Starting /dee2/code/volunteer_pipeline.sh SRR12919355 current disk space = 3050904514560 free memory = 1580289384 SRR12919355 SRAfilesize 941ebb5a4bd1f2187e2db47f9188739d SRR12919355.sra SRR12919355.sra file validated SRR12919355 is paired end SRR12919355 is conventional basespace SRR12919355 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919355_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.588 37.0 37.0 37.0 37.0 37.0 2 36.36625 37.0 37.0 37.0 37.0 37.0 3 36.636 37.0 37.0 37.0 37.0 37.0 4 36.6705 37.0 37.0 37.0 37.0 37.0 5 36.753 37.0 37.0 37.0 37.0 37.0 6 36.662 37.0 37.0 37.0 37.0 37.0 7 36.673 37.0 37.0 37.0 37.0 37.0 8 36.717 37.0 37.0 37.0 37.0 37.0 9 36.7015 37.0 37.0 37.0 37.0 37.0 10-14 36.7143 37.0 37.0 37.0 37.0 37.0 15-19 36.660000000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.689 37.0 37.0 37.0 37.0 37.0 25-29 36.602000000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.6014 37.0 37.0 37.0 37.0 37.0 35-39 36.55200000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.525099999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.5333 37.0 37.0 37.0 37.0 37.0 50-54 36.5138 37.0 37.0 37.0 37.0 37.0 55-59 36.530800000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.45570000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.4413 37.0 37.0 37.0 37.0 37.0 70-74 36.4256 37.0 37.0 37.0 37.0 37.0 75-79 36.3803 37.0 37.0 37.0 37.0 37.0 80-84 36.4016 37.0 37.0 37.0 37.0 37.0 85-89 36.3043 37.0 37.0 37.0 37.0 37.0 90-94 36.305 37.0 37.0 37.0 37.0 37.0 95-99 36.3129 37.0 37.0 37.0 37.0 37.0 100-104 36.2693 37.0 37.0 37.0 37.0 37.0 105-109 36.2535 37.0 37.0 37.0 37.0 37.0 110-114 36.2293 37.0 37.0 37.0 37.0 37.0 115-119 36.1267 37.0 37.0 37.0 37.0 37.0 120-124 36.1438 37.0 37.0 37.0 37.0 37.0 125-129 36.0072 37.0 37.0 37.0 37.0 37.0 130-134 36.0224 37.0 37.0 37.0 37.0 37.0 135-139 35.9731 37.0 37.0 37.0 37.0 37.0 140-144 35.9016 37.0 37.0 37.0 37.0 37.0 145-149 35.928599999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.762249999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 1.0 24 2.0 25 0.0 26 1.0 27 10.0 28 5.0 29 16.0 30 20.0 31 15.0 32 40.0 33 52.0 34 110.0 35 297.0 36 2976.0 37 454.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.75 13.325000000000001 4.875 41.05 2 17.66926755600302 13.591744273848477 37.60382582431412 31.135162345834384 3 17.299999999999997 17.325 28.000000000000004 37.375 4 21.025 24.65 23.200000000000003 31.125000000000004 5 21.099999999999998 31.3 25.124999999999996 22.475 6 19.75 34.5 25.45 20.3 7 14.05 27.3 41.175 17.474999999999998 8 16.950000000000003 26.150000000000002 33.25 23.65 9 16.35 23.599999999999998 36.35 23.7 10-14 19.465 29.635 28.835 22.065 15-19 19.615 28.7 28.52 23.165 20-24 19.41 28.945 28.305000000000003 23.34 25-29 18.795 29.335 27.555000000000003 24.315 30-34 19.79 28.555000000000003 27.79 23.865 35-39 19.314999999999998 28.73 28.110000000000003 23.845 40-44 19.6 29.235 27.845 23.32 45-49 19.165 28.865000000000002 27.310000000000002 24.66 50-54 18.915000000000003 29.505 27.834999999999997 23.745 55-59 19.759999999999998 28.965000000000003 27.405 23.87 60-64 19.134999999999998 28.410000000000004 28.42 24.035 65-69 19.34 29.28 27.92 23.46 70-74 19.6 29.060000000000002 27.439999999999998 23.9 75-79 19.915 28.49 27.634999999999998 23.96 80-84 19.825 28.655 27.415 24.104999999999997 85-89 19.470000000000002 29.275000000000002 27.495000000000005 23.76 90-94 20.145 28.560000000000002 27.455000000000002 23.84 95-99 19.885 28.595 28.015 23.505000000000003 100-104 19.915 28.305000000000003 27.96 23.82 105-109 20.46 28.634999999999998 27.339999999999996 23.565 110-114 19.994999999999997 28.804999999999996 27.575 23.625 115-119 20.46 28.494999999999997 27.27 23.775 120-124 20.005 28.27 27.63 24.095 125-129 19.950000000000003 29.04 27.284999999999997 23.724999999999998 130-134 19.96 29.195 27.200000000000003 23.645 135-139 20.515 28.01 27.36 24.115000000000002 140-144 20.66 28.549999999999997 27.235 23.555 145-149 20.64 28.325 26.995 24.04 150-151 20.837500000000002 28.712500000000002 27.187499999999996 23.