Starting /dee2/code/volunteer_pipeline.sh SRR12919356 current disk space = 3050962481152 free memory = 1039172412 SRR12919356 SRAfilesize 1bb17fcf0f7decd9439fa95ef956814b SRR12919356.sra SRR12919356.sra file validated SRR12919356 is paired end SRR12919356 is conventional basespace SRR12919356 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919356_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.582 37.0 37.0 37.0 37.0 37.0 2 36.2575 37.0 37.0 37.0 37.0 37.0 3 36.574 37.0 37.0 37.0 37.0 37.0 4 36.6915 37.0 37.0 37.0 37.0 37.0 5 36.696 37.0 37.0 37.0 37.0 37.0 6 36.678 37.0 37.0 37.0 37.0 37.0 7 36.6 37.0 37.0 37.0 37.0 37.0 8 36.613 37.0 37.0 37.0 37.0 37.0 9 36.61 37.0 37.0 37.0 37.0 37.0 10-14 36.682300000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.6331 37.0 37.0 37.0 37.0 37.0 20-24 36.60170000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.591300000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.5912 37.0 37.0 37.0 37.0 37.0 35-39 36.5461 37.0 37.0 37.0 37.0 37.0 40-44 36.523199999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.5402 37.0 37.0 37.0 37.0 37.0 50-54 36.465799999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.4597 37.0 37.0 37.0 37.0 37.0 60-64 36.3852 37.0 37.0 37.0 37.0 37.0 65-69 36.4197 37.0 37.0 37.0 37.0 37.0 70-74 36.346000000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.3094 37.0 37.0 37.0 37.0 37.0 80-84 36.312 37.0 37.0 37.0 37.0 37.0 85-89 36.2341 37.0 37.0 37.0 37.0 37.0 90-94 36.2598 37.0 37.0 37.0 37.0 37.0 95-99 36.201100000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.224399999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.205600000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.1185 37.0 37.0 37.0 37.0 37.0 115-119 36.0652 37.0 37.0 37.0 37.0 37.0 120-124 36.094800000000006 37.0 37.0 37.0 37.0 37.0 125-129 36.0167 37.0 37.0 37.0 37.0 37.0 130-134 35.919399999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.818200000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.701499999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.674699999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.43775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 3.0 25 4.0 26 3.0 27 7.0 28 12.0 29 16.0 30 28.0 31 29.0 32 38.0 33 57.0 34 101.0 35 333.0 36 2969.0 37 399.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.800000000000004 12.775 6.325 41.099999999999994 2 18.957703927492446 13.091641490433032 36.40483383685801 31.545820745216513 3 17.325 17.775 27.900000000000002 37.0 4 21.975 24.625 24.6 28.799999999999997 5 21.025 31.724999999999998 26.424999999999997 20.825 6 20.325 34.150000000000006 23.1 22.425 7 14.7 25.674999999999997 42.0 17.625 8 17.05 25.525 32.25 25.174999999999997 9 16.725 24.55 35.325 23.400000000000002 10-14 19.314999999999998 30.095 27.49 23.1 15-19 19.235 28.285 28.194999999999997 24.285 20-24 19.43 28.605000000000004 28.134999999999998 23.830000000000002 25-29 19.67 28.939999999999998 27.815 23.575 30-34 19.24 28.854999999999997 27.58 24.325 35-39 19.895 28.375 27.93 23.799999999999997 40-44 19.475 29.205 28.044999999999998 23.275000000000002 45-49 19.89 28.994999999999997 27.47 23.645 50-54 19.02 29.494999999999997 