Starting /dee2/code/volunteer_pipeline.sh SRR12919359 current disk space = 3050867048448 free memory = 1580484124 SRR12919359 SRAfilesize 1e1dcfffcfc7cd285947ce23f15306e3 SRR12919359.sra SRR12919359.sra file validated SRR12919359 is paired end SRR12919359 is conventional basespace SRR12919359 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919359_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6465 37.0 37.0 37.0 37.0 37.0 2 36.326 37.0 37.0 37.0 37.0 37.0 3 36.688 37.0 37.0 37.0 37.0 37.0 4 36.629 37.0 37.0 37.0 37.0 37.0 5 36.667 37.0 37.0 37.0 37.0 37.0 6 36.679 37.0 37.0 37.0 37.0 37.0 7 36.6885 37.0 37.0 37.0 37.0 37.0 8 36.6115 37.0 37.0 37.0 37.0 37.0 9 36.652 37.0 37.0 37.0 37.0 37.0 10-14 36.689600000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.6833 37.0 37.0 37.0 37.0 37.0 20-24 36.629999999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.604 37.0 37.0 37.0 37.0 37.0 30-34 36.5994 37.0 37.0 37.0 37.0 37.0 35-39 36.5805 37.0 37.0 37.0 37.0 37.0 40-44 36.5298 37.0 37.0 37.0 37.0 37.0 45-49 36.5159 37.0 37.0 37.0 37.0 37.0 50-54 36.4979 37.0 37.0 37.0 37.0 37.0 55-59 36.4589 37.0 37.0 37.0 37.0 37.0 60-64 36.4542 37.0 37.0 37.0 37.0 37.0 65-69 36.398 37.0 37.0 37.0 37.0 37.0 70-74 36.3774 37.0 37.0 37.0 37.0 37.0 75-79 36.3365 37.0 37.0 37.0 37.0 37.0 80-84 36.4151 37.0 37.0 37.0 37.0 37.0 85-89 36.27470000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.3007 37.0 37.0 37.0 37.0 37.0 95-99 36.2802 37.0 37.0 37.0 37.0 37.0 100-104 36.240300000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.227799999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.1274 37.0 37.0 37.0 37.0 37.0 115-119 36.160199999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.123900000000006 37.0 37.0 37.0 37.0 37.0 125-129 36.00319999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.9808 37.0 37.0 37.0 37.0 37.0 135-139 35.911500000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.8078 37.0 37.0 37.0 37.0 37.0 145-149 35.8014 37.0 37.0 37.0 37.0 37.0 150-151 35.587500000000006 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 0.0 21 1.0 22 1.0 23 0.0 24 2.0 25 1.0 26 2.0 27 4.0 28 11.0 29 11.0 30 27.0 31 28.0 32 40.0 33 63.0 34 116.0 35 286.0 36 2917.0 37 488.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.075 13.275 4.95 35.699999999999996 2 18.382722250125568 12.255148166750377 38.52335509794073 30.838774485183322 3 17.375 17.724999999999998 28.975 35.925000000000004 4 21.2 24.95 26.1 27.750000000000004 5 22.675 31.775 23.7 21.85 6 19.825 34.050000000000004 24.425 21.7 7 13.4 29.525000000000002 40.75 16.325 8 15.9 26.875 32.875 24.349999999999998 9 18.05 24.65 34.050000000000004 23.25 10-14 20.07 30.345 27.04 22.545 15-19 19.78 28.265 28.15 23.805 20-24 19.355 28.725 27.91 24.01 25-29 19.555 28.88 27.915 23.65 30-34 19.825 28.444999999999997 27.800000000000004 23.93 35-39 19.48 28.95 27.715 23.855 40-44 20.07 29.270000000000003 26.955000000000002 23.705000000000002 45-49 20.365 28.7 27.245 23.69 50-54 20.19 28.744999999999997 27.755000000000003 23.31 55-59 20.185 28.395 