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 1.5 24 2.0 25 5.0 26 7.0 27 8.0 28 9.5 29 14.5 30 32.0 31 40.5 32 40.5 33 53.5 34 57.5 35 70.5 36 95.5 37 112.0 38 138.5 39 179.5 40 211.5 41 224.0 42 229.0 43 254.5 44 261.0 45 255.5 46 260.5 47 263.5 48 242.5 49 191.0 50 152.5 51 143.0 52 122.5 53 79.0 54 58.0 55 44.5 56 32.5 57 30.0 58 22.0 59 11.5 60 11.0 61 7.0 62 3.5 63 5.5 64 6.5 65 3.5 66 1.0 67 1.5 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.675 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.42700629964393 83.45 2 7.641741988496302 13.950000000000001 3 0.8764721993974254 2.4 4 0.054779512462339086 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.9375 0.0 0.0 0.0 0.0 114-115 2.2 0.0 0.0 0.0 0.0 116-117 2.5125 0.0 0.0 0.0 0.0 118-119 2.6875 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.3499999999999996 0.0 0.0 0.0 0.0 124-125 3.7 0.0 0.0 0.0 0.0 126-127 4.199999999999999 0.0 0.0 0.0 0.0 128-129 4.6875 0.0 0.0 0.0 0.0 130-131 5.075 0.0 0.0 0.0 0.0 132-133 5.4 0.0 0.0 0.0 0.0 134-135 6.012499999999999 0.0 0.0 0.0 0.0 136-137 6.7125 0.0 0.0 0.0 0.0 138-139 7.137499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGGACA 10 0.006830828 145.0 7 TCTCTCA 10 0.006830828 145.0 7 >>END_MODULE SRR12919355 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919355_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.273 37.0 37.0 37.0 37.0 37.0 2 36.182 37.0 37.0 37.0 37.0 37.0 3 36.346 37.0 37.0 37.0 37.0 37.0 4 36.3505 37.0 37.0 37.0 37.0 37.0 5 36.338 37.0 37.0 37.0 37.0 37.0 6 36.343 37.0 37.0 37.0 37.0 37.0 7 36.349 37.0 37.0 37.0 37.0 37.0 8 36.5475 37.0 37.0 37.0 37.0 37.0 9 36.39 37.0 37.0 37.0 37.0 37.0 10-14 36.3885 37.0 37.0 37.0 37.0 37.0 15-19 36.351800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.362 37.0 37.0 37.0 37.0 37.0 25-29 36.2864 37.0 37.0 37.0 37.0 37.0 30-34 36.299099999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.2556 37.0 37.0 37.0 37.0 37.0 40-44 36.24079999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.2142 37.0 37.0 37.0 37.0 37.0 50-54 36.200900000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.1606 37.0 37.0 37.0 37.0 37.0 60-64 36.163 37.0 37.0 37.0 37.0 37.0 65-69 36.1011 37.0 37.0 37.0 37.0 37.0 70-74 36.07340000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.0225 37.0 37.0 37.0 37.0 37.0 80-84 36.0484 37.0 37.0 37.0 37.0 37.0 85-89 36.0243 37.0 37.0 37.0 37.0 37.0 90-94 35.9068 37.0 37.0 37.0 37.0 37.0 95-99 35.9238 37.0 37.0 37.0 37.0 37.0 100-104 35.9108 37.0 37.0 37.0 37.0 37.0 105-109 35.8651 37.0 37.0 37.0 37.0 37.0 110-114 35.8024 37.0 37.0 37.0 37.0 37.0 115-119 35.802499999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.723200000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.6862 37.0 37.0 37.0 37.0 37.0 130-134 35.5694 37.0 37.0 37.0 37.0 37.0 135-139 35.498 37.0 37.0 37.0 37.0 37.0 140-144 35.4832 37.0 37.0 37.0 37.0 37.0 145-149 35.3209 37.0 37.0 37.0 34.6 37.0 150-151 35.17375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 1.0 16 0.0 17 0.0 18 2.0 19 0.0 20 1.0 21 2.0 22 4.0 23 3.0 24 4.0 25 3.0 26 8.0 27 10.0 28 14.0 29 14.0 30 17.0 31 25.0 32 58.0 33 84.0 34 227.0 35 524.0 36 2717.0 37 277.