Starting /dee2/code/volunteer_pipeline.sh SRR12919353 current disk space = 3050890805248 free memory = 1044601576 SRR12919353 SRAfilesize 7bd96f5d3fb96054cd9c168f565e77b7 SRR12919353.sra SRR12919353.sra file validated SRR12919353 is paired end SRR12919353 is conventional basespace SRR12919353 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919353_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.644 37.0 37.0 37.0 37.0 37.0 2 36.45775 37.0 37.0 37.0 37.0 37.0 3 36.589 37.0 37.0 37.0 37.0 37.0 4 36.6875 37.0 37.0 37.0 37.0 37.0 5 36.68 37.0 37.0 37.0 37.0 37.0 6 36.6675 37.0 37.0 37.0 37.0 37.0 7 36.63 37.0 37.0 37.0 37.0 37.0 8 36.623 37.0 37.0 37.0 37.0 37.0 9 36.625 37.0 37.0 37.0 37.0 37.0 10-14 36.675799999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.654199999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.640499999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.55499999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.545300000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.58540000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.5243 37.0 37.0 37.0 37.0 37.0 45-49 36.4942 37.0 37.0 37.0 37.0 37.0 50-54 36.5136 37.0 37.0 37.0 37.0 37.0 55-59 36.4455 37.0 37.0 37.0 37.0 37.0 60-64 36.4348 37.0 37.0 37.0 37.0 37.0 65-69 36.4281 37.0 37.0 37.0 37.0 37.0 70-74 36.399 37.0 37.0 37.0 37.0 37.0 75-79 36.342200000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.35040000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.2687 37.0 37.0 37.0 37.0 37.0 90-94 36.2651 37.0 37.0 37.0 37.0 37.0 95-99 36.25599999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.244299999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1718 37.0 37.0 37.0 37.0 37.0 110-114 36.109 37.0 37.0 37.0 37.0 37.0 115-119 36.11050000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.103899999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.9929 37.0 37.0 37.0 37.0 37.0 130-134 35.9226 37.0 37.0 37.0 37.0 37.0 135-139 35.8055 37.0 37.0 37.0 37.0 37.0 140-144 35.7091 37.0 37.0 37.0 37.0 37.0 145-149 35.7091 37.0 37.0 37.0 37.0 37.0 150-151 35.578 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 1.0 26 7.0 27 12.0 28 8.0 29 16.0 30 19.0 31 29.0 32 38.0 33 62.0 34 109.0 35 291.0 36 2993.0 37 412.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.275 12.9 3.975 44.85 2 17.607223476297968 11.963882618510159 40.40632054176072 30.02257336343115 3 15.775 15.75 29.825000000000003 38.65 4 20.8 23.3 24.7 31.2 5 23.45 30.7 24.224999999999998 21.625 6 20.875 32.775 23.525 22.825 7 15.2 27.224999999999998 39.800000000000004 17.775 8 16.0 26.625 33.900000000000006 23.474999999999998 9 18.025 23.724999999999998 35.099999999999994 23.150000000000002 10-14 19.935 29.74 27.375 22.95 15-19 19.950000000000003 27.389999999999997 28.205000000000002 24.455 20-24 19.64 28.599999999999998 28.105000000000004 23.655 25-29 19.055 28.73 27.694999999999997 24.52 30-34 19.665 28.29 28.1 23.945 35-39 19.615 29.244999999999997 27.33 23.810000000000002 40-44 20.06 29.34 27.315 23.285 45-49 20.095 28.555000000000003 27.694999999999997 23.655 50-54 20.095 27.96 28.025 23.919999999999998 