Starting /dee2/code/volunteer_pipeline.sh SRR12919357 current disk space = 3050912903168 free memory = 1413612716 SRR12919357 SRAfilesize 20d58ae675b63002cc47a42e70e6207c SRR12919357.sra SRR12919357.sra file validated SRR12919357 is paired end SRR12919357 is conventional basespace SRR12919357 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919357_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.461 37.0 37.0 37.0 37.0 37.0 2 36.19125 37.0 37.0 37.0 37.0 37.0 3 36.5735 37.0 37.0 37.0 37.0 37.0 4 36.596 37.0 37.0 37.0 37.0 37.0 5 36.688 37.0 37.0 37.0 37.0 37.0 6 36.6845 37.0 37.0 37.0 37.0 37.0 7 36.62 37.0 37.0 37.0 37.0 37.0 8 36.7295 37.0 37.0 37.0 37.0 37.0 9 36.6215 37.0 37.0 37.0 37.0 37.0 10-14 36.6654 37.0 37.0 37.0 37.0 37.0 15-19 36.609300000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.5841 37.0 37.0 37.0 37.0 37.0 25-29 36.5717 37.0 37.0 37.0 37.0 37.0 30-34 36.5815 37.0 37.0 37.0 37.0 37.0 35-39 36.529399999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.4536 37.0 37.0 37.0 37.0 37.0 45-49 36.4556 37.0 37.0 37.0 37.0 37.0 50-54 36.464999999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.4308 37.0 37.0 37.0 37.0 37.0 60-64 36.3827 37.0 37.0 37.0 37.0 37.0 65-69 36.3577 37.0 37.0 37.0 37.0 37.0 70-74 36.3297 37.0 37.0 37.0 37.0 37.0 75-79 36.3229 37.0 37.0 37.0 37.0 37.0 80-84 36.3051 37.0 37.0 37.0 37.0 37.0 85-89 36.2214 37.0 37.0 37.0 37.0 37.0 90-94 36.25410000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.2087 37.0 37.0 37.0 37.0 37.0 100-104 36.1699 37.0 37.0 37.0 37.0 37.0 105-109 36.1248 37.0 37.0 37.0 37.0 37.0 110-114 36.088699999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0714 37.0 37.0 37.0 37.0 37.0 120-124 36.1044 37.0 37.0 37.0 37.0 37.0 125-129 35.955 37.0 37.0 37.0 37.0 37.0 130-134 35.9094 37.0 37.0 37.0 37.0 37.0 135-139 35.8346 37.0 37.0 37.0 37.0 37.0 140-144 35.7846 37.0 37.0 37.0 37.0 37.0 145-149 35.826800000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.64125 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 0.0 20 0.0 21 1.0 22 1.0 23 2.0 24 1.0 25 3.0 26 4.0 27 5.0 28 13.0 29 16.0 30 22.0 31 25.0 32 34.0 33 58.0 34 126.0 35 329.0 36 2965.0 37 393.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.15 12.675 5.475 32.7 2 20.306609700929883 14.601658708218146 36.34078914300075 28.75094244785122 3 17.724999999999998 21.9 29.7 30.675 4 22.325 29.299999999999997 23.275000000000002 25.1 5 22.2 32.5 25.95 19.35 6 20.599999999999998 34.949999999999996 24.7 19.75 7 15.299999999999999 24.95 42.199999999999996 17.549999999999997 8 17.325 25.025 31.775 25.874999999999996 9 17.25 25.3 32.800000000000004 24.65 10-14 20.44 29.095 27.73 22.735 15-19 19.675 28.325 28.51 23.49 20-24 19.830000000000002 28.485 27.894999999999996 23.79 25-29 19.8 29.104999999999997 27.325 23.77 30-34 19.78 28.76 28.139999999999997 23.32 35-39 20.169999999999998 28.46 27.655 23.715 40-44 19.634999999999998 29.12 27.805000000000003 23.44 45-49 19.905 29.04 27.91 23.145 50-54 20.51 29.235 27.26 22.994999999999997 55-59 19.625 28.999999999999996 28.04 23.335 60-64 19.975 28.884999999999998 27.455000000000002 23.685000000000002 65-69 19.59 28.565 28.294999999999998 23.549999999999997 70-74 19.56 29.080000000000002 27.735 23.625 75-79 20.14 28.27 27.93 23.66 80-84 20.24 28.689999999999998 27.334999999999997 23.735 85-89 20.36 28.139999999999997 28.03 23.47 90-94 19.77 28.96 27.85 23.419999999999998 95-99 20.330000000000002 29.32 26.900000000000002 23.45 100-104 19.88 29.385 27.41 23.325000000000003 105-109 20.64 28.910000000000004 26.740000000000002 23.71 110-114 19.900000000000002 29.18 27.13 23.79 115-119 20.380000000000003 28.515 28.01 23.095 120-124 20.415 28.415000000000003 27.625 23.544999999999998 125-129 20.625 28.53 27.465 23.380000000000003 130-134 20.385 28.560000000000002 26.889999999999997 24.165 135-139 20.87 28.375 27.485 23.27 140-144 20.549999999999997 29.215000000000003 27.08 23.155 145-149 20.95 28.785 27.029999999999998 23.235 150-151 21.2 27.0875 27.6625 24.