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.275 24.375 7.9750000000000005 25.374999999999996 2 27.275 27.900000000000002 30.575000000000003 14.249999999999998 3 20.474999999999998 27.55 33.75 18.224999999999998 4 23.325000000000003 34.949999999999996 24.2 17.525 5 25.0 36.1 22.85 16.05 6 21.5 37.85 23.25 17.4 7 21.05 22.675 38.224999999999994 18.05 8 21.675 24.775 29.299999999999997 24.25 9 22.275 25.1 29.575000000000003 23.05 10-14 23.145 29.349999999999998 27.26 20.244999999999997 15-19 23.799999999999997 27.860000000000003 28.035 20.305 20-24 23.105 28.685 27.61 20.599999999999998 25-29 23.669999999999998 28.1 27.865000000000002 20.365 30-34 23.565 29.125 27.415 19.895 35-39 23.49 28.89 27.750000000000004 19.869999999999997 40-44 23.919999999999998 28.660000000000004 27.72 19.7 45-49 23.494999999999997 28.095 28.244999999999997 20.165 50-54 23.26 28.515 27.944999999999997 20.28 55-59 23.165 28.215 28.235 20.385 60-64 23.135 27.644999999999996 28.389999999999997 20.830000000000002 65-69 23.369999999999997 28.01 28.205000000000002 20.415 70-74 23.39 28.050000000000004 28.189999999999998 20.369999999999997 75-79 23.75 27.450000000000003 27.939999999999998 20.86 80-84 23.31 27.794999999999998 28.060000000000002 20.835 85-89 24.169999999999998 27.61 28.12 20.1 90-94 23.674999999999997 27.800000000000004 28.744999999999997 19.78 95-99 23.43 28.09 28.1 20.380000000000003 100-104 24.145 27.845 27.900000000000002 20.11 105-109 23.925 28.544999999999998 27.66 19.869999999999997 110-114 23.62 28.68 27.334999999999997 20.365 115-119 24.25 28.065 27.700000000000003 19.985 120-124 24.605 28.015 27.755000000000003 19.625 125-129 24.11 28.535 27.534999999999997 19.82 130-134 24.63 28.52 27.605 19.245 135-139 25.97 28.23 26.82 18.98 140-144 24.68 28.525 27.134999999999998 19.66 145-149 26.165 27.884999999999998 26.695 19.255 150-151 25.8 27.425 27.462500000000002 19.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.0 20 2.5 21 2.5 22 1.0 23 1.5 24 3.5 25 3.0 26 1.0 27 4.5 28 8.0 29 12.0 30 16.5 31 26.5 32 33.5 33 40.5 34 61.0 35 65.0 36 78.5 37 115.0 38 136.0 39 167.0 40 210.5 41 244.0 42 269.5 43 279.0 44 286.0 45 286.5 46 265.0 47 236.0 48 211.5 49 190.0 50 153.5 51 120.5 52 110.0 53 96.5 54 65.0 55 41.5 56 35.5 57 27.0 58 18.0 59 12.5 60 15.0 61 12.0 62 7.0 63 9.0 64 4.5 65 1.0 66 1.5 67 1.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.05 #Duplication Level Percentage of deduplicated Percentage of total 1 91.37836353651839 83.2 2 7.633168588687535 13.900000000000002 3 0.7962657880285557 2.175 4 0.16474464579901155 0.6 5 0.027457440966501923 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAGTTGCATTTATCTAAAGTATTGTCACTTTACTTAACACTTGAGCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.9125 0.0 0.0 0.0 0.0 114-115 2.175 0.0 0.0 0.0 0.0 116-117 2.4875 0.0 0.0 0.0 0.0 118-119 2.6625 0.0 0.0 0.0 0.0 120-121 2.8499999999999996 0.0 0.0 0.0 0.0 122-123 3.325 0.0 0.0 0.0 0.0 124-125 3.675 0.0 0.0 0.0 0.0 126-127 4.15 0.0 0.0 0.0 0.0 128-129 4.6375 0.0 0.0 0.0 0.0 130-131 5.025 0.0 0.0 0.0 0.0 132-133 5.35 0.0 0.0 0.0 0.0 134-135 5.9625 0.0 0.0 0.0 0.0 136-137 6.6625 0.0 0.0 0.0 0.0 138-139 7.