Starting /dee2/code/volunteer_pipeline.sh SRR12919358 current disk space = 3050867048448 free memory = 1580470612 SRR12919358 SRAfilesize 35d4207a89111d3e90e8dd2128c69afb SRR12919358.sra SRR12919358.sra file validated SRR12919358 is paired end SRR12919358 is conventional basespace SRR12919358 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919358_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5155 37.0 37.0 37.0 37.0 37.0 2 36.37225 37.0 37.0 37.0 37.0 37.0 3 36.5745 37.0 37.0 37.0 37.0 37.0 4 36.6645 37.0 37.0 37.0 37.0 37.0 5 36.606 37.0 37.0 37.0 37.0 37.0 6 36.661 37.0 37.0 37.0 37.0 37.0 7 36.6025 37.0 37.0 37.0 37.0 37.0 8 36.613 37.0 37.0 37.0 37.0 37.0 9 36.6235 37.0 37.0 37.0 37.0 37.0 10-14 36.6472 37.0 37.0 37.0 37.0 37.0 15-19 36.6244 37.0 37.0 37.0 37.0 37.0 20-24 36.599599999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.58710000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.5493 37.0 37.0 37.0 37.0 37.0 35-39 36.5247 37.0 37.0 37.0 37.0 37.0 40-44 36.499100000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.4689 37.0 37.0 37.0 37.0 37.0 50-54 36.4721 37.0 37.0 37.0 37.0 37.0 55-59 36.461 37.0 37.0 37.0 37.0 37.0 60-64 36.4093 37.0 37.0 37.0 37.0 37.0 65-69 36.4634 37.0 37.0 37.0 37.0 37.0 70-74 36.389 37.0 37.0 37.0 37.0 37.0 75-79 36.3352 37.0 37.0 37.0 37.0 37.0 80-84 36.3203 37.0 37.0 37.0 37.0 37.0 85-89 36.2528 37.0 37.0 37.0 37.0 37.0 90-94 36.2265 37.0 37.0 37.0 37.0 37.0 95-99 36.2538 37.0 37.0 37.0 37.0 37.0 100-104 36.2657 37.0 37.0 37.0 37.0 37.0 105-109 36.1746 37.0 37.0 37.0 37.0 37.0 110-114 36.115700000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.112700000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.0944 37.0 37.0 37.0 37.0 37.0 125-129 36.0152 37.0 37.0 37.0 37.0 37.0 130-134 36.0106 37.0 37.0 37.0 37.0 37.0 135-139 35.910399999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8189 37.0 37.0 37.0 37.0 37.0 145-149 35.7971 37.0 37.0 37.0 37.0 37.0 150-151 35.730999999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 0.0 24 2.0 25 2.0 26 3.0 27 4.0 28 5.0 29 13.0 30 23.0 31 38.0 32 35.0 33 65.0 34 113.0 35 324.0 36 2992.0 37 379.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.65 13.675 5.875 38.800000000000004 2 20.38664323374341 13.030379111222695 34.973637961335676 31.609339693698217 3 16.35 17.675 30.4 35.575 4 21.325 25.0 25.224999999999998 28.449999999999996 5 22.3 31.275 24.975 21.45 6 19.775000000000002 35.225 24.349999999999998 20.65 7 14.424999999999999 27.450000000000003 40.35 17.775 8 17.325 26.450000000000003 31.7 24.525 9 17.075000000000003 24.425 35.725 22.775000000000002 10-14 19.48 30.15 28.110000000000003 22.259999999999998 15-19 19.794999999999998 28.955 28.425 22.825 20-24 19.650000000000002 28.32 28.205000000000002 23.825 25-29 19.62 28.63 28.144999999999996 23.605 30-34 19.650000000000002 29.21 27.42 23.72 35-39 19.939999999999998 28.854999999999997 27.99 23.215 40-44 19.900000000000002 29.060000000000002 27.229999999999997 23.810000000000002 45-49 20.395 28.754999999999995 27.525 23.325000000000003 50-54 19.785 28.88 28.050000000000004 23.285 55-59 20.61 28.625 27.0 23.765 60-64 20.27 28.42 27.584999999999997 23.724999999999998 65-69 19.805 28.595 27.900000000000002 23.7 70-74 19.384999999999998 28.92 27.865000000000002 23.830000000000002 75-79 19.82 29.12 27.655 23.405 80-84 20.515 28.904999999999998 27.500000000000004 23.080000000000002 85-89 19.875 28.694999999999997 27.839999999999996 23.59 90-94 19.685 28.744999999999997 27.57 24.0 95-99 20.105 28.744999999999997 28.060000000000002 23.09 100-104 20.11 28.7 27.935 23.255 105-109 20.25 28.725 27.725 23.3 110-114 20.200000000000003 28.895 27.439999999999998 23.465 115-119 20.330000000000002 29.09 27.305 23.275000000000002 120-124 20.215 28.605000000000004 27.445000000000004 23.735 125-129 20.47 27.950000000000003 27.775 23.805 130-134 20.07 29.160000000000004 27.22 23.549999999999997 135-139 20.979999999999997 28.42 26.895000000000003 23.705000000000002 140-144 19.865 28.904999999999998 27.13 24.099999999999998 145-149 20.875 28.685 27.015 23.425 150-151 21.6 28.237499999999997 26.787499999999998 23.