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 1.0 25 4.0 26 7.0 27 11.0 28 12.5 29 8.0 30 15.5 31 25.5 32 30.0 33 46.0 34 62.5 35 64.0 36 92.0 37 132.5 38 149.5 39 181.5 40 219.0 41 227.5 42 243.5 43 260.5 44 266.5 45 273.5 46 258.5 47 239.5 48 225.0 49 192.5 50 152.0 51 125.5 52 112.5 53 85.0 54 61.5 55 52.0 56 38.5 57 35.0 58 22.5 59 13.0 60 12.0 61 9.5 62 9.0 63 5.5 64 4.0 65 2.0 66 1.0 67 1.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 90.99421646929221 82.6 2 7.986780501239328 14.499999999999998 3 0.8812999173781328 2.4 4 0.13770311209033323 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.9750000000000001 0.0 0.0 0.0 0.0 106-107 1.1749999999999998 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.5125 0.0 0.0 0.0 0.0 112-113 1.6125 0.0 0.0 0.0 0.0 114-115 1.8125 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.35 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.175 0.0 0.0 0.0 0.0 126-127 3.45 0.0 0.0 0.0 0.0 128-129 3.7875 0.0 0.0 0.0 0.0 130-131 4.1125 0.0 0.0 0.0 0.0 132-133 4.449999999999999 0.0 0.0 0.0 0.0 134-135 4.825 0.0 0.0 0.0 0.0 136-137 5.137499999999999 0.0 0.0 0.0 0.0 138-139 5.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 40 0.0076550315 18.125 45-49 >>END_MODULE SRR12919357 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919357_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.088 37.0 37.0 37.0 37.0 37.0 2 36.2245 37.0 37.0 37.0 37.0 37.0 3 36.2955 37.0 37.0 37.0 37.0 37.0 4 36.2435 37.0 37.0 37.0 37.0 37.0 5 36.3995 37.0 37.0 37.0 37.0 37.0 6 36.366 37.0 37.0 37.0 37.0 37.0 7 36.263 37.0 37.0 37.0 37.0 37.0 8 36.318 37.0 37.0 37.0 37.0 37.0 9 36.3335 37.0 37.0 37.0 37.0 37.0 10-14 36.32379999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.29789999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.2715 37.0 37.0 37.0 37.0 37.0 25-29 36.223099999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.1587 37.0 37.0 37.0 37.0 37.0 35-39 36.1151 37.0 37.0 37.0 37.0 37.0 40-44 36.10699999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.0589 37.0 37.0 37.0 37.0 37.0 50-54 36.0092 37.0 37.0 37.0 37.0 37.0 55-59 36.063 37.0 37.0 37.0 37.0 37.0 60-64 36.0681 37.0 37.0 37.0 37.0 37.0 65-69 35.9828 37.0 37.0 37.0 37.0 37.0 70-74 35.9394 37.0 37.0 37.0 37.0 37.0 75-79 35.897499999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.916599999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.864000000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.857899999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.872699999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.743 37.0 37.0 37.0 37.0 37.0 105-109 35.7668 37.0 37.0 37.0 37.0 37.0 110-114 35.80329999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.7775 37.0 37.0 37.0 37.0 37.0 120-124 35.702999999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.705799999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.565 37.0 37.0 37.0 37.0 37.0 135-139 35.4542 37.0 37.0 37.0 37.0 37.0 140-144 35.3829 37.0 37.0 37.0 37.0 37.0 145-149 35.2667 37.0 37.0 37.0 32.2 37.0 150-151 35.09075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 6.0 15 1.0 16 4.0 17 1.0 18 0.0 19 2.0 20 3.0 21 2.0 22 4.0 23 5.0 24 7.0 25 9.0 26 6.0 27 13.0 28 11.0 29 19.0 30 31.0 31 32.0 32 58.0 33 96.0 34 192.0 35 491.0 36 2633.0 37 370.