27.955000000000002 23.53 55-59 19.900000000000002 28.505000000000003 27.32 24.275 60-64 20.175 28.425 27.584999999999997 23.815 65-69 20.265 27.994999999999997 28.43 23.31 70-74 19.425 28.449999999999996 28.785 23.34 75-79 20.03 28.7 27.52 23.75 80-84 19.79 27.955000000000002 28.27 23.985 85-89 20.395 28.810000000000002 27.529999999999998 23.265 90-94 19.830000000000002 28.675 27.975 23.52 95-99 20.05 28.005000000000003 28.175 23.77 100-104 19.67 29.12 27.544999999999998 23.665 105-109 19.82 27.975 27.96 24.245 110-114 20.485 28.585 27.065 23.865 115-119 20.57 28.754999999999995 27.145000000000003 23.53 120-124 20.925 28.244999999999997 27.084999999999997 23.745 125-129 20.255000000000003 27.450000000000003 28.435 23.86 130-134 20.39 28.194999999999997 27.445000000000004 23.97 135-139 21.135 28.134999999999998 26.955000000000002 23.775 140-144 20.665 28.645 26.840000000000003 23.849999999999998 145-149 21.355 27.560000000000002 27.35 23.735 150-151 20.974999999999998 29.025000000000002 26.075 23.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 2.5 23 3.0 24 2.5 25 3.5 26 5.5 27 6.0 28 9.5 29 16.5 30 19.0 31 28.5 32 36.0 33 44.0 34 68.0 35 80.5 36 83.5 37 109.0 38 139.0 39 164.0 40 196.5 41 222.5 42 241.5 43 260.0 44 260.0 45 265.5 46 276.0 47 259.5 48 239.5 49 208.0 50 156.0 51 122.0 52 105.5 53 92.0 54 71.5 55 48.0 56 35.0 57 27.5 58 23.5 59 17.0 60 14.5 61 12.0 62 8.5 63 5.5 64 2.0 65 1.5 66 1.5 67 1.5 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.7000000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.45 #Duplication Level Percentage of deduplicated Percentage of total 1 91.9901585565883 84.125 2 6.998359759431382 12.8 3 0.8201202843083653 2.25 4 0.10934937124111535 0.4 5 0.027337342810278838 0.125 6 0.054674685620557675 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAACAGTATCAGGAACCACACCACTCTCTGTCATCTCATTCAACAACTCC 6 0.15 No Hit CTCATAAAGTAAACAAATCTGCACTAACCATCAATCATACTTGTAAGTTA 6 0.15 No Hit CTTTGCCAGAACACCGAAACCAGTATTACCTTTTTCCTCCGCCCTCCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.4625 0.0 0.0 0.0 0.0 102-103 1.825 0.0 0.0 0.0 0.0 104-105 2.05 0.0 0.0 0.0 0.0 106-107 2.3 0.0 0.0 0.0 0.0 108-109 2.95 0.0 0.0 0.0 0.0 110-111 3.325 0.0 0.0 0.0 0.0 112-113 3.7375 0.0 0.0 0.0 0.0 114-115 4.137499999999999 0.0 0.0 0.0 0.0 116-117 4.5875 0.0 0.0 0.0 0.0 118-119 4.975 0.0 0.0 0.0 0.0 120-121 5.387499999999999 0.0 0.0 0.0 0.0 122-123 5.875 0.0 0.0 0.0 0.0 124-125 6.324999999999999 0.0 0.0 0.0 0.0 126-127 6.7875 0.0 0.0 0.0 0.0 128-129 7.300000000000001 0.0 0.0 0.0 0.0 130-131 8.175 0.0 0.0 0.0 0.0 132-133 8.725 0.0 0.0 0.0 0.0 134-135 9.375 0.0 0.0 0.0 0.0 136-137 10.0875 0.0 0.0 0.0 0.0 138-139 10.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGCCT 10 0.006830828 145.0 1 CCTATTC 10 0.006830828 145.0 5 AATTTGT 10 0.006830828 145.0 145 GCCTATT 10 0.006830828 145.0 4 TATTCCA 10 0.006830828 145.0 7 GTTATCC 10 0.006830828 145.0 7 CTATTCC 10 0.006830828 145.0 6 >>END_MODULE SRR12919356 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919356_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3005 37.0 37.0 37.0 37.0 37.0 2 36.267 37.0 37.0 37.0 37.0 37.0 3 36.2835 37.0 37.0 37.0 37.0 37.0 4 36.291 37.0 37.0 37.0 