Starting /dee2/code/volunteer_pipeline.sh SRR12919354 current disk space = 3050838777856 free memory = 1468175048 SRR12919354 SRAfilesize a8a38df19c80da605b13e8eb0eab91c0 SRR12919354.sra SRR12919354.sra file validated SRR12919354 is paired end SRR12919354 is conventional basespace SRR12919354 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919354_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5395 37.0 37.0 37.0 37.0 37.0 2 36.35025 37.0 37.0 37.0 37.0 37.0 3 36.644 37.0 37.0 37.0 37.0 37.0 4 36.685 37.0 37.0 37.0 37.0 37.0 5 36.75 37.0 37.0 37.0 37.0 37.0 6 36.726 37.0 37.0 37.0 37.0 37.0 7 36.643 37.0 37.0 37.0 37.0 37.0 8 36.747 37.0 37.0 37.0 37.0 37.0 9 36.644 37.0 37.0 37.0 37.0 37.0 10-14 36.6966 37.0 37.0 37.0 37.0 37.0 15-19 36.665800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.613 37.0 37.0 37.0 37.0 37.0 25-29 36.5703 37.0 37.0 37.0 37.0 37.0 30-34 36.518600000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.5221 37.0 37.0 37.0 37.0 37.0 40-44 36.5239 37.0 37.0 37.0 37.0 37.0 45-49 36.4837 37.0 37.0 37.0 37.0 37.0 50-54 36.5163 37.0 37.0 37.0 37.0 37.0 55-59 36.4359 37.0 37.0 37.0 37.0 37.0 60-64 36.351600000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.36639999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.3829 37.0 37.0 37.0 37.0 37.0 75-79 36.318799999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.276399999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.212 37.0 37.0 37.0 37.0 37.0 90-94 36.2405 37.0 37.0 37.0 37.0 37.0 95-99 36.2555 37.0 37.0 37.0 37.0 37.0 100-104 36.234 37.0 37.0 37.0 37.0 37.0 105-109 36.116400000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.0946 37.0 37.0 37.0 37.0 37.0 115-119 36.1576 37.0 37.0 37.0 37.0 37.0 120-124 36.087599999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.009699999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.9548 37.0 37.0 37.0 37.0 37.0 135-139 35.9357 37.0 37.0 37.0 37.0 37.0 140-144 35.782199999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.77239999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.57575 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 2.0 23 3.0 24 3.0 25 2.0 26 1.0 27 3.0 28 13.0 29 13.0 30 16.0 31 25.0 32 37.0 33 55.0 34 123.0 35 334.0 36 3006.0 37 362.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.325 11.924999999999999 7.75 45.0 2 17.82750817198894 13.452351018355543 37.993462408850895 30.726678400804623 3 17.275 17.75 29.725 35.25 4 21.675 24.6 24.625 29.099999999999998 5 22.525000000000002 32.6 23.625 21.25 6 19.3 35.725 25.15 19.825 7 15.174999999999999 26.825 41.175 16.825000000000003 8 16.175 27.525 32.225 24.075 9 17.474999999999998 21.95 36.199999999999996 24.375 10-14 19.325 30.009999999999998 27.52 23.145 15-19 19.105 28.785 27.500000000000004 24.610000000000003 20-24 19.625 28.439999999999998 27.944999999999997 23.990000000000002 25-29 19.634999999999998 28.389999999999997 27.91 24.065 30-34 18.915000000000003 28.46 28.345 24.279999999999998 35-39 19.41 28.610000000000003 28.185 23.794999999999998 40-44 18.64 29.595 27.965 23.799999999999997 45-49 19.99 28.52 