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 35 0.0035366106 20.714287 40-44 >>END_MODULE Read 788253 spots for SRR12919355.sra Written 788253 spots for SRR12919355.sra Read 788253 spots for SRR12919355.sra Written 788253 spots for SRR12919355.sra Read 788253 spots for SRR12919355.sra Written 788253 spots for SRR12919355.sra Read 788253 spots for SRR12919355.sra Written 788253 spots for SRR12919355.sra Read 788253 spots for SRR12919355.sra Written 788253 spots for SRR12919355.sra Read 788253 spots for SRR12919355.sra Written 788253 spots for SRR12919355.sra Read 788253 spots for SRR12919355.sra Written 788253 spots for SRR12919355.sra Read 788253 spots for SRR12919355.sra Written 788253 spots for SRR12919355.sra Read 788253 spots for SRR12919355.sra Written 788253 spots for SRR12919355.sra Read 788253 spots for SRR12919355.sra Written 788253 spots for SRR12919355.sra Read 788253 spots for SRR12919355.sra Written 788253 spots for SRR12919355.sra Read 788253 spots for SRR12919355.sra Written 788253 spots for SRR12919355.sra Read 788253 spots for SRR12919355.sra Written 788253 spots for SRR12919355.sra Read 788253 spots for SRR12919355.sra Written 788253 spots for SRR12919355.sra Read 788253 spots for SRR12919355.sra Written 788253 spots for SRR12919355.sra Read 788258 spots for SRR12919355.sra Written 788258 spots for SRR12919355.sra Read 788253 spots for SRR12919355.sra Written 788253 spots for SRR12919355.sra Read 788253 spots for SRR12919355.sra Written 788253 spots for SRR12919355.sra Read 788253 spots for SRR12919355.sra Written 788253 spots for SRR12919355.sra Read 788253 spots for SRR12919355.sra Written 788253 spots for SRR12919355.sra SRR ids: ['SRR12919355.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8h3uyaey SRR12919355.sra spots: 15765065 blocks: [[1, 788253], [788254, 1576506], [1576507, 2364759], [2364760, 3153012], [3153013, 3941265], [3941266, 4729518], [4729519, 5517771], [5517772, 6306024], [6306025, 7094277], [7094278, 7882530], [7882531, 8670783], [8670784, 9459036], [9459037, 10247289], [10247290, 11035542], [11035543, 11823795], [11823796, 12612048], [12612049, 13400301], [13400302, 14188554], [14188555, 14976807], [14976808, 15765065]] SRR12919355 file size 5335958 SRR12919355 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919355 SRR12919355_1.fastq SRR12919355_2.fastq Input file: SRR12919355_1.fastq Paired file: SRR12919355_2.fastq trimmed: SRR12919355-trimmed-pair1.fastq, SRR12919355-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:36:21 2025 >> started Wed Feb 12 20:36:38 2025 >> done (17.332s) 15765065 read pairs processed; of these: 25 ( 0.00%) short read pairs filtered out after trimming by size control 404 ( 0.00%) empty read pairs filtered out after trimming by size control 15764636 (100.00%) read pairs available; of these: 1590080 (10.09%) trimmed read pairs available after processing 14174556 (89.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 4 0.00% 22 3 0.00% 23 4 0.00% 24 6 0.00% 25 3 0.00% 26 11 0.00% 27 6 0.00% 28 4 0.00% 29 6 0.00% 30 11 0.00% 31 12 0.00% 32 4 0.00% 33 9 0.00% 34 12 0.00% 35 13 0.00% 36 9 0.00% 37 11 0.00% 38 19 0.00% 39 11 0.00% 40 21 0.00% 41 11 0.00% 42 21 0.00% 43 11 0.00% 44 15 0.00% 45 19 0.00% 46 26 0.00% 47 20 0.00% 48 57 0.00% 49 38 0.00% 50 51 0.00% 51 60 0.00% 52 57 0.00% 53 54 0.00% 54 64 0.00% 55 60 0.00% 56 89 0.00% 57 88 0.00% 58 96 0.00% 59 107 0.00% 60 126 0.00% 61 170 0.00% 62 186 0.00% 63 236 0.00% 64 248 0.00% 65 250 0.00% 66 302 0.00% 67 313 0.00% 68 399 0.00% 69 411 0.00% 70 551 0.00% 71 604 0.00% 72 690 0.00% 73 862 0.01% 74 919 0.01% 75 1010 0.01% 76 1088 0.01% 77 1284 0.01% 78 1339 0.01% 79 1669 0.01% 80 1745 0.01% 81 2069 0.01% 82 2441 0.02% 83 2653 0.02% 84 3162 0.02% 85 3366 0.02% 86 3475 0.02% 87 3829 0.02% 88 4157 0.03% 89 4492 0.03% 90 4934 0.03% 91 5434 0.03% 92 6131 0.04% 93 6668 0.04% 94 7807 0.05% 95 8083 0.05% 96 8546 0.05% 97 9015 0.06% 98 9478 0.06% 99 9982 0.06% 100 10801 0.07% 101 11135 0.07% 102 12223 0.08% 103 13115 0.08% 104 14242 0.09% 105 15067 0.10% 106 15424 0.10% 107 16126 0.10% 108 16453 0.10% 109 17209 0.11% 110 17326 0.11% 111 18451 0.12% 112 19325 0.12% 113 