55-59 20.22 28.15 27.700000000000003 23.93 60-64 20.09 28.525 27.800000000000004 23.585 65-69 20.345 28.689999999999998 27.375 23.59 70-74 20.13 28.07 27.855 23.945 75-79 20.27 28.244999999999997 27.900000000000002 23.585 80-84 19.925 28.439999999999998 27.400000000000002 24.235 85-89 20.205000000000002 28.51 27.445000000000004 23.84 90-94 20.8 28.17 27.765 23.265 95-99 20.315 28.845 27.694999999999997 23.145 100-104 20.415 28.555000000000003 27.255000000000003 23.775 105-109 21.345 27.875 27.04 23.74 110-114 20.625 28.005000000000003 27.565 23.805 115-119 20.785 28.37 26.91 23.935000000000002 120-124 20.25 28.165000000000003 27.38 24.205 125-129 20.815 28.549999999999997 26.715 23.919999999999998 130-134 21.085 28.360000000000003 27.43 23.125 135-139 21.335 28.43 26.91 23.325000000000003 140-144 20.665 28.625 27.08 23.630000000000003 145-149 21.62 28.299999999999997 26.419999999999998 23.66 150-151 21.4125 27.425 26.724999999999998 24.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.5 25 3.5 26 4.5 27 7.0 28 9.5 29 14.5 30 21.5 31 25.5 32 32.5 33 38.0 34 51.0 35 67.5 36 79.5 37 99.5 38 134.5 39 161.5 40 171.0 41 219.5 42 259.0 43 257.5 44 269.0 45 286.5 46 274.0 47 241.5 48 232.0 49 216.5 50 178.5 51 141.5 52 110.5 53 88.0 54 72.5 55 57.0 56 41.5 57 29.0 58 19.0 59 15.5 60 17.0 61 16.0 62 9.0 63 4.5 64 3.5 65 3.5 66 4.0 67 3.5 68 2.5 69 0.5 70 0.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.49427214305672 80.075 2 9.388097233864208 16.8 3 1.0058675607711651 2.7 4 0.08382229673093043 0.3 5 0.02794076557697681 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAACCGTTTCCATATTGACCATAGAATTTGTTTGGATACATCCTATTCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.025 0.0 66-67 0.05 0.0 0.0 0.025 0.0 68-69 0.05 0.0 0.0 0.025 0.0 70-71 0.0625 0.0 0.0 0.025 0.0 72-73 0.0875 0.0 0.0 0.025 0.0 74-75 0.125 0.0 0.0 0.025 0.0 76-77 0.15 0.0 0.0 0.025 0.0 78-79 0.175 0.0 0.0 0.025 0.0 80-81 0.175 0.0 0.0 0.025 0.0 82-83 0.225 0.0 0.0 0.025 0.0 84-85 0.3125 0.0 0.0 0.025 0.0 86-87 0.3625 0.0 0.0 0.025 0.0 88-89 0.4125 0.0 0.0 0.025 0.0 90-91 0.5 0.0 0.0 0.025 0.0 92-93 0.6375 0.0 0.0 0.025 0.0 94-95 0.825 0.0 0.0 0.025 0.0 96-97 0.95 0.0 0.0 0.025 0.0 98-99 1.1875 0.0 0.0 0.025 0.0 100-101 1.4625 0.0 0.0 0.025 0.0 102-103 1.7125 0.0 0.0 0.025 0.0 104-105 1.8625 0.0 0.0 0.025 0.0 106-107 1.9625 0.0 0.0 0.025 0.0 108-109 2.0625 0.0 0.0 0.025 0.0 110-111 2.25 0.0 0.0 0.025 0.0 112-113 2.6125 0.0 0.0 0.025 0.0 114-115 2.875 0.0 0.0 0.025 0.0 116-117 3.425 0.0 0.0 0.025 0.0 118-119 3.775 0.0 0.0 0.025 0.0 120-121 4.1875 0.0 0.0 0.025 0.0 122-123 4.5 0.0 0.0 0.025 0.0 124-125 4.925 0.0 0.0 0.025 0.0 126-127 5.262499999999999 0.0 0.0 0.025 0.0 128-129 5.7125 0.0 0.0 0.025 0.0 130-131 6.262499999999999 0.0 0.0 0.025 0.0 132-133 6.7375 0.0 0.0 0.025 0.0 134-135 7.4375 0.0 0.0 0.025 0.0 136-137 7.862500000000001 0.0 0.0 0.025 0.0 138-139 8.75 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCACGG 10 0.006830828 145.0 4 >>END_MODULE SRR12919353 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919353_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3855 37.0 37.0 37.0 37.0 37.0 2 36.3525 