Starting /dee2/code/volunteer_pipeline.sh SRR12919351 current disk space = 3050961985536 free memory = 1511169024 SRR12919351 SRAfilesize d4da63af34a2a208ebf76d3c36bc164d SRR12919351.sra SRR12919351.sra file validated SRR12919351 is paired end SRR12919351 is conventional basespace SRR12919351 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919351_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5725 37.0 37.0 37.0 37.0 37.0 2 36.35425 37.0 37.0 37.0 37.0 37.0 3 36.6555 37.0 37.0 37.0 37.0 37.0 4 36.5995 37.0 37.0 37.0 37.0 37.0 5 36.6615 37.0 37.0 37.0 37.0 37.0 6 36.6945 37.0 37.0 37.0 37.0 37.0 7 36.6585 37.0 37.0 37.0 37.0 37.0 8 36.634 37.0 37.0 37.0 37.0 37.0 9 36.648 37.0 37.0 37.0 37.0 37.0 10-14 36.6828 37.0 37.0 37.0 37.0 37.0 15-19 36.626 37.0 37.0 37.0 37.0 37.0 20-24 36.638 37.0 37.0 37.0 37.0 37.0 25-29 36.5916 37.0 37.0 37.0 37.0 37.0 30-34 36.557900000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.53340000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.5249 37.0 37.0 37.0 37.0 37.0 45-49 36.4643 37.0 37.0 37.0 37.0 37.0 50-54 36.5113 37.0 37.0 37.0 37.0 37.0 55-59 36.497800000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.4608 37.0 37.0 37.0 37.0 37.0 65-69 36.4369 37.0 37.0 37.0 37.0 37.0 70-74 36.418 37.0 37.0 37.0 37.0 37.0 75-79 36.411199999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.3707 37.0 37.0 37.0 37.0 37.0 85-89 36.299699999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.2848 37.0 37.0 37.0 37.0 37.0 95-99 36.30239999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.2496 37.0 37.0 37.0 37.0 37.0 105-109 36.19000000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.116600000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.162699999999994 37.0 37.0 37.0 37.0 37.0 120-124 36.1684 37.0 37.0 37.0 37.0 37.0 125-129 36.0447 37.0 37.0 37.0 37.0 37.0 130-134 36.0105 37.0 37.0 37.0 37.0 37.0 135-139 35.8846 37.0 37.0 37.0 37.0 37.0 140-144 35.700300000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.6413 37.0 37.0 37.0 37.0 37.0 150-151 35.558 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 0.0 23 0.0 24 2.0 25 4.0 26 3.0 27 5.0 28 9.0 29 8.0 30 23.0 31 28.0 32 40.0 33 65.0 34 120.0 35 316.0 36 2959.0 37 416.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.125 13.100000000000001 5.55 41.225 2 18.104098566758864 13.527784762383707 36.93738999245662 31.430726678400806 3 16.3 17.5 28.249999999999996 37.95 4 20.849999999999998 24.425 24.775 29.95 5 21.15 31.25 25.025 22.575 6 19.525000000000002 36.275 23.7 20.5 7 14.575 27.425 41.05 16.950000000000003 8 17.599999999999998 27.625 30.5 24.275 9 17.175 23.175 35.65 24.0 10-14 19.265 29.95 27.405 23.380000000000003 15-19 19.075 28.549999999999997 28.32 24.055 20-24 19.205 29.09 27.675 24.03 25-29 19.585 28.744999999999997 27.650000000000002 24.02 30-34 19.07 29.715000000000003 26.845000000000002 24.37 35-39 19.465 29.575000000000003 27.66 23.3 40-44 19.45 30.055 27.295 23.200000000000003 45-49 19.155 28.71 27.775 24.36 50-54 19.885 29.060000000000002 27.189999999999998 23.865 55-59 19.634999999999998 28.74 27.805000000000003 23.82 60-64 19.48 28.99 27.705000000000002 23.825 65-69 19.555 29.37 27.284999999999997 23.79 70-74 19.650000000000002 29.635 27.865000000000002 22.85 75-79 19.375 28.865000000000002 27.634999999999998 24.125 80-84 19.48 29.04 27.779999999999998 23.7 85-89 19.64 28.845 27.339999999999996 24.175 90-94 19.405 28.67 28.33 23.595 95-99 19.900000000000002 28.655 27.735 23.71 100-104 19.97 28.455000000000002 27.195000000000004 24.38 105-109 20.06 29.315 26.875 23.75 110-114 19.71 28.99 27.33 23.97 115-119 20.485 28.95 26.76 23.805 120-124 20.599999999999998 28.415000000000003 26.490000000000002 24.495 125-129 20.445 27.875 27.41 24.27 130-134 19.885 28.799999999999997 27.250000000000004 24.065 135-139 20.51 28.71 26.669999999999998 24.11 140-144 20.65 28.99 25.765 24.595 145-149 20.485 28.675 26.215 24.625 150-151 20.837500000000002 28.0875 26.625 24.