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 5.5 26 8.0 27 10.5 28 13.0 29 14.5 30 17.0 31 22.5 32 38.5 33 46.5 34 57.0 35 79.0 36 102.5 37 118.5 38 140.5 39 163.5 40 188.0 41 230.5 42 252.0 43 258.0 44 261.5 45 266.5 46 259.5 47 254.5 48 234.5 49 190.0 50 163.5 51 142.5 52 117.0 53 87.5 54 67.5 55 50.5 56 33.0 57 29.0 58 23.0 59 14.5 60 11.5 61 8.0 62 4.0 63 2.0 64 2.5 65 1.5 66 1.5 67 1.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.42500000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.225 #Duplication Level Percentage of deduplicated Percentage of total 1 91.4497122499315 83.42500000000001 2 7.5363113181693615 13.750000000000002 3 0.959166895039737 2.625 4 0.054809536859413546 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.6000000000000001 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.7125 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.175 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.7375 0.0 0.0 0.0 0.0 118-119 1.9375 0.0 0.0 0.0 0.0 120-121 2.0875 0.0 0.0 0.0 0.0 122-123 2.4749999999999996 0.0 0.0 0.0 0.0 124-125 2.8375 0.0 0.0 0.0 0.0 126-127 3.1624999999999996 0.0 0.0 0.0 0.0 128-129 3.675 0.0 0.0 0.0 0.0 130-131 3.9625 0.0 0.0 0.0 0.0 132-133 4.4625 0.0 0.0 0.0 0.0 134-135 4.95 0.0 0.0 0.0 0.0 136-137 5.300000000000001 0.0 0.0 0.0 0.0 138-139 5.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACATTG 10 0.0068343505 144.975 5 >>END_MODULE SRR12919358 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919358_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1895 37.0 37.0 37.0 37.0 37.0 2 36.234 37.0 37.0 37.0 37.0 37.0 3 36.2705 37.0 37.0 37.0 37.0 37.0 4 36.333 37.0 37.0 37.0 37.0 37.0 5 36.305 37.0 37.0 37.0 37.0 37.0 6 36.211 37.0 37.0 37.0 37.0 37.0 7 36.2445 37.0 37.0 37.0 37.0 37.0 8 36.3815 37.0 37.0 37.0 37.0 37.0 9 36.262 37.0 37.0 37.0 37.0 37.0 10-14 36.319500000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.3096 37.0 37.0 37.0 37.0 37.0 20-24 36.242599999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.1513 37.0 37.0 37.0 37.0 37.0 30-34 36.122 37.0 37.0 37.0 37.0 37.0 35-39 36.1389 37.0 37.0 37.0 37.0 37.0 40-44 36.1075 37.0 37.0 37.0 37.0 37.0 45-49 36.0524 37.0 37.0 37.0 37.0 37.0 50-54 36.0757 37.0 37.0 37.0 37.0 37.0 55-59 36.0479 37.0 37.0 37.0 37.0 37.0 60-64 35.99 37.0 37.0 37.0 37.0 37.0 65-69 35.9634 37.0 37.0 37.0 37.0 37.0 70-74 35.9658 37.0 37.0 37.0 37.0 37.0 75-79 35.8604 37.0 37.0 37.0 37.0 37.0 80-84 35.8603 37.0 37.0 37.0 37.0 37.0 85-89 35.924899999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.8412 37.0 37.0 37.0 37.0 37.0 95-99 35.7913 37.0 37.0 37.0 37.0 37.0 100-104 35.8023 37.0 37.0 37.0 37.0 37.0 105-109 35.8005 37.0 37.0 37.0 37.0 37.0 110-114 35.773199999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.7262 37.0 37.0 37.0 37.0 37.0 120-124 35.6075 37.0 37.0 37.0 37.0 37.0 125-129 35.689800000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.4788 37.0 37.0 37.0 37.0 37.0 135-139 35.3891 37.0 37.0 37.0 37.0 37.0 140-144 35.4518 37.0 37.0 37.0 37.0 37.0 145-149 35.2879 37.0 37.0 37.0 29.8 37.0 150-151 35.14825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 0.0 14 4.0 15 2.0 16 1.0 17 1.0 18 0.0 19 3.0 20 2.0 21 4.0 22 5.0 23 4.0 24 6.0 25 3.0 26 6.0 27 7.0 28 17.0 29 16.0 30 26.0 31 37.0 32 62.0 33 113.0 34 219.0 35 573.0 36 2594.0 37 293.