27.705000000000002 23.715 60-64 20.075000000000003 28.33 27.445000000000004 24.15 65-69 19.945 28.939999999999998 27.55 23.565 70-74 20.044999999999998 28.9 27.57 23.485 75-79 20.27 28.465 27.215 24.05 80-84 19.830000000000002 28.970000000000002 27.66 23.54 85-89 20.13 28.799999999999997 27.560000000000002 23.51 90-94 20.345 28.93 27.3 23.425 95-99 20.1 28.465 27.615000000000002 23.82 100-104 20.25 28.27 27.700000000000003 23.78 105-109 20.105 28.985 27.415 23.494999999999997 110-114 20.165 29.115000000000002 27.22 23.5 115-119 20.82 28.655 26.834999999999997 23.69 120-124 20.665 28.34 27.345000000000002 23.65 125-129 20.97 29.205 26.650000000000002 23.175 130-134 21.265 28.73 26.700000000000003 23.305 135-139 20.805 28.435 26.5 24.26 140-144 21.7 27.91 26.75 23.64 145-149 21.485000000000003 28.634999999999998 26.39 23.49 150-151 21.087500000000002 28.8625 26.2125 23.8375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 1.5 22 2.5 23 1.0 24 2.5 25 5.5 26 10.0 27 11.0 28 9.0 29 12.0 30 18.0 31 24.5 32 29.5 33 44.5 34 65.5 35 76.0 36 102.5 37 126.0 38 134.0 39 170.0 40 193.0 41 218.5 42 246.5 43 251.5 44 262.0 45 257.5 46 242.0 47 228.0 48 210.5 49 195.5 50 166.0 51 136.5 52 121.0 53 99.5 54 77.0 55 57.5 56 42.5 57 30.0 58 23.0 59 21.5 60 20.0 61 15.0 62 12.5 63 8.5 64 5.5 65 3.5 66 2.0 67 3.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.52224371373308 81.89999999999999 2 8.51063829787234 15.4 3 0.8842221608179055 2.4 4 0.08289582757667864 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.7250000000000001 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 1.075 0.0 0.0 0.0 0.0 98-99 1.3250000000000002 0.0 0.0 0.0 0.0 100-101 1.6 0.0 0.0 0.0 0.0 102-103 1.775 0.0 0.0 0.0 0.0 104-105 2.025 0.0 0.0 0.0 0.0 106-107 2.425 0.0 0.0 0.0 0.0 108-109 2.7625 0.0 0.0 0.0 0.0 110-111 3.15 0.0 0.0 0.0 0.0 112-113 3.6 0.0 0.0 0.0 0.0 114-115 4.012499999999999 0.0 0.0 0.0 0.0 116-117 4.475 0.0 0.0 0.0 0.0 118-119 4.85 0.0 0.0 0.0 0.0 120-121 5.1625 0.0 0.0 0.0 0.0 122-123 5.7875 0.0 0.0 0.0 0.0 124-125 6.2875 0.0 0.0 0.0 0.0 126-127 7.15 0.0 0.0 0.0 0.0 128-129 8.1125 0.0 0.0 0.0 0.0 130-131 8.925 0.0 0.0 0.0 0.0 132-133 9.7375 0.0 0.0 0.0 0.0 134-135 10.3625 0.0 0.0 0.0 0.0 136-137 11.1 0.0 0.0 0.0 0.0 138-139 11.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAAACC 10 0.006830828 145.0 6 >>END_MODULE SRR12919359 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919359_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1755 37.0 37.0 37.0 37.0 37.0 2 36.1745 37.0 37.0 37.0 37.0 37.0 3 36.3165 37.0 37.0 37.0 37.0 37.0 4 36.289 37.0 37.0 37.0 37.0 37.0 5 36.3515 37.0 37.0 37.0 37.0 37.0 6 36.2565 37.0 37.0 37.0 37.0 37.0 7 36.25 37.0 37.0 37.0 37.0 37.0 8 36.299 37.0 37.0 37.0 37.0 37.0 9 36.3225 37.0 37.0 37.0 37.0 37.0 10-14 36.306599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.2759 37.0 37.0 37.0 37.0 37.0 20-24 36.273 37.0 37.0 37.0 37.0 37.0 25-29 36.1695 37.0 37.0 37.0 37.0 37.0 30-34 36.1462 37.0 37.0 37.0 37.0 37.0 35-39 36.138099999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.1407 37.0 