27.650000000000002 23.84 50-54 19.835 28.689999999999998 27.36 24.115000000000002 55-59 19.435 28.375 28.000000000000004 24.19 60-64 19.29 28.904999999999998 27.935 23.87 65-69 19.555 28.53 28.035 23.880000000000003 70-74 19.865 28.705000000000002 27.33 24.099999999999998 75-79 19.39 28.95 27.85 23.810000000000002 80-84 19.715 27.994999999999997 27.92 24.37 85-89 19.585 29.26 27.615000000000002 23.54 90-94 19.735 28.939999999999998 27.985 23.34 95-99 19.945 28.13 27.944999999999997 23.98 100-104 20.244999999999997 28.4 28.175 23.18 105-109 20.385 28.52 26.889999999999997 24.205 110-114 20.52 28.105000000000004 27.415 23.96 115-119 20.535 28.475 27.474999999999998 23.515 120-124 20.815 28.485 26.855 23.845 125-129 20.979999999999997 27.905 27.46 23.655 130-134 20.625 28.79 27.515 23.07 135-139 20.905 28.015 27.48 23.599999999999998 140-144 19.900000000000002 28.199999999999996 27.279999999999998 24.62 145-149 20.580000000000002 28.035 27.51 23.875 150-151 20.5125 28.3875 27.85 23.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.0 23 1.0 24 1.5 25 3.5 26 4.5 27 5.5 28 10.0 29 16.0 30 22.5 31 29.5 32 30.0 33 42.0 34 58.5 35 75.0 36 98.5 37 113.5 38 142.0 39 181.0 40 207.5 41 234.0 42 244.0 43 254.0 44 276.5 45 274.0 46 258.0 47 239.0 48 217.0 49 195.5 50 161.0 51 126.5 52 112.5 53 91.0 54 62.0 55 50.0 56 42.5 57 27.5 58 21.5 59 17.0 60 11.0 61 9.5 62 5.5 63 5.5 64 5.0 65 3.0 66 2.5 67 1.5 68 1.5 69 1.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.025 #Duplication Level Percentage of deduplicated Percentage of total 1 91.29360065915957 83.1 2 7.662730019225488 13.950000000000001 3 0.9338093930238945 2.55 4 0.10985992859104642 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.9625 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.1875 0.0 0.0 0.0 0.0 116-117 2.5125 0.0 0.0 0.0 0.0 118-119 2.9125 0.0 0.0 0.0 0.0 120-121 3.3125 0.0 0.0 0.0 0.0 122-123 3.7375 0.0 0.0 0.0 0.0 124-125 3.9625 0.0 0.0 0.0 0.0 126-127 4.362500000000001 0.0 0.0 0.0 0.0 128-129 4.8875 0.0 0.0 0.0 0.0 130-131 5.375 0.0 0.0 0.0 0.0 132-133 5.699999999999999 0.0 0.0 0.0 0.0 134-135 6.1875 0.0 0.0 0.0 0.0 136-137 6.6625 0.0 0.0 0.0 0.0 138-139 7.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGTGGC 10 0.006830828 145.0 9 ATCTAAA 10 0.006830828 145.0 6 CCTCATC 10 0.006830828 145.0 1 >>END_MODULE SRR12919354 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919354_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.232 37.0 37.0 37.0 37.0 37.0 2 36.3025 37.0 37.0 37.0 37.0 37.0 3 36.332 37.0 37.0 37.0 37.0 37.0 4 36.3755 37.0 37.0 37.0 37.0 37.0 5 36.4405 37.0 37.0 37.0 37.0 37.0 6 36.469 37.0 37.0 37.0 37.0 37.0 7 36.377 37.0 37.0 37.0 37.0 37.0 8 36.436 37.0 37.0 37.0 37.0 37.0 9 36.447 37.0 37.0 37.0 37.0 37.0 10-14 36.4617 37.0 37.0 37.0 37.0 37.0 15-19 36.4302 37.0 37.0 37.0 37.0 37.0 20-24 36.4193 37.0 37.0 37.0 37.0 37.0 25-29 36.379999999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.2486 37.0 37.0 37.0 37.0 37.0 35-39 36.2637 37.0 37.0 37.0 37.0 37.0 40-44 36.298899999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.2693 37.0 37.0 37.0 37.0 