37.0 37.0 5 36.4755 37.0 37.0 37.0 37.0 37.0 6 36.3365 37.0 37.0 37.0 37.0 37.0 7 36.249 37.0 37.0 37.0 37.0 37.0 8 36.447 37.0 37.0 37.0 37.0 37.0 9 36.418 37.0 37.0 37.0 37.0 37.0 10-14 36.3611 37.0 37.0 37.0 37.0 37.0 15-19 36.309900000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.315 37.0 37.0 37.0 37.0 37.0 25-29 36.2207 37.0 37.0 37.0 37.0 37.0 30-34 36.205 37.0 37.0 37.0 37.0 37.0 35-39 36.2229 37.0 37.0 37.0 37.0 37.0 40-44 36.196799999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.1499 37.0 37.0 37.0 37.0 37.0 50-54 36.1314 37.0 37.0 37.0 37.0 37.0 55-59 36.0932 37.0 37.0 37.0 37.0 37.0 60-64 36.0863 37.0 37.0 37.0 37.0 37.0 65-69 36.037 37.0 37.0 37.0 37.0 37.0 70-74 36.0028 37.0 37.0 37.0 37.0 37.0 75-79 35.9829 37.0 37.0 37.0 37.0 37.0 80-84 35.9358 37.0 37.0 37.0 37.0 37.0 85-89 35.8788 37.0 37.0 37.0 37.0 37.0 90-94 35.8832 37.0 37.0 37.0 37.0 37.0 95-99 35.86409999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.7878 37.0 37.0 37.0 37.0 37.0 105-109 35.7938 37.0 37.0 37.0 37.0 37.0 110-114 35.7767 37.0 37.0 37.0 37.0 37.0 115-119 35.7577 37.0 37.0 37.0 37.0 37.0 120-124 35.6377 37.0 37.0 37.0 37.0 37.0 125-129 35.570100000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.519099999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.3368 37.0 37.0 37.0 37.0 37.0 140-144 35.2793 37.0 37.0 37.0 32.2 37.0 145-149 35.120099999999994 37.0 37.0 37.0 27.4 37.0 150-151 34.995999999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 0.0 15 3.0 16 1.0 17 1.0 18 1.0 19 1.0 20 1.0 21 4.0 22 3.0 23 8.0 24 8.0 25 6.0 26 12.0 27 13.0 28 9.0 29 18.0 30 31.0 31 43.0 32 58.0 33 95.0 34 177.0 35 482.0 36 2727.0 37 294.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.4 22.75 8.774999999999999 27.075 2 25.624999999999996 26.900000000000002 32.05 15.425 3 20.549999999999997 27.500000000000004 33.5 18.45 4 22.7 34.849999999999994 22.975 19.475 5 25.05 37.4 22.575 14.975 6 20.474999999999998 39.324999999999996 23.075000000000003 17.125 7 20.825 22.725 37.974999999999994 18.475 8 20.95 24.825 28.9 25.324999999999996 9 21.825 25.224999999999998 30.875000000000004 22.075 10-14 23.715 29.01 26.595000000000002 20.68 15-19 23.200000000000003 27.985 27.985 20.830000000000002 20-24 23.155 28.59 27.689999999999998 20.565 25-29 22.395 28.389999999999997 28.549999999999997 20.665 30-34 22.509999999999998 28.075 29.13 20.285 35-39 23.13 27.48 28.29 21.099999999999998 40-44 23.27 27.605 28.9 20.225 45-49 23.305 28.105000000000004 28.49 20.1 50-54 22.884999999999998 27.975 28.470000000000002 20.669999999999998 55-59 23.845 28.13 27.93 20.095 60-64 22.869999999999997 28.77 27.51 20.849999999999998 65-69 23.095 28.785 27.445000000000004 20.674999999999997 70-74 23.78 28.485 28.000000000000004 19.735 75-79 23.53 28.18 27.894999999999996 20.395 80-84 23.794999999999998 28.59 27.384999999999998 20.23 85-89 23.25 28.235 28.375 20.14 90-94 24.09 28.125 27.189999999999998 20.595 95-99 23.474999999999998 27.865000000000002 28.000000000000004 20.66 100-104 23.494999999999997 28.110000000000003 28.175 20.22 105-109 24.2 27.61 27.765 20.424999999999997 110-114 24.525 27.68 27.715 20.080000000000002 115-119 24.42 27.925 27.750000000000004 19.905 120-124 24.25 28.660000000000004 27.33 19.759999999999998 125-129 25.174999999999997 27.839999999999996 27.125 19.86 130-134 24.595 28.860000000000003 27.534999999999997 19.009999999999998 135-139 26.384999999999998 27.985 27.33 18.3 140-144 26.405 27.834999999999997 26.974999999999998 18.785 145-149 26.615 27.889999999999997 25.955000000000002 19.54 150-151 27.1375 28.475 26.337500000000002 18.