37.0 37.0 37.0 37.0 37.0 3 36.3595 37.0 37.0 37.0 37.0 37.0 4 36.3475 37.0 37.0 37.0 37.0 37.0 5 36.363 37.0 37.0 37.0 37.0 37.0 6 36.3485 37.0 37.0 37.0 37.0 37.0 7 36.355 37.0 37.0 37.0 37.0 37.0 8 36.3845 37.0 37.0 37.0 37.0 37.0 9 36.4985 37.0 37.0 37.0 37.0 37.0 10-14 36.393600000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.3517 37.0 37.0 37.0 37.0 37.0 20-24 36.4303 37.0 37.0 37.0 37.0 37.0 25-29 36.3656 37.0 37.0 37.0 37.0 37.0 30-34 36.3286 37.0 37.0 37.0 37.0 37.0 35-39 36.3097 37.0 37.0 37.0 37.0 37.0 40-44 36.2327 37.0 37.0 37.0 37.0 37.0 45-49 36.2046 37.0 37.0 37.0 37.0 37.0 50-54 36.1924 37.0 37.0 37.0 37.0 37.0 55-59 36.191 37.0 37.0 37.0 37.0 37.0 60-64 36.2001 37.0 37.0 37.0 37.0 37.0 65-69 36.135999999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.1274 37.0 37.0 37.0 37.0 37.0 75-79 36.115300000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.063599999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.0194 37.0 37.0 37.0 37.0 37.0 90-94 35.9857 37.0 37.0 37.0 37.0 37.0 95-99 35.985400000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.85940000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.94540000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.8621 37.0 37.0 37.0 37.0 37.0 115-119 35.8283 37.0 37.0 37.0 37.0 37.0 120-124 35.817600000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.7749 37.0 37.0 37.0 37.0 37.0 130-134 35.667 37.0 37.0 37.0 37.0 37.0 135-139 35.5484 37.0 37.0 37.0 37.0 37.0 140-144 35.5007 37.0 37.0 37.0 37.0 37.0 145-149 35.375299999999996 37.0 37.0 37.0 34.6 37.0 150-151 35.196749999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 0.0 15 2.0 16 1.0 17 0.0 18 0.0 19 2.0 20 1.0 21 2.0 22 2.0 23 4.0 24 4.0 25 8.0 26 11.0 27 7.0 28 7.0 29 17.0 30 27.0 31 32.0 32 42.0 33 78.0 34 187.0 35 479.0 36 2737.0 37 346.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.05 27.150000000000002 6.550000000000001 29.25 2 24.325 28.799999999999997 31.5 15.375 3 18.775 27.425 31.65 22.15 4 21.5 33.975 25.424999999999997 19.1 5 23.95 38.45 22.1 15.5 6 21.099999999999998 39.300000000000004 22.25 17.349999999999998 7 21.25 23.0 37.775 17.974999999999998 8 19.900000000000002 25.650000000000002 29.425 25.025 9 20.974999999999998 23.799999999999997 32.025 23.200000000000003 10-14 23.275000000000002 28.89 26.5 21.335 15-19 23.02 27.67 28.37 20.94 20-24 23.215 28.595 27.01 21.18 25-29 23.580000000000002 27.67 27.365000000000002 21.385 30-34 22.14 27.485 28.235 22.14 35-39 22.8 28.365000000000002 27.625 21.21 40-44 22.935 28.035 28.395 20.635 45-49 23.29 27.689999999999998 27.845 21.175 50-54 23.474999999999998 27.950000000000003 27.47 21.105 55-59 23.705000000000002 27.615000000000002 27.955000000000002 20.724999999999998 60-64 23.82 27.24 28.110000000000003 20.830000000000002 65-69 23.985 27.644999999999996 28.044999999999998 20.325 70-74 23.365 28.27 27.52 20.845 75-79 23.22 27.894999999999996 27.735 21.15 80-84 23.895 27.694999999999997 28.015 20.395 85-89 23.025000000000002 27.68 28.625 20.669999999999998 90-94 23.775 28.315 27.46 20.45 95-99 23.985 27.744999999999997 27.42 20.849999999999998 100-104 23.945 27.88 27.82 