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.125 25.825 9.45 24.6 2 26.325 27.474999999999998 30.975 15.225 3 20.9 27.200000000000003 33.625 18.275 4 23.65 34.075 24.5 17.775 5 24.175 37.75 21.525 16.55 6 21.125 39.6 21.9 17.375 7 20.4 22.375 39.275 17.95 8 21.45 25.15 29.299999999999997 24.099999999999998 9 21.6 23.275000000000002 30.75 24.375 10-14 23.27 29.080000000000002 27.455000000000002 20.195 15-19 23.705000000000002 28.04 27.575 20.68 20-24 23.35 28.92 27.860000000000003 19.869999999999997 25-29 23.04 28.79 28.18 19.99 30-34 23.105 27.589999999999996 28.804999999999996 20.5 35-39 22.67 27.765 28.705000000000002 20.86 40-44 22.875 27.71 29.005 20.41 45-49 22.91 27.355 29.035 20.7 50-54 23.96 27.515 28.194999999999997 20.330000000000002 55-59 23.715 28.49 27.88 19.915 60-64 22.5 28.215 28.565 20.72 65-69 23.64 27.834999999999997 28.035 20.49 70-74 23.705000000000002 27.82 28.285 20.19 75-79 22.93 28.07 29.18 19.82 80-84 23.595 28.199999999999996 27.845 20.36 85-89 24.060000000000002 27.900000000000002 27.985 20.055 90-94 23.175 27.689999999999998 28.599999999999998 20.535 95-99 22.96 27.755000000000003 28.71 20.575 100-104 24.095 27.675 28.439999999999998 19.79 105-109 23.265 27.99 28.115000000000002 20.630000000000003 110-114 23.419999999999998 27.62 28.305000000000003 20.655 115-119 22.975 29.060000000000002 28.28 19.685 120-124 24.09 28.58 27.305 20.025000000000002 125-129 23.724999999999998 28.470000000000002 27.735 20.07 130-134 24.635 28.26 27.715 19.39 135-139 24.245 27.944999999999997 28.035 19.775000000000002 140-144 24.740000000000002 28.144999999999996 27.395000000000003 19.72 145-149 24.495 28.384999999999998 27.224999999999998 19.895 150-151 25.974999999999998 28.075 26.674999999999997 19.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 1.5 20 1.5 21 3.0 22 2.0 23 3.0 24 5.5 25 6.0 26 6.5 27 6.5 28 10.0 29 15.0 30 18.5 31 24.5 32 32.0 33 36.5 34 47.0 35 72.5 36 87.5 37 107.5 38 152.5 39 176.5 40 203.5 41 250.5 42 281.5 43 281.5 44 273.5 45 261.5 46 249.0 47 246.0 48 232.0 49 199.5 50 150.5 51 120.0 52 104.5 53 83.5 54 61.5 55 47.5 56 32.5 57 21.5 58 20.0 59 14.0 60 9.5 61 9.5 62 6.0 63 5.0 64 5.5 65 1.5 66 0.5 67 0.5 68 0.0 69 2.0 70 2.0 71 0.0 72 0.0 73 0.0 74 0.5 75 1.0 76 1.0 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.45 #Duplication Level Percentage of deduplicated Percentage of total 1 91.58009841443412 83.75 2 7.54510661563696 13.8 3 0.8201202843083653 2.25 4 0.054674685620557675 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.6000000000000001 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.7125 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.175 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.7375 0.0 0.0 0.0 0.0 118-119 1.9375 0.0 0.0 0.0 0.0 120-121 2.0875 0.0 0.0 0.0 0.0 122-123 2.4875 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.1875 0.0 0.0 0.0 0.0 128-129 3.7249999999999996 0.0 0.0 0.0 0.0 130-131 4.0 0.0 0.0 0.0 0.0 132-133 4.487500000000001 0.0 0.0 0.0 0.0 134-135 4.975 0.0 0.0 0.0 0.0 136-137 5.3375 0.0 0.0 0.0 0.0 138-139 5.