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 1.5 10 1.5 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.5 17 0.5 18 0.0 19 1.0 20 2.0 21 1.5 22 3.0 23 5.5 24 5.0 25 4.5 26 3.0 27 4.5 28 6.0 29 8.0 30 17.0 31 26.5 32 29.0 33 33.5 34 48.0 35 67.0 36 91.5 37 113.5 38 130.5 39 164.0 40 207.5 41 237.0 42 280.0 43 302.5 44 297.5 45 289.0 46 272.0 47 253.5 48 213.0 49 181.0 50 145.5 51 115.5 52 102.5 53 83.5 54 65.0 55 39.0 56 27.0 57 27.5 58 19.0 59 14.0 60 9.0 61 5.0 62 7.0 63 6.5 64 6.0 65 3.0 66 2.5 67 3.0 68 2.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.5 96 1.0 97 0.5 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.625 #Duplication Level Percentage of deduplicated Percentage of total 1 92.16916780354707 84.45 2 6.903137789904503 12.65 3 0.7094133697135061 1.95 4 0.1364256480218281 0.5 5 0.0 0.0 6 0.08185538881309685 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGATGTGCGCGGGTACAGTTGTTTGATTCGTGGGTTGTTTAGAGCCA 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CTACTACTCTACTCTCTTAATTCTCACACTCATTCATAGTACTGACTCTG 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.0999999999999996 0.0 0.0 0.0 0.0 106-107 2.35 0.0 0.0 0.0 0.0 108-109 3.0 0.0 0.0 0.0 0.0 110-111 3.375 0.0 0.0 0.0 0.0 112-113 3.7875 0.0 0.0 0.0 0.0 114-115 4.1875 0.0 0.0 0.0 0.0 116-117 4.6375 0.0 0.0 0.0 0.0 118-119 5.025 0.0 0.0 0.0 0.0 120-121 5.4375 0.0 0.0 0.0 0.0 122-123 5.925000000000001 0.0 0.0 0.0 0.0 124-125 6.375 0.0 0.0 0.0 0.0 126-127 6.8125 0.0 0.0 0.0 0.0 128-129 7.324999999999999 0.0 0.0 0.0 0.0 130-131 8.2 0.0 0.0 0.0 0.0 132-133 8.775 0.0 0.0 0.0 0.0 134-135 9.45 0.0 0.0 0.0 0.0 136-137 10.1375 0.0 0.0 0.0 0.0 138-139 10.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTTGG 10 0.006830828 145.0 4 GGTTGGG 10 0.006830828 145.0 5 CACTGGT 10 0.006830828 145.0 1 TTGGGTA 10 0.006830828 145.0 7 >>END_MODULE Read 857687 spots for SRR12919356.sra Written 857687 spots for SRR12919356.sra Read 857687 spots for SRR12919356.sra Written 857687 spots for SRR12919356.sra Read 857687 spots for SRR12919356.sra Written 857687 spots for SRR12919356.sra Read 857687 spots for SRR12919356.sra Written 857687 spots for SRR12919356.sra Read 857687 spots for SRR12919356.sra Written 857687 spots for SRR12919356.sra Read 857687 spots for SRR12919356.sra Written 857687 spots for SRR12919356.sra Read 857687 spots for SRR12919356.sra Written 857687 spots for SRR12919356.sra Read 857687 spots for SRR12919356.sra Written 857687 spots for SRR12919356.sra Read 857687 spots for SRR12919356.sra Written 857687 spots for SRR12919356.sra Read 857687 spots for SRR12919356.sra Written 857687 spots for SRR12919356.sra Read 857702 spots for SRR12919356.sra Written 857702 spots for SRR12919356.sra Read 857687 spots for SRR12919356.sra Written 857687 spots for SRR12919356.sra Read 857687 