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.875 24.349999999999998 8.05 20.724999999999998 2 26.6 25.575 30.775000000000002 17.05 3 20.849999999999998 28.15 33.050000000000004 17.95 4 23.200000000000003 33.175 25.775 17.849999999999998 5 24.425 37.35 20.9 17.325 6 23.75 36.199999999999996 21.9 18.15 7 19.625 22.275 38.45 19.650000000000002 8 20.674999999999997 26.025 28.549999999999997 24.75 9 21.975 24.8 29.799999999999997 23.425 10-14 22.965 28.610000000000003 27.375 21.05 15-19 23.195 27.57 28.255000000000003 20.979999999999997 20-24 22.915 28.29 28.175 20.62 25-29 23.43 28.410000000000004 27.33 20.830000000000002 30-34 23.095 28.04 28.705000000000002 20.16 35-39 22.96 27.839999999999996 28.67 20.53 40-44 23.405 28.565 28.32 19.71 45-49 23.53 28.125 27.584999999999997 20.76 50-54 23.549999999999997 28.389999999999997 28.485 19.575 55-59 23.189999999999998 28.38 28.24 20.19 60-64 24.044999999999998 27.450000000000003 28.535 19.97 65-69 22.525000000000002 27.92 28.599999999999998 20.955 70-74 23.169999999999998 27.87 28.875 20.085 75-79 23.330000000000002 28.449999999999996 27.98 20.24 80-84 23.575 27.700000000000003 28.16 20.565 85-89 23.544999999999998 28.144999999999996 28.310000000000002 20.0 90-94 23.419999999999998 28.410000000000004 27.935 20.235 95-99 23.599999999999998 28.765 27.700000000000003 19.935 100-104 23.32 28.595 27.905 20.18 105-109 23.74 28.134999999999998 27.66 20.465 110-114 23.66 28.144999999999996 28.21 19.985 115-119 23.77 28.155 28.23 19.845 120-124 24.145 27.51 27.925 20.419999999999998 125-129 23.915 28.12 27.500000000000004 20.465 130-134 24.075 28.215 27.505000000000003 20.205000000000002 135-139 24.21 28.29 27.700000000000003 19.8 140-144 24.915000000000003 28.02 27.025 20.04 145-149 25.235000000000003 28.050000000000004 27.175 19.54 150-151 24.9 28.725 26.400000000000002 19.975 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 2.0 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 0.0 23 1.5 24 3.0 25 2.0 26 2.5 27 7.5 28 13.0 29 12.0 30 15.5 31 30.0 32 39.0 33 45.0 34 57.5 35 71.0 36 88.0 37 126.5 38 168.0 39 179.5 40 197.5 41 229.0 42 231.0 43 237.0 44 257.0 45 267.0 46 271.0 47 262.0 48 235.0 49 204.5 50 169.0 51 137.5 52 110.0 53 81.0 54 57.0 55 36.0 56 30.0 57 29.0 58 27.5 59 16.5 60 7.5 61 6.5 62 6.0 63 5.5 64 4.0 65 2.5 66 0.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 1.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.8 #Duplication Level Percentage of deduplicated Percentage of total 1 91.07929515418502 82.69999999999999 2 7.901982378854626 14.35 3 0.8535242290748899 2.325 4 0.13766519823788548 0.5 5 0.027533039647577095 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.3875 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 1.9874999999999998 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.5250000000000004 0.0 0.0 0.0 0.0 122-123 2.7875 0.0 0.0 0.0 0.0 124-125 3.1375 0.0 0.0 0.0 0.0 126-127 3.4000000000000004 0.0 0.0 0.0 0.0 128-129 3.75 0.0 0.0 0.0 0.0 130-131 4.1125 0.0 0.0 0.0 0.0 132-133 4.449999999999999 0.0 0.0 0.0 0.0 134-135 4.825 0.0 0.0 0.0 0.0 136-137 5.137499999999999 0.0 0.0 0.0 0.0 138-139 5.