37.0 50-54 36.1996 37.0 37.0 37.0 37.0 37.0 55-59 36.197500000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.2286 37.0 37.0 37.0 37.0 37.0 65-69 36.1431 37.0 37.0 37.0 37.0 37.0 70-74 36.13870000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.0789 37.0 37.0 37.0 37.0 37.0 80-84 36.0094 37.0 37.0 37.0 37.0 37.0 85-89 36.0519 37.0 37.0 37.0 37.0 37.0 90-94 36.0008 37.0 37.0 37.0 37.0 37.0 95-99 35.9613 37.0 37.0 37.0 37.0 37.0 100-104 35.9174 37.0 37.0 37.0 37.0 37.0 105-109 35.9409 37.0 37.0 37.0 37.0 37.0 110-114 35.907 37.0 37.0 37.0 37.0 37.0 115-119 35.8583 37.0 37.0 37.0 37.0 37.0 120-124 35.78509999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.7351 37.0 37.0 37.0 37.0 37.0 130-134 35.6727 37.0 37.0 37.0 37.0 37.0 135-139 35.601600000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.533 37.0 37.0 37.0 37.0 37.0 145-149 35.38099999999999 37.0 37.0 37.0 34.6 37.0 150-151 35.15675 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 1.0 15 1.0 16 2.0 17 1.0 18 2.0 19 2.0 20 0.0 21 2.0 22 2.0 23 3.0 24 3.0 25 7.0 26 6.0 27 9.0 28 14.0 29 15.0 30 21.0 31 34.0 32 46.0 33 82.0 34 149.0 35 523.0 36 2759.0 37 313.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.175000000000004 22.375 11.075 29.375 2 26.674999999999997 26.525 31.775 15.024999999999999 3 19.5 27.650000000000002 33.375 19.475 4 22.35 33.925 25.4 18.325 5 24.25 36.75 22.525000000000002 16.475 6 22.85 38.6 22.725 15.825 7 20.849999999999998 21.875 39.025 18.25 8 21.425 25.424999999999997 29.225 23.925 9 21.475 26.6 30.425 21.5 10-14 23.244999999999997 29.54 26.290000000000003 20.925 15-19 23.195 27.755000000000003 28.64 20.41 20-24 23.365 27.529999999999998 28.335 20.77 25-29 23.375 28.71 27.525 20.39 30-34 22.91 27.915 27.894999999999996 21.279999999999998 35-39 23.0 28.93 27.525 20.544999999999998 40-44 22.814999999999998 28.18 28.715000000000003 20.29 45-49 23.405 28.155 28.315 20.125 50-54 23.145 28.67 28.134999999999998 20.05 55-59 23.335 28.095 28.165000000000003 20.405 60-64 23.13 28.810000000000002 28.299999999999997 19.759999999999998 65-69 24.015 28.389999999999997 27.125 20.47 70-74 22.939999999999998 28.23 28.235 20.595 75-79 23.345 28.1 28.425 20.13 80-84 23.825 26.99 28.194999999999997 20.990000000000002 85-89 23.31 27.705000000000002 28.49 20.495 90-94 23.62 27.775 28.139999999999997 20.465 95-99 23.39 27.555000000000003 28.205000000000002 20.849999999999998 100-104 24.145 27.939999999999998 27.834999999999997 20.080000000000002 105-109 23.849999999999998 27.92 28.144999999999996 20.085 110-114 23.705000000000002 27.950000000000003 28.12 20.225 115-119 23.79 28.939999999999998 27.665 19.605 120-124 23.669999999999998 28.405 27.715 20.21 125-129 24.85 28.345 27.310000000000002 19.495 130-134 25.27 28.28 26.779999999999998 19.67 135-139 25.169999999999998 27.615000000000002 27.800000000000004 19.415 140-144 25.515 28.025 26.840000000000003 19.62 145-149 26.71 27.334999999999997 27.150000000000002 18.805 150-151 26.474999999999998 27.55 26.887499999999996 19.0875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 1.5 21 3.0 22 3.0 23 2.0 24 3.5 25 4.0 26 4.5 27 8.0 28 6.0 29 8.5 30 15.0 31 25.5 32 35.0 33 43.5 34 57.0 35 74.5 36 95.0 37 120.5 38 157.0 39 183.5 40 194.5 41 224.0 42 241.0 43 251.5 44 281.0 45 286.5 46 265.5 47 236.0 48 220.5 49 193.5 50 158.5 51 131.5 52 108.0 53 80.5 54 58.0 55 51.5 56 38.5 57 24.5 58 17.0 59 17.0 60 17.5 61 11.5 62 8.0 63 7.5 64 6.0 65 6.0 66 3.