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.0 24 1.5 25 3.0 26 3.0 27 4.0 28 8.5 29 14.0 30 20.0 31 28.0 32 43.0 33 53.5 34 58.0 35 89.5 36 115.0 37 119.0 38 145.0 39 174.0 40 200.5 41 233.0 42 254.5 43 259.5 44 267.0 45 270.0 46 248.5 47 224.0 48 224.0 49 195.0 50 150.5 51 133.5 52 105.0 53 84.0 54 59.0 55 46.0 56 45.5 57 28.5 58 14.0 59 14.5 60 16.5 61 9.0 62 7.5 63 7.5 64 5.5 65 5.0 66 3.5 67 3.0 68 2.0 69 0.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.9 #Duplication Level Percentage of deduplicated Percentage of total 1 92.05658324265505 84.6 2 7.236126224156692 13.3 3 0.544069640914037 1.5 4 0.1632208922742111 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.7374999999999998 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.175 0.0 0.0 0.0 0.0 108-109 2.4125 0.0 0.0 0.0 0.0 110-111 2.8 0.0 0.0 0.0 0.0 112-113 3.175 0.0 0.0 0.0 0.0 114-115 3.4875 0.0 0.0 0.0 0.0 116-117 4.125 0.0 0.0 0.0 0.0 118-119 4.6 0.0 0.0 0.0 0.0 120-121 5.0 0.0 0.0 0.0 0.0 122-123 5.525 0.0 0.0 0.0 0.0 124-125 5.987500000000001 0.0 0.0 0.0 0.0 126-127 6.45 0.0 0.0 0.0 0.0 128-129 6.824999999999999 0.0 0.0 0.0 0.0 130-131 7.275 0.0 0.0 0.0 0.0 132-133 7.725 0.0 0.0 0.0 0.0 134-135 8.4625 0.0 0.0 0.0 0.0 136-137 9.0125 0.0 0.0 0.0 0.0 138-139 9.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 55 0.0025160722 15.818182 20-24 >>END_MODULE SRR12919351 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919351_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4175 37.0 37.0 37.0 37.0 37.0 2 36.309 37.0 37.0 37.0 37.0 37.0 3 36.396 37.0 37.0 37.0 37.0 37.0 4 36.3835 37.0 37.0 37.0 37.0 37.0 5 36.424 37.0 37.0 37.0 37.0 37.0 6 36.3735 37.0 37.0 37.0 37.0 37.0 7 36.3175 37.0 37.0 37.0 37.0 37.0 8 36.494 37.0 37.0 37.0 37.0 37.0 9 36.415 37.0 37.0 37.0 37.0 37.0 10-14 36.4927 37.0 37.0 37.0 37.0 37.0 15-19 36.4334 37.0 37.0 37.0 37.0 37.0 20-24 36.4503 37.0 37.0 37.0 37.0 37.0 25-29 36.414100000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.3488 37.0 37.0 37.0 37.0 37.0 35-39 36.325100000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.325100000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.2928 37.0 37.0 37.0 37.0 37.0 50-54 36.2829 37.0 37.0 37.0 37.0 37.0 55-59 36.2632 37.0 37.0 37.0 37.0 37.0 60-64 36.2586 37.0 37.0 37.0 37.0 37.0 65-69 36.21130000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.209799999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.189800000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.1455 37.0 37.0 37.0 37.0 37.0 85-89 36.1356 37.0 37.0 37.0 37.0 37.0 90-94 36.0405 37.0 37.0 37.0 37.0 37.0 95-99 36.035900000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.0479 37.0 37.0 37.0 37.0 37.0 105-109 35.9847 37.0 37.0 37.0 37.0 37.0 110-114 35.9588 37.0 37.0 37.0 37.0 37.0 115-119 35.95870000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.8709 37.0 37.0 37.0 37.0 37.0 125-129 35.85809999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.7142 37.0 37.0 37.0 37.0 37.0 135-139 35.5677 37.0 37.0 37.0 37.0 37.0 140-144 35.445100000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.312799999999996 37.0 37.0 37.0 32.2 37.0 150-151 35.195 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 3.