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 976015 spots for SRR12919358.sra Written 976015 spots for SRR12919358.sra Read 976015 spots for SRR12919358.sra Written 976015 spots for SRR12919358.sra Read 976015 spots for SRR12919358.sra Written 976015 spots for SRR12919358.sra Read 976015 spots for SRR12919358.sra Written 976015 spots for SRR12919358.sra Read 976015 spots for SRR12919358.sra Written 976015 spots for SRR12919358.sra Read 976015 spots for SRR12919358.sra Written 976015 spots for SRR12919358.sra Read 976015 spots for SRR12919358.sra Written 976015 spots for SRR12919358.sra Read 976015 spots for SRR12919358.sra Written 976015 spots for SRR12919358.sra Read 976015 spots for SRR12919358.sra Written 976015 spots for SRR12919358.sra Read 976015 spots for SRR12919358.sra Written 976015 spots for SRR12919358.sra Read 976015 spots for SRR12919358.sra Written 976015 spots for SRR12919358.sra Read 976015 spots for SRR12919358.sra Written 976015 spots for SRR12919358.sra Read 976015 spots for SRR12919358.sra Written 976015 spots for SRR12919358.sra Read 976015 spots for SRR12919358.sra Written 976015 spots for SRR12919358.sra Read 976015 spots for SRR12919358.sra Written 976015 spots for SRR12919358.sra Read 976015 spots for SRR12919358.sra Written 976015 spots for SRR12919358.sra Read 976015 spots for SRR12919358.sra Written 976015 spots for SRR12919358.sra Read 976015 spots for SRR12919358.sra Written 976015 spots for SRR12919358.sra Read 976015 spots for SRR12919358.sra Written 976015 spots for SRR12919358.sra Read 976030 spots for SRR12919358.sra Written 976030 spots for SRR12919358.sra SRR ids: ['SRR12919358.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sfchh4wv SRR12919358.sra spots: 19520315 blocks: [[1, 976015], [976016, 1952030], [1952031, 2928045], [2928046, 3904060], [3904061, 4880075], [4880076, 5856090], [5856091, 6832105], [6832106, 7808120], [7808121, 8784135], [8784136, 9760150], [9760151, 10736165], [10736166, 11712180], [11712181, 12688195], [12688196, 13664210], [13664211, 14640225], [14640226, 15616240], [15616241, 16592255], [16592256, 17568270], [17568271, 18544285], [18544286, 19520315]] SRR12919358 file size 6612156 SRR12919358 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919358 SRR12919358_1.fastq SRR12919358_2.fastq Input file: SRR12919358_1.fastq Paired file: SRR12919358_2.fastq trimmed: SRR12919358-trimmed-pair1.fastq, SRR12919358-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:38:04 2025 >> started Wed Feb 12 20:38:26 2025 >> done (21.043s) 19520315 read pairs processed; of these: 28 ( 0.00%) short read pairs filtered out after trimming by size control 340 ( 0.00%) empty read pairs filtered out after trimming by size control 19519947 (100.00%) read pairs available; of these: 1951644 (10.00%) trimmed read pairs available after processing 17568303 (90.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 5 0.00% 21 6 0.00% 22 9 0.00% 23 7 0.00% 24 6 0.00% 25 15 0.00% 26 5 0.00% 27 10 0.00% 28 11 0.00% 29 17 0.00% 30 13 0.00% 31 14 0.00% 32 19 0.00% 33 8 0.00% 34 12 0.00% 35 18 0.00% 36 20 0.00% 37 12 0.00% 38 19 0.00% 39 18 0.00% 40 29 0.00% 41 15 0.00% 42 13 0.00% 43 18 0.00% 44 26 0.00% 45 30 0.00% 46 20 0.00% 47 47 0.00% 48 23 0.00% 49 42 0.00% 50 38 0.00% 51 48 0.00% 52 75 0.00% 53 70 0.00% 54 64 0.00% 55 62 0.00% 56 83 0.00% 57 75 0.00% 58 108 0.00% 59 122 0.00% 60 151 0.00% 61 156 0.00% 62 153 0.00% 63 205 0.00% 64 221 0.00% 65 230 0.00% 66 243 0.00% 67 267 0.00% 68 353 0.00% 69 398 0.00% 70 460 0.00% 71 555 0.00% 72 693 0.00% 73 753 0.00% 74 895 0.00% 75 905 0.00% 76 1009 0.01% 77 1135 0.01% 78 1260 0.01% 79 1417 0.01% 80 1639 0.01% 81 1979 0.01% 82 2303 0.01% 83 2565 0.01% 84 2839 0.01% 85 3182 0.02% 86 3590 0.02% 87 3937 0.02% 88 4129 0.02% 89 4668 0.02% 90 5094 0.03% 91 5769 0.03% 92 6396 0.03% 93 7167 0.04% 94 7911 0.04% 95 8459 0.04% 96 9143 0.05% 97 9806 0.05% 98 10379 0.05% 99 10850 0.06% 100 11530 0.06% 101 12393 0.06% 102 13606 0.07% 103 14773 0.08% 104 15580 0.08% 105 16794 0.09% 106 17389 0.09% 107 18328 0.09% 108 