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.47010422380691 83.375 2 7.4602303894679105 13.600000000000001 3 0.9599561162918266 2.625 4 0.10970927043335163 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.6000000000000001 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 0.9874999999999999 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 1.8624999999999998 0.0 0.0 0.0 0.0 112-113 1.9875 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.5374999999999996 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.3125 0.0 0.0 0.0 0.0 122-123 3.7125 0.0 0.0 0.0 0.0 124-125 3.95 0.0 0.0 0.0 0.0 126-127 4.362500000000001 0.0 0.0 0.0 0.0 128-129 4.8875 0.0 0.0 0.0 0.0 130-131 5.387499999999999 0.0 0.0 0.0 0.0 132-133 5.725 0.0 0.0 0.0 0.0 134-135 6.2125 0.0 0.0 0.0 0.0 136-137 6.6875 0.0 0.0 0.0 0.0 138-139 7.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAAAC 10 0.006830828 145.0 6 >>END_MODULE Read 752953 spots for SRR12919354.sra Written 752953 spots for SRR12919354.sra Read 752953 spots for SRR12919354.sra Written 752953 spots for SRR12919354.sra Read 752953 spots for SRR12919354.sra Written 752953 spots for SRR12919354.sra Read 752953 spots for SRR12919354.sra Written 752953 spots for SRR12919354.sra Read 752953 spots for SRR12919354.sra Written 752953 spots for SRR12919354.sra Read 752953 spots for SRR12919354.sra Written 752953 spots for SRR12919354.sra Read 752953 spots for SRR12919354.sra Written 752953 spots for SRR12919354.sra Read 752953 spots for SRR12919354.sra Written 752953 spots for SRR12919354.sra Read 752953 spots for SRR12919354.sra Written 752953 spots for SRR12919354.sra Read 752953 spots for SRR12919354.sra Written 752953 spots for SRR12919354.sra Read 752953 spots for SRR12919354.sra Written 752953 spots for SRR12919354.sra Read 752953 spots for SRR12919354.sra Written 752953 spots for SRR12919354.sra Read 752953 spots for SRR12919354.sra Written 752953 spots for SRR12919354.sra Read 752953 spots for SRR12919354.sra Written 752953 spots for SRR12919354.sra Read 752953 spots for SRR12919354.sra Written 752953 spots for SRR12919354.sra Read 752953 spots for SRR12919354.sra Written 752953 spots for SRR12919354.sra Read 752965 spots for SRR12919354.sra Written 752965 spots for SRR12919354.sra Read 752953 spots for SRR12919354.sra Written 752953 spots for SRR12919354.sra Read 752953 spots for SRR12919354.sra Written 752953 spots for SRR12919354.sra Read 752953 spots for SRR12919354.sra Written 752953 spots for SRR12919354.sra SRR ids: ['SRR12919354.