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 0.0 21 2.0 22 1.0 23 5.0 24 6.0 25 3.0 26 4.0 27 10.0 28 8.0 29 11.0 30 16.0 31 29.0 32 59.0 33 81.0 34 178.0 35 486.0 36 2744.0 37 352.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.675 26.424999999999997 9.175 26.724999999999998 2 28.449999999999996 27.55 29.925 14.075 3 20.45 27.175 33.1 19.275000000000002 4 23.05 33.875 24.65 18.425 5 24.925 37.225 21.375 16.475 6 23.0 38.15 22.425 16.425 7 20.424999999999997 24.0 37.25 18.325 8 20.724999999999998 25.95 28.499999999999996 24.825 9 20.724999999999998 25.35 32.025 21.9 10-14 24.185000000000002 29.049999999999997 26.484999999999996 20.28 15-19 23.44 28.310000000000002 27.33 20.919999999999998 20-24 23.669999999999998 28.494999999999997 27.689999999999998 20.145 25-29 23.995 28.57 27.625 19.81 30-34 23.315 28.525 28.21 19.950000000000003 35-39 23.64 28.634999999999998 27.66 20.064999999999998 40-44 23.96 27.6 27.61 20.830000000000002 45-49 24.19 28.185 27.529999999999998 20.095 50-54 23.985 28.494999999999997 27.07 20.45 55-59 23.205000000000002 28.68 27.905 20.21 60-64 23.25 28.27 27.939999999999998 20.54 65-69 23.84 27.245 29.01 19.905 70-74 23.885 27.66 28.33 20.125 75-79 23.78 27.715 28.449999999999996 20.055 80-84 23.82 27.88 27.87 20.43 85-89 24.135 27.425 28.035 20.405 90-94 24.295 27.605 28.34 19.759999999999998 95-99 24.125 27.85 27.944999999999997 20.080000000000002 100-104 24.46 27.994999999999997 27.935 19.61 105-109 24.335 28.38 27.639999999999997 19.645000000000003 110-114 24.44 28.055000000000003 28.52 18.985 115-119 24.565 28.285 27.48 19.67 120-124 24.834999999999997 27.815 27.58 19.77 125-129 24.93 27.85 27.544999999999998 19.675 130-134 26.13 28.095 26.729999999999997 19.045 135-139 25.69 28.050000000000004 27.005000000000003 19.255 140-144 26.284999999999997 28.1 27.034999999999997 18.58 145-149 26.63 27.744999999999997 26.779999999999998 18.845 150-151 25.8625 27.737499999999997 27.1625 19.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 2.0 22 2.0 23 1.0 24 1.5 25 1.5 26 3.5 27 5.5 28 6.0 29 7.0 30 9.5 31 17.5 32 25.5 33 38.5 34 52.0 35 62.5 36 96.5 37 129.0 38 147.0 39 174.0 40 200.0 41 223.0 42 252.0 43 275.5 44 288.0 45 282.0 46 277.0 47 251.0 48 220.0 49 200.0 50 155.5 51 130.5 52 108.5 53 75.0 54 54.0 55 49.5 56 44.0 57 30.0 58 21.0 59 14.0 60 12.0 61 10.5 62 7.0 63 7.0 64 5.5 65 3.0 66 3.5 67 3.5 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.25 #Duplication Level Percentage of deduplicated Percentage of total 1 92.41192411924119 85.25 2 6.910569105691057 12.75 3 0.5420054200542005 1.5 4 0.13550135501355012 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.2999999999999998 0.0 0.0 0.0 0.0 100-101 1.5875 0.0 0.0 0.0 0.0 102-103 1.7875 0.0 0.0 0.0 0.0 104-105 1.925 0.0 0.0 0.0 0.0 106-107 2.225 0.0 0.0 0.0 0.0 108-109 2.4625 0.0 0.0 0.0 0.0 110-111 2.85 0.0 0.0 0.0 0.0 112-113 3.2249999999999996 0.0 0.0 0.0 0.0 114-115 3.525 0.0 0.0 0.0 0.0 116-117 4.1625 0.0 0.0 0.0 0.0 118-119 4.625 0.0 0.0 0.0 0.0 120-121 5.025 0.0 0.0 0.0 0.0 122-123 5.550000000000001 0.0 0.0 0.0 0.0 124-125 6.012499999999999 0.0 0.0 0.0 0.0 126-127 6.475 0.0 0.0 0.0 0.0 128-129 6.85 0.0 0.0 0.0 0.0 130-131 7.275 0.0 0.0 0.0 0.0 132-133 7.725 0.0 0.0 0.0 0.0 134-135 8.4625 0.0 0.0 0.0 0.0 136-137 9.0125 0.0 0.0 0.0 0.0 138-139 9.