20.355 105-109 24.12 27.889999999999997 27.615000000000002 20.375 110-114 24.745 27.665 27.36 20.23 115-119 23.835 28.79 27.134999999999998 20.24 120-124 24.09 28.04 27.405 20.465 125-129 25.365 27.544999999999998 26.76 20.330000000000002 130-134 25.045 27.825 27.534999999999997 19.595000000000002 135-139 24.675 28.71 26.955000000000002 19.66 140-144 25.314999999999998 28.12 26.905 19.66 145-149 25.814999999999998 27.37 27.365000000000002 19.45 150-151 26.3125 26.687499999999996 27.275 19.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 2.0 14 2.0 15 1.5 16 2.0 17 1.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 2.0 25 2.5 26 2.5 27 6.5 28 9.5 29 11.5 30 10.0 31 16.0 32 23.5 33 34.5 34 54.5 35 68.0 36 84.0 37 106.5 38 124.0 39 172.0 40 214.0 41 230.0 42 241.0 43 265.5 44 283.5 45 272.0 46 265.5 47 242.0 48 218.0 49 198.5 50 171.0 51 144.0 52 123.5 53 91.0 54 61.5 55 55.0 56 46.0 57 31.0 58 23.5 59 21.0 60 14.5 61 11.0 62 9.0 63 4.5 64 4.0 65 4.0 66 3.5 67 2.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.55 #Duplication Level Percentage of deduplicated Percentage of total 1 89.55890563930765 80.2 2 9.380234505862646 16.8 3 0.9212730318257957 2.475 4 0.11166945840312675 0.4 5 0.02791736460078169 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0 102-103 1.6875 0.0 0.0 0.0 0.0 104-105 1.8625 0.0 0.0 0.0 0.0 106-107 1.9625 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.275 0.0 0.0 0.0 0.0 112-113 2.6375 0.0 0.0 0.0 0.0 114-115 2.9 0.0 0.0 0.0 0.0 116-117 3.4625 0.0 0.0 0.0 0.0 118-119 3.825 0.0 0.0 0.0 0.0 120-121 4.237500000000001 0.0 0.0 0.0 0.0 122-123 4.55 0.0 0.0 0.0 0.0 124-125 5.0 0.0 0.0 0.0 0.0 126-127 5.362500000000001 0.0 0.0 0.0 0.0 128-129 5.8125 0.0 0.0 0.0 0.0 130-131 6.362500000000001 0.0 0.0 0.0 0.0 132-133 6.8375 0.0 0.0 0.0 0.0 134-135 7.5625 0.0 0.0 0.0 0.0 136-137 8.025 0.0 0.0 0.0 0.0 138-139 8.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGAG 65 0.0076375785 13.384615 140-144 >>END_MODULE Read 733231 spots for SRR12919353.sra Written 733231 spots for SRR12919353.sra Read 733231 spots for SRR12919353.sra Written 733231 spots for SRR12919353.sra Read 733231 spots for SRR12919353.sra Written 733231 spots for SRR12919353.sra Read 733231 spots for SRR12919353.sra Written 733231 spots for SRR12919353.sra Read 733231 spots for SRR12919353.sra Written 733231 spots for SRR12919353.sra Read 733231 spots for SRR12919353.sra Written 733231 spots for SRR12919353.sra Read 733231 spots for SRR12919353.sra Written 733231 spots for SRR12919353.sra Read 733231 spots for SRR12919353.sra Written 733231 spots for SRR12919353.sra Read 733237 spots for SRR12919353.sra Written 733237 spots for SRR12919353.sra Read 733231 spots for SRR12919353.sra Written 733231 spots for SRR12919353.sra Read 733231 spots for SRR12919353.sra Written 733231 spots for SRR12919353.sra Read 733231 spots for SRR12919353.sra Written 733231 spots for SRR12919353.sra Read 733231 spots for SRR12919353.sra Written 733231 spots for SRR12919353.sra Read 733231 spots for SRR12919353.sra Written 733231 spots for SRR12919353.sra Read 733231 spots for SRR12919353.sra Written 733231 spots for SRR12919353.sra Read 733231 spots for SRR12919353.sra Written 733231 spots for SRR12919353.sra Read 733231 spots for SRR12919353.sra Written 733231 spots for SRR12919353.sra Read 733231 spots for SRR12919353.sra Written 733231 spots for SRR12919353.sra Read 733231 spots for SRR12919353.sra Written 733231 spots for SRR12919353.sra Read 733231 spots for SRR12919353.sra Written 733231 spots for SRR12919353.sra SRR ids: ['SRR12919353.