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 896493 spots for SRR12919357.sra Written 896493 spots for SRR12919357.sra Read 896493 spots for SRR12919357.sra Written 896493 spots for SRR12919357.sra Read 896493 spots for SRR12919357.sra Written 896493 spots for SRR12919357.sra Read 896493 spots for SRR12919357.sra Written 896493 spots for SRR12919357.sra Read 896493 spots for SRR12919357.sra Written 896493 spots for SRR12919357.sra Read 896493 spots for SRR12919357.sra Written 896493 spots for SRR12919357.sra Read 896493 spots for SRR12919357.sra Written 896493 spots for SRR12919357.sra Read 896493 spots for SRR12919357.sra Written 896493 spots for SRR12919357.sra Read 896493 spots for SRR12919357.sra Written 896493 spots for SRR12919357.sra Read 896493 spots for SRR12919357.sra Written 896493 spots for SRR12919357.sra Read 896493 spots for SRR12919357.sra Written 896493 spots for SRR12919357.sra Read 896493 spots for SRR12919357.sra Written 896493 spots for SRR12919357.sra Read 896493 spots for SRR12919357.sra Written 896493 spots for SRR12919357.sra Read 896493 spots for SRR12919357.sra Written 896493 spots for SRR12919357.sra Read 896493 spots for SRR12919357.sra Written 896493 spots for SRR12919357.sra Read 896493 spots for SRR12919357.sra Written 896493 spots for SRR12919357.sra Read 896508 spots for SRR12919357.sra Written 896508 spots for SRR12919357.sra Read 896493 spots for SRR12919357.sra Written 896493 spots for SRR12919357.sra Read 896493 spots for SRR12919357.sra Written 896493 spots for SRR12919357.sra Read 896493 spots for SRR12919357.sra Written 896493 spots for SRR12919357.sra SRR ids: ['SRR12919357.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q8hwqprk SRR12919357.sra spots: 17929875 blocks: [[1, 896493], [896494, 1792986], [1792987, 2689479], [2689480, 3585972], [3585973, 4482465], [4482466, 5378958], [5378959, 6275451], [6275452, 7171944], [7171945, 8068437], [8068438, 8964930], [8964931, 9861423], [9861424, 10757916], [10757917, 11654409], [11654410, 12550902], [12550903, 13447395], [13447396, 14343888], [14343889, 15240381], [15240382, 16136874], [16136875, 17033367], [17033368, 17929875]] SRR12919357 file size 6071655 SRR12919357 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919357 SRR12919357_1.fastq SRR12919357_2.fastq Input file: SRR12919357_1.fastq Paired file: SRR12919357_2.fastq trimmed: SRR12919357-trimmed-pair1.fastq, SRR12919357-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:02:37 2025 >> started Wed Feb 12 20:03:09 2025 >> done (31.369s) 17929875 read pairs processed; of these: 43 ( 0.00%) short read pairs filtered out after trimming by size control 1063 ( 0.01%) empty read pairs filtered out after trimming by size control 17928769 (99.99%) read pairs available; of these: 1672496 ( 9.33%) trimmed read pairs available after processing 16256273 (90.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 9 0.00% 21 7 0.00% 22 4 0.00% 23 10 0.00% 24 8 0.00% 25 7 0.00% 26 8 0.00% 27 12 0.00% 28 15 0.00% 29 10 0.00% 30 17 0.00% 31 9 0.00% 32 18 0.00% 33 12 0.00% 34 17 0.00% 35 16 0.00% 36 20 0.00% 37 19 0.00% 38 25 0.00% 39 22 0.00% 40 31 0.00% 41 25 0.00% 42 21 0.00% 43 32 0.00% 44 44 0.00% 45 24 0.00% 46 29 0.00% 47 41 0.00% 48 38 0.00% 49 56 0.00% 50 68 0.00% 51 73 0.00% 52 74 0.00% 53 74 0.00% 54 79 0.00% 55 85 0.00% 56 97 0.00% 57 92 0.00% 58 132 0.00% 59 125 0.00% 60 177 0.00% 61 184 0.00% 62 242 0.00% 63 256 0.00% 64 245 0.00% 65 287 0.00% 66 279 0.00% 67 310 0.00% 68 317 0.00% 69 451 0.00% 70 480 0.00% 71 575 0.00% 72 772 0.00% 73 826 0.00% 74 871 0.00% 75 953 0.01% 76 987 0.01% 77 1064 0.01% 78 1200 0.01% 79 1293 0.01% 80 1695 0.01% 81 1943 0.01% 82 2330 0.01% 83 2749 0.02% 84 2975 0.02% 85 3136 0.02% 86 3245 0.02% 87 3359 0.02% 88 3632 0.02% 89 3942 0.02% 90 4571 0.03% 91 5073 0.03% 92 5857 0.03% 93 6835 0.04% 94 7412 0.04% 95 7730 0.04% 96 8197 0.05% 97 8208 0.05% 98 8380 0.05% 99 9049 0.05% 100 9753 0.05% 101 10466 0.06% 102 11793 0.07% 103 13022 0.07% 104 13930 0.08% 105 15186 0.08% 106 15253 0.09% 107 15476 0.09% 108 15342 