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAAACA 10 0.006830828 145.0 6 >>END_MODULE Read 872514 spots for SRR12919351.sra Written 872514 spots for SRR12919351.sra Read 872514 spots for SRR12919351.sra Written 872514 spots for SRR12919351.sra Read 872514 spots for SRR12919351.sra Written 872514 spots for SRR12919351.sra Read 872514 spots for SRR12919351.sra Written 872514 spots for SRR12919351.sra Read 872514 spots for SRR12919351.sra Written 872514 spots for SRR12919351.sra Read 872514 spots for SRR12919351.sra Written 872514 spots for SRR12919351.sra Read 872514 spots for SRR12919351.sra Written 872514 spots for SRR12919351.sra Read 872514 spots for SRR12919351.sra Written 872514 spots for SRR12919351.sra Read 872514 spots for SRR12919351.sra Written 872514 spots for SRR12919351.sra Read 872514 spots for SRR12919351.sra Written 872514 spots for SRR12919351.sra Read 872514 spots for SRR12919351.sra Written 872514 spots for SRR12919351.sra Read 872514 spots for SRR12919351.sra Written 872514 spots for SRR12919351.sra Read 872514 spots for SRR12919351.sra Written 872514 spots for SRR12919351.sra Read 872514 spots for SRR12919351.sra Written 872514 spots for SRR12919351.sra Read 872514 spots for SRR12919351.sra Written 872514 spots for SRR12919351.sra Read 872514 spots for SRR12919351.sra Written 872514 spots for SRR12919351.sra Read 872514 spots for SRR12919351.sra Written 872514 spots for SRR12919351.sra Read 872514 spots for SRR12919351.sra Written 872514 spots for SRR12919351.sra Read 872520 spots for SRR12919351.sra Written 872520 spots for SRR12919351.sra Read 872514 spots for SRR12919351.sra Written 872514 spots for SRR12919351.sra SRR ids: ['SRR12919351.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_imudicfy SRR12919351.sra spots: 17450286 blocks: [[1, 872514], [872515, 1745028], [1745029, 2617542], [2617543, 3490056], [3490057, 4362570], [4362571, 5235084], [5235085, 6107598], [6107599, 6980112], [6980113, 7852626], [7852627, 8725140], [8725141, 9597654], [9597655, 10470168], [10470169, 11342682], [11342683, 12215196], [12215197, 13087710], [13087711, 13960224], [13960225, 14832738], [14832739, 15705252], [15705253, 16577766], [16577767, 17450286]] SRR12919351 file size 5908670 SRR12919351 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919351 SRR12919351_1.fastq SRR12919351_2.fastq Input file: SRR12919351_1.fastq Paired file: SRR12919351_2.fastq trimmed: SRR12919351-trimmed-pair1.fastq, SRR12919351-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:00:56 2025 >> started Wed Feb 12 20:01:16 2025 >> done (20.006s) 17450286 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 344 ( 0.00%) empty read pairs filtered out after trimming by size control 17449918 (100.00%) read pairs available; of these: 2494231 (14.29%) trimmed read pairs available after processing 14955687 (85.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 1 0.00% 21 4 0.00% 22 4 0.00% 23 3 0.00% 24 6 0.00% 25 7 0.00% 26 5 0.00% 27 3 0.00% 28 11 0.00% 29 1 0.00% 30 5 0.00% 31 7 0.00% 32 7 0.00% 33 11 0.00% 34 14 0.00% 35 16 0.00% 36 12 0.00% 37 13 0.00% 38 18 0.00% 39 13 0.00% 40 20 0.00% 41 15 0.00% 42 28 0.00% 43 24 0.00% 44 27 0.00% 45 40 0.00% 46 28 0.00% 47 35 0.00% 48 45 0.00% 49 49 0.00% 50 75 0.00% 51 58 0.00% 52 81 0.00% 53 100 0.00% 54 103 0.00% 55 144 0.00% 56 114 0.00% 57 141 0.00% 58 162 0.00% 59 229 0.00% 60 259 0.00% 61 330 0.00% 62 355 0.00% 63 395 0.00% 64 434 0.00% 65 493 0.00% 66 579 0.00% 67 619 0.00% 68 697 0.00% 69 820 0.00% 70 1009 0.01% 71 1229 0.01% 72 1392 0.01% 73 1737 0.01% 74 1908 0.01% 75 1920 0.01% 76 2283 0.01% 77 2592 0.01% 78 2827 0.02% 79 3028 0.02% 80 3691 0.02% 81 4229 0.02% 82 4867 0.03% 83 5396 0.03% 84 6010 0.03% 85 6692 0.04% 86 7253 0.04% 87 7805 0.04% 88 8306 0.05% 89 8890 0.05% 90 9865 0.06% 91 10839 0.06% 92 12095 0.07% 93 13323 0.08% 94 14456 0.08% 95 15556 0.09% 96 16425 0.09% 97 17243 0.10% 98 18132 0.10% 99 19024 0.11% 100 19754 0.11% 