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3yesz28_ SRR12919353.sra spots: 14664626 blocks: [[1, 733231], [733232, 1466462], [1466463, 2199693], [2199694, 2932924], [2932925, 3666155], [3666156, 4399386], [4399387, 5132617], [5132618, 5865848], [5865849, 6599079], [6599080, 7332310], [7332311, 8065541], [8065542, 8798772], [8798773, 9532003], [9532004, 10265234], [10265235, 10998465], [10998466, 11731696], [11731697, 12464927], [12464928, 13198158], [13198159, 13931389], [13931390, 14664626]] SRR12919353 file size 4961981 SRR12919353 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919353 SRR12919353_1.fastq SRR12919353_2.fastq Input file: SRR12919353_1.fastq Paired file: SRR12919353_2.fastq trimmed: SRR12919353-trimmed-pair1.fastq, SRR12919353-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:47:28 2025 >> started Wed Feb 12 19:47:48 2025 >> done (19.129s) 14664626 read pairs processed; of these: 29 ( 0.00%) short read pairs filtered out after trimming by size control 75 ( 0.00%) empty read pairs filtered out after trimming by size control 14664522 (100.00%) read pairs available; of these: 1840416 (12.55%) trimmed read pairs available after processing 12824106 (87.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 2 0.00% 21 5 0.00% 22 1 0.00% 23 5 0.00% 24 8 0.00% 25 6 0.00% 26 9 0.00% 27 7 0.00% 28 6 0.00% 29 8 0.00% 30 11 0.00% 31 7 0.00% 32 10 0.00% 33 4 0.00% 34 10 0.00% 35 17 0.00% 36 18 0.00% 37 12 0.00% 38 18 0.00% 39 16 0.00% 40 20 0.00% 41 17 0.00% 42 14 0.00% 43 13 0.00% 44 17 0.00% 45 24 0.00% 46 16 0.00% 47 29 0.00% 48 25 0.00% 49 44 0.00% 50 36 0.00% 51 51 0.00% 52 53 0.00% 53 68 0.00% 54 58 0.00% 55 66 0.00% 56 74 0.00% 57 86 0.00% 58 101 0.00% 59 114 0.00% 60 133 0.00% 61 161 0.00% 62 209 0.00% 63 207 0.00% 64 241 0.00% 65 262 0.00% 66 302 0.00% 67 329 0.00% 68 352 0.00% 69 447 0.00% 70 545 0.00% 71 648 0.00% 72 771 0.01% 73 839 0.01% 74 945 0.01% 75 1067 0.01% 76 1180 0.01% 77 1348 0.01% 78 1570 0.01% 79 1728 0.01% 80 1993 0.01% 81 2314 0.02% 82 2669 0.02% 83 2975 0.02% 84 3290 0.02% 85 3801 0.03% 86 4069 0.03% 87 4521 0.03% 88 4646 0.03% 89 5302 0.04% 90 5784 0.04% 91 6438 0.04% 92 7190 0.05% 93 8011 0.05% 94 8675 0.06% 95 9487 0.06% 96 9968 0.07% 97 10770 0.07% 98 11052 0.08% 99 11936 0.08% 100 12590 0.09% 101 13355 0.09% 102 14489 0.10% 103 15634 0.11% 104 16689 0.11% 105 17509 0.12% 106 18379 0.13% 107 19061 0.13% 108 19882 0.14% 109 20666 0.14% 110 20650 0.14% 111 21932 0.15% 112 22930 0.16% 113 24131 0.16% 114 25375 0.17% 115 26485 0.18% 116 26966 0.18% 117 27896 0.19% 118 28366 0.19% 119 29083 0.20% 120 29891 0.20% 121 30416 0.21% 122 31310 0.21% 123 32395 0.22% 124 33499 0.23% 125 34252 0.23% 126 35662 0.24% 127 