37.0 37.0 37.0 37.0 45-49 36.1934 37.0 37.0 37.0 37.0 37.0 50-54 36.1371 37.0 37.0 37.0 37.0 37.0 55-59 36.084199999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.012 37.0 37.0 37.0 37.0 37.0 65-69 36.027499999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.9988 37.0 37.0 37.0 37.0 37.0 75-79 35.9642 37.0 37.0 37.0 37.0 37.0 80-84 35.918600000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.906800000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.8594 37.0 37.0 37.0 37.0 37.0 95-99 35.8321 37.0 37.0 37.0 37.0 37.0 100-104 35.8393 37.0 37.0 37.0 37.0 37.0 105-109 35.7232 37.0 37.0 37.0 37.0 37.0 110-114 35.8031 37.0 37.0 37.0 37.0 37.0 115-119 35.7581 37.0 37.0 37.0 37.0 37.0 120-124 35.73700000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.732099999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.5817 37.0 37.0 37.0 37.0 37.0 135-139 35.4579 37.0 37.0 37.0 37.0 37.0 140-144 35.408300000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.189499999999995 37.0 37.0 37.0 29.8 37.0 150-151 35.153499999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 3.0 14 3.0 15 2.0 16 2.0 17 1.0 18 4.0 19 2.0 20 2.0 21 3.0 22 2.0 23 7.0 24 6.0 25 3.0 26 6.0 27 11.0 28 9.0 29 26.0 30 19.0 31 36.0 32 49.0 33 77.0 34 194.0 35 527.0 36 2761.0 37 244.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.300000000000004 25.05 6.6000000000000005 23.05 2 26.224999999999998 25.775 31.5 16.5 3 20.0 26.8 35.6 17.599999999999998 4 25.3 31.125000000000004 24.675 18.9 5 26.05 36.5 20.8 16.650000000000002 6 21.8 37.824999999999996 23.05 17.325 7 20.5 23.799999999999997 37.45 18.25 8 21.3 26.900000000000002 27.750000000000004 24.05 9 22.1 23.3 30.125 24.474999999999998 10-14 23.905 29.375 26.0 20.72 15-19 24.07 28.59 27.295 20.044999999999998 20-24 23.325000000000003 28.945 27.255000000000003 20.474999999999998 25-29 23.5 28.655 27.765 20.080000000000002 30-34 23.455000000000002 28.465 27.694999999999997 20.385 35-39 23.36 28.625 27.46 20.555 40-44 23.255 28.970000000000002 27.62 20.155 45-49 22.805 28.939999999999998 28.194999999999997 20.06 50-54 23.400000000000002 27.884999999999998 28.46 20.255000000000003 55-59 23.385 28.95 27.87 19.794999999999998 60-64 23.244999999999997 28.355000000000004 28.04 20.36 65-69 24.285 27.665 27.805000000000003 20.244999999999997 70-74 23.49 27.97 28.22 20.32 75-79 23.26 28.655 27.685 20.4 80-84 23.745 28.07 27.785 20.4 85-89 23.56 28.134999999999998 27.74 20.565 90-94 23.925 28.1 27.99 19.985 95-99 23.335 27.060000000000002 28.79 20.815 100-104 23.915 28.305000000000003 28.110000000000003 19.67 105-109 23.825 28.46 27.61 20.105 110-114 24.990000000000002 27.994999999999997 27.095000000000002 19.919999999999998 115-119 24.075 28.849999999999998 27.16 19.915 120-124 25.009999999999998 28.244999999999997 26.634999999999998 20.11 125-129 25.624999999999996 28.425 26.815 19.134999999999998 130-134 25.885 28.505000000000003 26.534999999999997 19.075 135-139 26.355 28.165000000000003 26.490000000000002 18.990000000000002 140-144 27.200000000000003 28.194999999999997 25.86 18.745 145-149 27.744999999999997 27.900000000000002 25.745 18.61 150-151 28.287499999999998 28.037499999999998 26.2125 17.4625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.5 9 1.5 10 1.0 11 0.0 12 1.0 13 1.5 14 1.5 15 1.