20182 0.13% 114 21078 0.13% 115 22356 0.14% 116 22874 0.15% 117 23692 0.15% 118 24026 0.15% 119 24089 0.15% 120 24888 0.16% 121 25714 0.16% 122 26478 0.17% 123 27374 0.17% 124 28713 0.18% 125 29137 0.18% 126 30549 0.19% 127 31205 0.20% 128 31204 0.20% 129 31549 0.20% 130 32522 0.21% 131 32903 0.21% 132 33753 0.21% 133 34097 0.22% 134 35264 0.22% 135 36548 0.23% 136 37395 0.24% 137 38099 0.24% 138 38397 0.24% 139 39008 0.25% 140 39006 0.25% 141 39889 0.25% 142 40592 0.26% 143 40833 0.26% 144 42476 0.27% 145 43306 0.27% 146 43834 0.28% 147 44038 0.28% 148 44959 0.29% 149 44535 0.28% 150 45369 0.29% 151 14174556 89.91% 15764636 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=34 prefix-density=0.58 prefix-fanout=2.2 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=34 fanout-score=85.37 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=13.9 sequence=TTCCTTCAACTTCCCACAGTATCCCATTCTCAATCTCCTTGTATGGGAACGAATCCGAGAGAAGCTCATCACCAGAGAGAAGATCTTGATAGACCAACATGATTGCGCAGAAGAGCTCCTCTCTTTCGGATCGACCCAAAGACAGA criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=24 prefix-density=0.46 prefix-fanout=2.5 sequence=CCCAAGGAAGTTTTCTGGCTTCCCATCACCACATCCTGGTATGATGCTGCCACTAAAGCGCTCAAGGATATGAAGTTAAGAAAATGCTATTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=99.14 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.3 sequence=GTGAAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAA SRR12919355 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:37:33 Started mapping on | Feb 12 20:37:33 Finished on | Feb 12 20:39:39 Mapping speed, Million of reads per hour | 450.42 Number of input reads | 15764636 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14478622 Uniquely mapped reads % | 91.84% Average mapped length | 295.76 Number of splices: Total | 13736387 Number of splices: Annotated (sjdb) | 13397556 Number of splices: GT/AG | 13477742 Number of splices: GC/AG | 198294 Number of splices: AT/AC | 12848 Number of splices: Non-canonical | 47503 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 3.14 Insertion rate per base | 0.03% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 415239 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 38263 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.17% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 870775 870775 870775 N_multimapping 415239 415239 415239 N_noFeature 571373 14295821 655600 N_ambiguous 196888 867 97923 UnstrandedReadsAssigned:13710361 PositiveStrandReadsAssigned:181934 NegativeStrandReadsAssigned:13725099 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919355 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919355-trimmed-pair1.fastq SRR12919355-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,764,636 reads, 13,671,502 reads pseudoaligned [quant] estimated average fragment length: 266.903 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52401 SRR12919355.ke.tsv 34699 SRR12919355.se.tsv 87100 total ==> SRR12919355.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.1 441 19.7858 Potri.005G024800.1.v4.1 1035 769.097 192 19.6242 Potri.004G059700.1.v4.1 961 695.237 42 4.74886 Potri.007G009000.2.v4.1 1416 1150.1 0 0 Potri.003G141000.2.v4.1 2943 2677.1 579.259 17.0091 Potri.016G087400.1.v4.1 270 84.1427 1343.65 1255.29 Potri.015G069301.1.v4.1 564 315.499 0 0 Potri.010G195200.1.v4.1 1773 1507.1 69.6661 3.63373 Potri.012G127500.1.v4.1 977 711.183 4266 471.533 ==> SRR12919355.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 257 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 176 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 9 SRR12919355 completed mapping pipeline successfully