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_okbtgllb SRR12919354.sra spots: 15059072 blocks: [[1, 752953], [752954, 1505906], [1505907, 2258859], [2258860, 3011812], [3011813, 3764765], [3764766, 4517718], [4517719, 5270671], [5270672, 6023624], [6023625, 6776577], [6776578, 7529530], [7529531, 8282483], [8282484, 9035436], [9035437, 9788389], [9788390, 10541342], [10541343, 11294295], [11294296, 12047248], [12047249, 12800201], [12800202, 13553154], [13553155, 14306107], [14306108, 15059072]] SRR12919354 file size 5096031 SRR12919354 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919354 SRR12919354_1.fastq SRR12919354_2.fastq Input file: SRR12919354_1.fastq Paired file: SRR12919354_2.fastq trimmed: SRR12919354-trimmed-pair1.fastq, SRR12919354-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:55:58 2025 >> started Wed Feb 12 19:56:16 2025 >> done (17.617s) 15059072 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 302 ( 0.00%) empty read pairs filtered out after trimming by size control 15058746 (100.00%) read pairs available; of these: 1547933 (10.28%) trimmed read pairs available after processing 13510813 (89.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 4 0.00% 21 3 0.00% 22 1 0.00% 23 2 0.00% 24 2 0.00% 25 2 0.00% 26 5 0.00% 27 10 0.00% 28 9 0.00% 29 8 0.00% 30 12 0.00% 31 8 0.00% 32 8 0.00% 33 9 0.00% 34 10 0.00% 35 9 0.00% 36 18 0.00% 37 13 0.00% 38 13 0.00% 39 20 0.00% 40 17 0.00% 41 14 0.00% 42 18 0.00% 43 21 0.00% 44 13 0.00% 45 26 0.00% 46 21 0.00% 47 29 0.00% 48 26 0.00% 49 40 0.00% 50 46 0.00% 51 48 0.00% 52 47 0.00% 53 69 0.00% 54 61 0.00% 55 71 0.00% 56 87 0.00% 57 72 0.00% 58 97 0.00% 59 99 0.00% 60 134 0.00% 61 151 0.00% 62 212 0.00% 63 184 0.00% 64 212 0.00% 65 242 0.00% 66 275 0.00% 67 292 0.00% 68 313 0.00% 69 396 0.00% 70 537 0.00% 71 555 0.00% 72 691 0.00% 73 756 0.01% 74 862 0.01% 75 1002 0.01% 76 1090 0.01% 77 1163 0.01% 78 1251 0.01% 79 1489 0.01% 80 1600 0.01% 81 1982 0.01% 82 2346 0.02% 83 2672 0.02% 84 2964 0.02% 85 3426 0.02% 86 3372 0.02% 87 3878 0.03% 88 4179 0.03% 89 4485 0.03% 90 4816 0.03% 91 5583 0.04% 92 6190 0.04% 93 6924 0.05% 94 7577 0.05% 95 7993 0.05% 96 8677 0.06% 97 9136 0.06% 98 9488 0.06% 99 10149 0.07% 100 10780 0.07% 101 11472 0.08% 102 12561 0.08% 103 13321 0.09% 104 14067 0.09% 105 15095 0.10% 106 15645 0.10% 107 15969 0.11% 108 16323 0.11% 109 17037 0.11% 110 17609 0.12% 111 18491 0.12% 112 19417 0.13% 113 20265 0.13% 114 21222 0.14% 115 22373 0.15% 116 22987 0.15% 117 23246 0.15% 118 23538 0.16% 119 24301 0.16% 120 24689 0.16% 121 25198 0.17% 122 25954 0.17% 123 27251 0.18% 124 28229 0.19% 125 29154 0.19% 126 29950 0.20% 127 30248 0.20% 128 30703 0.20% 129 30427 0.20% 130 30879 0.21% 131 31762 0.21% 132 32689 0.22% 133 33706 0.22% 134 34138 0.23% 135 35734 0.24% 136 36190 0.24% 137 36036 0.24% 138 37000 0.25% 139 37397 0.25% 140 36929 0.25% 141 37778 0.25% 142 38589 0.26% 143 39173 0.26% 144 39764 0.26% 145 40907 0.27% 146 41242 0.27% 147 42272 0.28% 148 42774 0.28% 149 42042 0.28% 150 43069 0.29% 151 13510813 89.72% 15058746 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=5.96 fanout-score-rank=28 prefix-density=0.20 prefix-fanout=3.7 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=475.78 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=36.