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 0.0 22 0.5 23 2.0 24 3.0 25 2.5 26 5.0 27 6.0 28 9.5 29 14.5 30 15.0 31 17.0 32 28.0 33 39.5 34 44.0 35 62.5 36 98.0 37 120.0 38 138.5 39 184.0 40 206.0 41 224.5 42 274.0 43 297.0 44 281.0 45 265.0 46 252.5 47 235.0 48 216.0 49 189.5 50 159.0 51 124.5 52 104.0 53 86.5 54 68.5 55 52.0 56 38.5 57 29.0 58 20.5 59 14.0 60 7.0 61 5.0 62 6.5 63 8.5 64 6.5 65 4.0 66 1.5 67 2.0 68 2.5 69 2.0 70 1.0 71 2.0 72 2.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 1.0 93 1.0 94 0.5 95 0.5 96 0.5 97 0.5 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.925 #Duplication Level Percentage of deduplicated Percentage of total 1 91.06406378883696 82.8 2 8.001099807533683 14.549999999999999 3 0.8523508386032445 2.325 4 0.05499037668408029 0.2 5 0.027495188342040146 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8500000000000001 0.0 0.0 0.0 0.0 96-97 1.05 0.0 0.0 0.0 0.0 98-99 1.2999999999999998 0.0 0.0 0.0 0.0 100-101 1.575 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 2.0 0.0 0.0 0.0 0.0 106-107 2.3875 0.0 0.0 0.0 0.0 108-109 2.7125 0.0 0.0 0.0 0.0 110-111 3.1 0.0 0.0 0.0 0.0 112-113 3.55 0.0 0.0 0.0 0.0 114-115 3.9625 0.0 0.0 0.0 0.0 116-117 4.449999999999999 0.0 0.0 0.0 0.0 118-119 4.85 0.0 0.0 0.0 0.0 120-121 5.1625 0.0 0.0 0.0 0.0 122-123 5.7875 0.0 0.0 0.0 0.0 124-125 6.3125 0.0 0.0 0.0 0.0 126-127 7.175000000000001 0.0 0.0 0.0 0.0 128-129 8.125 0.0 0.0 0.0 0.0 130-131 8.925 0.0 0.0 0.0 0.0 132-133 9.7375 0.0 0.0 0.0 0.0 134-135 10.3625 0.0 0.0 0.0 0.0 136-137 11.1 0.0 0.0 0.0 0.0 138-139 11.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTACTC 10 0.006830828 145.0 8 AGGATCT 10 0.006830828 145.0 1 GGATCTT 10 0.006830828 145.0 2 TTTTCGA 10 0.006830828 145.0 7 >>END_MODULE Read 802557 spots for SRR12919359.sra Written 802557 spots for SRR12919359.sra Read 802557 spots for SRR12919359.sra Written 802557 spots for SRR12919359.sra Read 802557 spots for SRR12919359.sra Written 802557 spots for SRR12919359.sra Read 802557 spots for SRR12919359.sra Written 802557 spots for SRR12919359.sra Read 802557 spots for SRR12919359.sra Written 802557 spots for SRR12919359.sra Read 802557 spots for SRR12919359.sra Written 802557 spots for SRR12919359.sra Read 802557 spots for SRR12919359.sra Written 802557 spots for SRR12919359.sra Read 802557 spots for SRR12919359.sra Written 802557 spots for SRR12919359.sra Read 802557 spots for SRR12919359.sra Written 802557 spots for SRR12919359.sra Read 802557 spots for SRR12919359.sra Written 802557 spots for SRR12919359.sra Read 802557 spots for SRR12919359.sra Written 802557 spots for SRR12919359.sra Read 802557 spots for SRR12919359.sra Written 802557 spots for SRR12919359.sra Read 802574 spots for SRR12919359.sra Written 802574 spots for SRR12919359.sra Read 802557 spots for SRR12919359.sra Written 802557 