spots for SRR12919356.sra Written 857687 spots for SRR12919356.sra Read 857687 spots for SRR12919356.sra Written 857687 spots for SRR12919356.sra Read 857687 spots for SRR12919356.sra Written 857687 spots for SRR12919356.sra Read 857687 spots for SRR12919356.sra Written 857687 spots for SRR12919356.sra Read 857687 spots for SRR12919356.sra Written 857687 spots for SRR12919356.sra Read 857687 spots for SRR12919356.sra Written 857687 spots for SRR12919356.sra Read 857687 spots for SRR12919356.sra Written 857687 spots for SRR12919356.sra Read 857687 spots for SRR12919356.sra Written 857687 spots for SRR12919356.sra SRR ids: ['SRR12919356.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0g43s0_b SRR12919356.sra spots: 17153755 blocks: [[1, 857687], [857688, 1715374], [1715375, 2573061], [2573062, 3430748], [3430749, 4288435], [4288436, 5146122], [5146123, 6003809], [6003810, 6861496], [6861497, 7719183], [7719184, 8576870], [8576871, 9434557], [9434558, 10292244], [10292245, 11149931], [11149932, 12007618], [12007619, 12865305], [12865306, 13722992], [13722993, 14580679], [14580680, 15438366], [15438367, 16296053], [16296054, 17153755]] SRR12919356 file size 5807896 SRR12919356 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919356 SRR12919356_1.fastq SRR12919356_2.fastq Input file: SRR12919356_1.fastq Paired file: SRR12919356_2.fastq trimmed: SRR12919356-trimmed-pair1.fastq, SRR12919356-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:05:14 2025 >> started Wed Feb 12 20:05:36 2025 >> done (22.305s) 17153755 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 1815 ( 0.01%) empty read pairs filtered out after trimming by size control 17151917 (99.99%) read pairs available; of these: 2663721 (15.53%) trimmed read pairs available after processing 14488196 (84.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 2 0.00% 21 3 0.00% 22 4 0.00% 23 3 0.00% 24 5 0.00% 25 7 0.00% 26 4 0.00% 27 10 0.00% 28 12 0.00% 29 13 0.00% 30 12 0.00% 31 13 0.00% 32 13 0.00% 33 9 0.00% 34 21 0.00% 35 10 0.00% 36 14 0.00% 37 25 0.00% 38 24 0.00% 39 13 0.00% 40 31 0.00% 41 32 0.00% 42 32 0.00% 43 27 0.00% 44 44 0.00% 45 36 0.00% 46 46 0.00% 47 50 0.00% 48 57 0.00% 49 88 0.00% 50 112 0.00% 51 107 0.00% 52 139 0.00% 53 103 0.00% 54 136 0.00% 55 145 0.00% 56 191 0.00% 57 189 0.00% 58 243 0.00% 59 248 0.00% 60 309 0.00% 61 414 0.00% 62 438 0.00% 63 429 0.00% 64 564 0.00% 65 577 0.00% 66 665 0.00% 67 755 0.00% 68 826 0.00% 69 1002 0.01% 70 1123 0.01% 71 1327 0.01% 72 1614 0.01% 73 1860 0.01% 74 2019 0.01% 75 2274 0.01% 76 2521 0.01% 77 2628 0.02% 78 2951 0.02% 79 3370 0.02% 80 3837 0.02% 81 4477 0.03% 82 5100 0.03% 83 5650 0.03% 84 6623 0.04% 85 7109 0.04% 86 7281 0.04% 87 8183 0.05% 88 8972 0.05% 89 9649 0.06% 90 10303 0.06% 91 11562 0.07% 92 12657 0.07% 93 14106 0.08% 94 15303 0.09% 95 16612 0.10% 96 17500 0.10% 97 18276 0.11% 98 18869 0.11% 99 19994 0.12% 100 21543 0.13% 101 22282 0.13% 102 23767 0.14% 103 26048 0.15% 104 27533 0.16% 105 28828 0.17% 106 29864 0.17% 107 30512 0.18% 108 31305 0.18% 109 32181 0.19% 110 32452 0.19% 111 34607 0.20% 112 35734 0.21% 113 37387 0.22% 114 39200 0.23% 115 40609 0.24% 116 41048 0.24% 117 42034 0.25% 118 43366 0.25% 119 