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=14.91 fanout-score-rank=16 prefix-density=0.28 prefix-fanout=7.3 sequence=TTTGACAAGAAGCAGTTTCTTACACAGATTAAGAAATTTATCAAGAATCTGTCGGAGAAACTTGATGAGGACCAGAAGGAACATTTTAGAAAGAACATTGAGGGAGCAACCAAGTTCTTGCTTTCAAAAATCAAGGACTTGCAATTCTTTGTGGGGGAGAGCATGCATGATGATGGTTGTTTGGTCTTTGCTTATTACAAAGAAGGTGCTACCGATCCAACATTCTTGTACTTTGCCCCTTCTTTGAAGGAGGTCAAGTGCTGAAGAGTGCCAATAGCTGGCCTTGATGTGCAAGTGCTAGCTTTATTAGTTTTAGTTTTATCCTTGAATGCTTTGCTATCTTTTGTTCTGGTGGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=820.30 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=16.7 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAACTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACAATGTGCTGGTTATCAGTGGAGAGAGGAAGCGCGGAGAGGAGAAAGAAGGGGCCAAGTATGTGAGAATGGAAAGGAGGGTTGGTAAGTTTATGAGGAAGTTTGTGTTGCCTGAGAATGCTAACACTGACGCTATTTCTGCTGTTTGTCAAGATGGGGTTCTGACTGTTACTGTTGAGAAATTACCACCTCCTGAGCCTAAGAAGCCTAAGACTATCG SRR12919354 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:56:57 Started mapping on | Feb 12 19:56:57 Finished on | Feb 12 19:58:51 Mapping speed, Million of reads per hour | 475.54 Number of input reads | 15058746 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14053741 Uniquely mapped reads % | 93.33% Average mapped length | 295.73 Number of splices: Total | 13160505 Number of splices: Annotated (sjdb) | 12840852 Number of splices: GT/AG | 12916391 Number of splices: GC/AG | 192847 Number of splices: AT/AC | 13678 Number of splices: Non-canonical | 37589 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.01 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 359723 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 33021 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.96% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 645282 645282 645282 N_multimapping 359723 359723 359723 N_noFeature 592638 13884388 667641 N_ambiguous 178320 730 83707 UnstrandedReadsAssigned:13282783 PositiveStrandReadsAssigned:168623 NegativeStrandReadsAssigned:13302393 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919354 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919354-trimmed-pair1.fastq SRR12919354-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,058,746 reads, 13,344,680 reads pseudoaligned [quant] estimated average fragment length: 265.776 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,040 rounds 52401 SRR12919354.ke.tsv 34699 SRR12919354.se.tsv 87100 total ==> SRR12919354.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.22 456 22.1631 Potri.005G024800.1.v4.1 1035 770.224 131 14.493 Potri.004G059700.1.v4.1 961 696.442 42 5.13886 Potri.007G009000.2.v4.1 1416 1151.22 1 0.0740189 Potri.003G141000.2.v4.1 2943 2678.22 741 23.5762 Potri.016G087400.1.v4.1 270 84.9227 1019 1022.48 Potri.015G069301.1.v4.1 564 315.749 0 0 Potri.010G195200.1.v4.1 1773 1508.22 88 4.97187 Potri.012G127500.1.v4.1 977 712.32 4996 597.654 ==> SRR12919354.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 212 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 220 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 25 SRR12919354 completed mapping pipeline successfully