19046 0.10% 109 20047 0.10% 110 20425 0.10% 111 21273 0.11% 112 22778 0.12% 113 23545 0.12% 114 25382 0.13% 115 26328 0.13% 116 27164 0.14% 117 28158 0.14% 118 29007 0.15% 119 29244 0.15% 120 29997 0.15% 121 31188 0.16% 122 32328 0.17% 123 33452 0.17% 124 35953 0.18% 125 36402 0.19% 126 37880 0.19% 127 39216 0.20% 128 38965 0.20% 129 39774 0.20% 130 40571 0.21% 131 41126 0.21% 132 42840 0.22% 133 44134 0.23% 134 45119 0.23% 135 46672 0.24% 136 48175 0.25% 137 48791 0.25% 138 48795 0.25% 139 49243 0.25% 140 49447 0.25% 141 50824 0.26% 142 51900 0.27% 143 52815 0.27% 144 54871 0.28% 145 55737 0.29% 146 56579 0.29% 147 57420 0.29% 148 57813 0.30% 149 57626 0.30% 150 58682 0.30% 151 17568303 90.00% 19519947 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=6.83 fanout-score-rank=30 prefix-density=0.34 prefix-fanout=4.0 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=442.70 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=33.5 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=11.09 fanout-score-rank=14 prefix-density=0.31 prefix-fanout=6.1 sequence=TTTGACAAGAAGCAGTTTCTTACACAGATTAAGAAATTTATCAAGAATCTGTCGGAGAAACTTGATGAGGACCAGAAGGAACATTTTAGAAAGAACATTGAGGGAGCAACCAAGTTCTTGCTTTCAAAAATCAAGGACTTGCAATTCTTTGTGGGGGAGAGCATGCATGATGATGGTTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=16 fanout-score=422.36 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=34.9 sequence=AAGAAGAAGAAA SRR12919358 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:39:17 Started mapping on | Feb 12 20:39:26 Finished on | Feb 12 20:41:31 Mapping speed, Million of reads per hour | 562.17 Number of input reads | 19519947 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18210350 Uniquely mapped reads % | 93.29% Average mapped length | 295.99 Number of splices: Total | 16801279 Number of splices: Annotated (sjdb) | 16386090 Number of splices: GT/AG | 16479769 Number of splices: GC/AG | 252247 Number of splices: AT/AC | 18077 Number of splices: Non-canonical | 51186 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.94 Insertion rate per base | 0.03% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 465911 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 70449 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.80% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 843686 843686 843686 N_multimapping 465911 465911 465911 N_noFeature 794013 17987725 888157 N_ambiguous 234973 952 106113 UnstrandedReadsAssigned:17181364 PositiveStrandReadsAssigned:221673 NegativeStrandReadsAssigned:17216080 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919358 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919358-trimmed-pair1.fastq SRR12919358-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,519,947 reads, 17,291,882 reads pseudoaligned [quant] estimated average fragment length: 261.978 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52401 SRR12919358.ke.tsv 34699 SRR12919358.se.tsv 87100 total ==> SRR12919358.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.02 571 20.3611 Potri.005G024800.1.v4.1 1035 774.022 222 17.9698 Potri.004G059700.1.v4.1 961 700.235 41 3.66845 Potri.007G009000.2.v4.1 1416 1155.02 0 0 Potri.003G141000.2.v4.1 2943 2682.02 632.166 14.7677 Potri.016G087400.1.v4.1 270 84.4338 1059 785.819 Potri.015G069301.1.v4.1 564 318.065 0 0 Potri.010G195200.1.v4.1 1773 1512.02 64 2.65195 Potri.012G127500.1.v4.1 977 716.148 10287 899.972 ==> SRR12919358.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 230 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 112 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 5 SRR12919358 completed mapping pipeline successfully