0.09% 109 15576 0.09% 110 16187 0.09% 111 17746 0.10% 112 19303 0.11% 113 20670 0.12% 114 22396 0.12% 115 23547 0.13% 116 23853 0.13% 117 23926 0.13% 118 23582 0.13% 119 23930 0.13% 120 24585 0.14% 121 25329 0.14% 122 27034 0.15% 123 29328 0.16% 124 30743 0.17% 125 32581 0.18% 126 33029 0.18% 127 33283 0.19% 128 32501 0.18% 129 32497 0.18% 130 32849 0.18% 131 33531 0.19% 132 35028 0.20% 133 37242 0.21% 134 39603 0.22% 135 41445 0.23% 136 42090 0.23% 137 42045 0.23% 138 42271 0.24% 139 41769 0.23% 140 41442 0.23% 141 42032 0.23% 142 43412 0.24% 143 44579 0.25% 144 47628 0.27% 145 49214 0.27% 146 50344 0.28% 147 51007 0.28% 148 50352 0.28% 149 49569 0.28% 150 49595 0.28% 151 16256273 90.67% 17928769 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=5.44 fanout-score-rank=19 prefix-density=0.24 prefix-fanout=3.2 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=22.59 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=5.6 sequence=AAGTCCACCAGAACAAAAGATAGCAAAGCATTCAAGGATAAAACTAAAACTAATAAAGCTAGCACTTGCACATCAAGGCCAGCTATTGGCACTCTTCAGCACTTGACCTCCTTCAAAGAAGGGGCAAAGTACAAGAATGTTGGATCGGTAGCACCTTCTTTGTAATAAGCAAAGACCAA criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=37 prefix-density=0.15 prefix-fanout=2.0 sequence=CCAGACCAGCAGAGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=445.41 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=34.2 sequence=AAGAAGAAGAAG SRR12919357 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:04:05 Started mapping on | Feb 12 20:04:06 Finished on | Feb 12 20:07:36 Mapping speed, Million of reads per hour | 307.35 Number of input reads | 17928769 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16314957 Uniquely mapped reads % | 91.00% Average mapped length | 296.13 Number of splices: Total | 15370702 Number of splices: Annotated (sjdb) | 15010487 Number of splices: GT/AG | 15086160 Number of splices: GC/AG | 223134 Number of splices: AT/AC | 14835 Number of splices: Non-canonical | 46573 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 3.09 Insertion rate per base | 0.03% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 418063 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 47358 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.25% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1195749 1195749 1195749 N_multimapping 418063 418063 418063 N_noFeature 662034 16111210 748208 N_ambiguous 220682 969 102552 UnstrandedReadsAssigned:15432241 PositiveStrandReadsAssigned:202778 NegativeStrandReadsAssigned:15464197 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919357 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919357-trimmed-pair1.fastq SRR12919357-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,928,769 reads, 15,547,573 reads pseudoaligned [quant] estimated average fragment length: 267.196 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR12919357.ke.tsv 34699 SRR12919357.se.tsv 87100 total ==> SRR12919357.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.8 477 20.1134 Potri.005G024800.1.v4.1 1035 768.804 166 15.9495 Potri.004G059700.1.v4.1 961 695.121 46 4.88822 Potri.007G009000.2.v4.1 1416 1149.8 0 0 Potri.003G141000.2.v4.1 2943 2676.8 906.96 25.0279 Potri.016G087400.1.v4.1 270 83.0369 922.383 820.528 Potri.015G069301.1.v4.1 564 316.942 0 0 Potri.010G195200.1.v4.1 1773 1506.8 113 5.53956 Potri.012G127500.1.v4.1 977 710.982 5659 587.942 ==> SRR12919357.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 242 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 189 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 4 SRR12919357 completed mapping pipeline successfully