots for SRR12919350.sra Read 939877 spots for SRR12919350.sra Written 939877 spots for SRR12919350.sra Read 939878 spots for SRR12919350.sra Written 939878 spots for SRR12919350.sra Read 939877 spots for SRR12919350.sra Written 939877 spots for SRR12919350.sra Read 939877 spots for SRR12919350.sra Written 939877 spots for SRR12919350.sra SRR ids: ['SRR12919350.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ifb5x8a6 SRR12919350.sra spots: 18797541 blocks: [[1, 939877], [939878, 1879754], [1879755, 2819631], [2819632, 3759508], [3759509, 4699385], [4699386, 5639262], [5639263, 6579139], [6579140, 7519016], [7519017, 8458893], [8458894, 9398770], [9398771, 10338647], [10338648, 11278524], [11278525, 12218401], [12218402, 13158278], [13158279, 14098155], [14098156, 15038032], [15038033, 15977909], [15977910, 16917786], [16917787, 17857663], [17857664, 18797541]] SRR12919350 file size 6366526 SRR12919350 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919350 SRR12919350_1.fastq SRR12919350_2.fastq Input file: SRR12919350_1.fastq Paired file: SRR12919350_2.fastq trimmed: SRR12919350-trimmed-pair1.fastq, SRR12919350-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:53:06 2025 >> started Wed Feb 12 19:53:40 2025 >> done (34.314s) 18797541 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 2150 ( 0.01%) empty read pairs filtered out after trimming by size control 18795367 (99.99%) read pairs available; of these: 1713408 ( 9.12%) trimmed read pairs available after processing 17081959 (90.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 12 0.00% 20 4 0.00% 21 2 0.00% 22 6 0.00% 23 4 0.00% 24 4 0.00% 25 2 0.00% 26 8 0.00% 27 2 0.00% 28 5 0.00% 29 3 0.00% 30 6 0.00% 31 5 0.00% 32 7 0.00% 33 11 0.00% 34 6 0.00% 35 17 0.00% 36 5 0.00% 37 11 0.00% 38 10 0.00% 39 12 0.00% 40 22 0.00% 41 12 0.00% 42 13 0.00% 43 8 0.00% 44 17 0.00% 45 26 0.00% 46 20 0.00% 47 26 0.00% 48 23 0.00% 49 33 0.00% 50 31 0.00% 51 49 0.00% 52 48 0.00% 53 57 0.00% 54 57 0.00% 55 58 0.00% 56 69 0.00% 57 76 0.00% 58 82 0.00% 59 108 0.00% 60 115 0.00% 61 144 0.00% 62 153 0.00% 63 194 0.00% 64 196 0.00% 65 209 0.00% 66 213 0.00% 67 261 0.00% 68 265 0.00% 69 359 0.00% 70 409 0.00% 71 537 0.00% 72 644 0.00% 73 737 0.00% 74 854 0.00% 75 874 0.00% 76 931 0.00% 77 1037 0.01% 78 1185 0.01% 79 1333 0.01% 80 1553 0.01% 81 1898 0.01% 82 2151 0.01% 83 2444 0.01% 84 2864 0.02% 85 3053 0.02% 86 3089 0.02% 87 3372 0.02% 88 3721 0.02% 89 3951 0.02% 90 4593 0.02% 91 5055 0.03% 92 5953 0.03% 93 6718 0.04% 94 7446 0.04% 95 7885 0.04% 96 8207 0.04% 97 8438 0.04% 98 8735 0.05% 99 9441 0.05% 100 9876 0.05% 101 10845 0.06% 102 12264 0.07% 103 13533 0.07% 104 14494 0.08% 105 15326 0.08% 106 15568 0.08% 107 16138 0.09% 108 16359 0.09% 109 16727 0.09% 110 17203 0.09% 111 18442 0.10% 112 20058 0.11% 113 21071 0.11% 114 23030 0.12% 115 24517 0.13% 116 24449 0.13% 117 24848 0.13% 118 25195 0.13% 119 25041 0.13% 120 25821 0.14% 121 26772 0.14% 122 28276 0.15% 123 30303 0.16% 124 32071 0.17% 125 32572 0.17% 126 33743 0.18% 127 33848 0.18% 128 33504 0.18% 129 34187 0.18% 130 34862 0.19% 131 35439 0.19% 132 36608 0.19% 133 38492 0.20% 134 40153 0.21% 135 41648 0.22% 136 42428 0.23% 137 43068 0.23% 138 42622 0.23% 139 42799 0.23% 140 42548 0.23% 141 43143 0.23% 142 44140 0.23% 143 45642 0.24% 144 47412 0.25% 145 49405 0.26% 146 50582 0.27% 147 51253 0.27% 148 51289 0.27% 149 50497 0.27% 150 51097 0.27% 151 17081959 90.88% 18795367 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=17 prefix-density=0.77 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=12.07 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.7 sequence=GACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=21 prefix-density=0.60 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=68.50 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.1 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT SRR12919350 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:54:27 Started mapping on | Feb 12 19:54:28 Finished on | Feb 12 20:01:22 Mapping speed, Million of reads per hour | 163.44 Number of input reads | 18795367 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17225363 Uniquely mapped reads % | 91.65% Average mapped length | 296.30 Number of splices: Total | 17108393 Number of splices: Annotated (sjdb) | 16764009 Number of splices: GT/AG | 16754575 Number of splices: GC/AG | 294198 Number of splices: AT/AC | 10966 Number of splices: Non-canonical | 48654 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 418880 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 90404 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.48% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1151124 1151124 1151124 N_multimapping 418880 418880 418880 N_noFeature 610846 16992646 689306 N_ambiguous 270340 1035 115599 UnstrandedReadsAssigned:16344177 PositiveStrandReadsAssigned:231682 NegativeStrandReadsAssigned:16420458 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919350 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919350-trimmed-pair1.fastq SRR12919350-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,795,367 reads, 16,525,666 reads pseudoaligned [quant] estimated average fragment length: 272.203 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,003 rounds 52401 SRR12919350.ke.tsv 34699 SRR12919350.se.tsv 87100 total ==> SRR12919350.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.8 755 25.3878 Potri.005G024800.1.v4.1 1035 763.797 750 57.6772 Potri.004G059700.1.v4.1 961 689.969 32 2.72421 Potri.007G009000.2.v4.1 1416 1144.8 0 0 Potri.003G141000.2.v4.1 2943 2671.8 593 13.0368 Potri.016G087400.1.v4.1 270 82.6093 815.267 579.684 Potri.015G069301.1.v4.1 564 311.146 0 0 Potri.010G195200.1.v4.1 1773 1501.8 47 1.83826 Potri.012G127500.1.v4.1 977 705.878 312 25.9624 ==> SRR12919350.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 44 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 169 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12919350 completed mapping pipeline successfully