101 20997 0.12% 102 22211 0.13% 103 23945 0.14% 104 25361 0.15% 105 26677 0.15% 106 27787 0.16% 107 28090 0.16% 108 29088 0.17% 109 29217 0.17% 110 30588 0.18% 111 31870 0.18% 112 33161 0.19% 113 34536 0.20% 114 35491 0.20% 115 37371 0.21% 116 37958 0.22% 117 38718 0.22% 118 39760 0.23% 119 39946 0.23% 120 40811 0.23% 121 40677 0.23% 122 42150 0.24% 123 43724 0.25% 124 44800 0.26% 125 46172 0.26% 126 47528 0.27% 127 47969 0.27% 128 48444 0.28% 129 48468 0.28% 130 49528 0.28% 131 49725 0.28% 132 50935 0.29% 133 52298 0.30% 134 53185 0.30% 135 54295 0.31% 136 54923 0.31% 137 55937 0.32% 138 56359 0.32% 139 57271 0.33% 140 55995 0.32% 141 57247 0.33% 142 57760 0.33% 143 58880 0.34% 144 59599 0.34% 145 60445 0.35% 146 60708 0.35% 147 61502 0.35% 148 62114 0.36% 149 62535 0.36% 150 63036 0.36% 151 14955687 85.71% 17449918 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=5.86 fanout-score-rank=25 prefix-density=0.32 prefix-fanout=3.6 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=454.61 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=35.0 sequence=CTTCTTCTTGAG criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=9.58 fanout-score-rank=21 prefix-density=0.32 prefix-fanout=5.6 sequence=TTTGACAAGAAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=427.88 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=33.6 sequence=AAGAAGAAGAAA SRR12919351 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:02:00 Started mapping on | Feb 12 20:02:00 Finished on | Feb 12 20:04:19 Mapping speed, Million of reads per hour | 451.94 Number of input reads | 17449918 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16054261 Uniquely mapped reads % | 92.00% Average mapped length | 293.27 Number of splices: Total | 13752755 Number of splices: Annotated (sjdb) | 13402853 Number of splices: GT/AG | 13492075 Number of splices: GC/AG | 201359 Number of splices: AT/AC | 14647 Number of splices: Non-canonical | 44674 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.94 Insertion rate per base | 0.03% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431364 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 102111 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.74% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 964293 964293 964293 N_multimapping 431364 431364 431364 N_noFeature 613745 15835987 699003 N_ambiguous 227721 919 94450 UnstrandedReadsAssigned:15212795 PositiveStrandReadsAssigned:217355 NegativeStrandReadsAssigned:15260808 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919351 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919351-trimmed-pair1.fastq SRR12919351-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,449,918 reads, 15,381,588 reads pseudoaligned [quant] estimated average fragment length: 241.649 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52401 SRR12919351.ke.tsv 34699 SRR12919351.se.tsv 87100 total ==> SRR12919351.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.35 528 20.2859 Potri.005G024800.1.v4.1 1035 794.351 217 18.6544 Potri.004G059700.1.v4.1 961 720.417 30 2.84361 Potri.007G009000.2.v4.1 1416 1175.35 0 0 Potri.003G141000.2.v4.1 2943 2702.35 907.517 22.9322 Potri.016G087400.1.v4.1 270 91.2454 1200 898.056 Potri.015G069301.1.v4.1 564 333.487 0 0 Potri.010G195200.1.v4.1 1773 1532.35 64 2.85204 Potri.012G127500.1.v4.1 977 736.382 10110 937.522 ==> SRR12919351.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 48 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 280 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 200 SRR12919351 completed mapping pipeline successfully