36655 0.25% 128 36260 0.25% 129 36731 0.25% 130 37911 0.26% 131 38312 0.26% 132 38921 0.27% 133 39768 0.27% 134 41013 0.28% 135 42306 0.29% 136 42778 0.29% 137 43335 0.30% 138 44235 0.30% 139 44331 0.30% 140 44671 0.30% 141 45144 0.31% 142 46110 0.31% 143 46992 0.32% 144 47669 0.33% 145 48818 0.33% 146 49019 0.33% 147 49324 0.34% 148 50130 0.34% 149 50014 0.34% 150 51184 0.35% 151 12824106 87.45% 14664522 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=8.07 fanout-score-rank=15 prefix-density=0.29 prefix-fanout=4.1 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=115.07 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=17.5 sequence=TCATCACCAACA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=33 prefix-density=0.19 prefix-fanout=2.5 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=496.13 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=9.9 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAA SRR12919353 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:48:42 Started mapping on | Feb 12 19:48:42 Finished on | Feb 12 19:51:02 Mapping speed, Million of reads per hour | 377.09 Number of input reads | 14664522 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13440340 Uniquely mapped reads % | 91.65% Average mapped length | 294.68 Number of splices: Total | 12543251 Number of splices: Annotated (sjdb) | 12265840 Number of splices: GT/AG | 12314034 Number of splices: GC/AG | 183503 Number of splices: AT/AC | 10844 Number of splices: Non-canonical | 34870 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.09 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 373072 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 33066 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.47% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 851110 851110 851110 N_multimapping 373072 373072 373072 N_noFeature 538960 13268203 611586 N_ambiguous 176852 1074 76662 UnstrandedReadsAssigned:12724528 PositiveStrandReadsAssigned:171063 NegativeStrandReadsAssigned:12752092 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919353 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919353-trimmed-pair1.fastq SRR12919353-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,664,522 reads, 12,819,364 reads pseudoaligned [quant] estimated average fragment length: 249.268 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR12919353.ke.tsv 34699 SRR12919353.se.tsv 87100 total ==> SRR12919353.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.73 469 22.1591 Potri.005G024800.1.v4.1 1035 786.732 166 17.6429 Potri.004G059700.1.v4.1 961 712.851 37 4.34001 Potri.007G009000.2.v4.1 1416 1167.73 0 0 Potri.003G141000.2.v4.1 2943 2694.73 678.232 21.0451 Potri.016G087400.1.v4.1 270 87.6848 1246.12 1188.29 Potri.015G069301.1.v4.1 564 328.202 0 0 Potri.010G195200.1.v4.1 1773 1524.73 90 4.93556 Potri.012G127500.1.v4.1 977 728.792 6424 737.037 ==> SRR12919353.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 123 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 241 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 20 SRR12919353 completed mapping pipeline successfully