43020 0.25% 120 43826 0.26% 121 44769 0.26% 122 45951 0.27% 123 47559 0.28% 124 48561 0.28% 125 50005 0.29% 126 51926 0.30% 127 51904 0.30% 128 52246 0.30% 129 52717 0.31% 130 53153 0.31% 131 53317 0.31% 132 54587 0.32% 133 56046 0.33% 134 56430 0.33% 135 57945 0.34% 136 58671 0.34% 137 59338 0.35% 138 59733 0.35% 139 59356 0.35% 140 59165 0.34% 141 60239 0.35% 142 61038 0.36% 143 61245 0.36% 144 63072 0.37% 145 63625 0.37% 146 63801 0.37% 147 64344 0.38% 148 64854 0.38% 149 64311 0.37% 150 64662 0.38% 151 14488196 84.47% 17151917 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=9.04 fanout-score-rank=17 prefix-density=0.27 prefix-fanout=5.0 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=17 fanout-score=484.24 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=36.2 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=38 prefix-density=0.13 prefix-fanout=2.0 sequence=CCAGACCAGCAGAGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=16 fanout-score=407.96 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=33.4 sequence=AAGAAGAAGAAG SRR12919356 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:06:25 Started mapping on | Feb 12 20:06:25 Finished on | Feb 12 20:08:25 Mapping speed, Million of reads per hour | 514.56 Number of input reads | 17151917 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16089239 Uniquely mapped reads % | 93.80% Average mapped length | 292.59 Number of splices: Total | 14678662 Number of splices: Annotated (sjdb) | 14326518 Number of splices: GT/AG | 14409827 Number of splices: GC/AG | 212564 Number of splices: AT/AC | 13955 Number of splices: Non-canonical | 42316 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 380746 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 55376 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.51% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 681932 681932 681932 N_multimapping 380746 380746 380746 N_noFeature 698586 15877929 800976 N_ambiguous 203796 939 94455 UnstrandedReadsAssigned:15186857 PositiveStrandReadsAssigned:210371 NegativeStrandReadsAssigned:15193808 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919356 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919356-trimmed-pair1.fastq SRR12919356-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,151,917 reads, 15,292,649 reads pseudoaligned [quant] estimated average fragment length: 243.213 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR12919356.ke.tsv 34699 SRR12919356.se.tsv 87100 total ==> SRR12919356.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.79 512 22.0697 Potri.005G024800.1.v4.1 1035 792.787 174 16.8 Potri.004G059700.1.v4.1 961 718.93 30 3.19412 Potri.007G009000.2.v4.1 1416 1173.79 0 0 Potri.003G141000.2.v4.1 2943 2700.79 685.423 19.4261 Potri.016G087400.1.v4.1 270 94.0254 1001 814.902 Potri.015G069301.1.v4.1 564 335.662 0 0 Potri.010G195200.1.v4.1 1773 1530.79 115.019 5.75139 Potri.012G127500.1.v4.1 977 734.873 6675 695.273 ==> SRR12919356.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 126 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 254 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR12919356 completed mapping pipeline successfully