spots for SRR12919359.sra Read 802557 spots for SRR12919359.sra Written 802557 spots for SRR12919359.sra Read 802557 spots for SRR12919359.sra Written 802557 spots for SRR12919359.sra Read 802557 spots for SRR12919359.sra Written 802557 spots for SRR12919359.sra Read 802557 spots for SRR12919359.sra Written 802557 spots for SRR12919359.sra Read 802557 spots for SRR12919359.sra Written 802557 spots for SRR12919359.sra Read 802557 spots for SRR12919359.sra Written 802557 spots for SRR12919359.sra SRR ids: ['SRR12919359.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nq09fk2e SRR12919359.sra spots: 16051157 blocks: [[1, 802557], [802558, 1605114], [1605115, 2407671], [2407672, 3210228], [3210229, 4012785], [4012786, 4815342], [4815343, 5617899], [5617900, 6420456], [6420457, 7223013], [7223014, 8025570], [8025571, 8828127], [8828128, 9630684], [9630685, 10433241], [10433242, 11235798], [11235799, 12038355], [12038356, 12840912], [12840913, 13643469], [13643470, 14446026], [14446027, 15248583], [15248584, 16051157]] SRR12919359 file size 5433185 SRR12919359 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919359 SRR12919359_1.fastq SRR12919359_2.fastq Input file: SRR12919359_1.fastq Paired file: SRR12919359_2.fastq trimmed: SRR12919359-trimmed-pair1.fastq, SRR12919359-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:37:25 2025 >> started Wed Feb 12 20:37:42 2025 >> done (17.550s) 16051157 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 4426 ( 0.03%) empty read pairs filtered out after trimming by size control 16046711 (99.97%) read pairs available; of these: 2648122 (16.50%) trimmed read pairs available after processing 13398589 (83.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 1 0.00% 20 2 0.00% 21 4 0.00% 22 6 0.00% 23 5 0.00% 24 8 0.00% 25 4 0.00% 26 7 0.00% 27 5 0.00% 28 12 0.00% 29 9 0.00% 30 8 0.00% 31 13 0.00% 32 5 0.00% 33 10 0.00% 34 17 0.00% 35 10 0.00% 36 13 0.00% 37 18 0.00% 38 14 0.00% 39 23 0.00% 40 27 0.00% 41 31 0.00% 42 28 0.00% 43 29 0.00% 44 32 0.00% 45 39 0.00% 46 40 0.00% 47 65 0.00% 48 51 0.00% 49 68 0.00% 50 82 0.00% 51 115 0.00% 52 108 0.00% 53 114 0.00% 54 123 0.00% 55 135 0.00% 56 144 0.00% 57 209 0.00% 58 248 0.00% 59 240 0.00% 60 344 0.00% 61 408 0.00% 62 456 0.00% 63 568 0.00% 64 594 0.00% 65 668 0.00% 66 700 0.00% 67 835 0.01% 68 917 0.01% 69 1097 0.01% 70 1288 0.01% 71 1490 0.01% 72 1767 0.01% 73 2110 0.01% 74 2350 0.01% 75 2456 0.02% 76 2751 0.02% 77 3110 0.02% 78 3435 0.02% 79 3827 0.02% 80 4281 0.03% 81 4902 0.03% 82 5853 0.04% 83 6606 0.04% 84 7343 0.05% 85 8071 0.05% 86 8534 0.05% 87 9306 0.06% 88 9888 0.06% 89 10453 0.07% 90 11438 0.07% 91 12585 0.08% 92 13815 0.09% 93 15091 0.09% 94 16386 0.10% 95 17913 0.11% 96 19021 0.12% 97 19395 0.12% 98 20090 0.13% 99 20561 0.13% 100 21846 0.14% 101 23039 0.14% 102 24288 0.15% 103 26107 0.16% 104 27845 0.17% 105 29358 0.18% 106 30311 0.19% 107 30776 0.19% 108 31381 0.20% 109 32403 0.20% 110 32576 0.20% 111 34050 0.21% 112 35259 0.22% 113 36672 0.23% 114 38908 0.24% 115 39987 0.25% 116 40926 0.26% 117 41612 0.26% 118 41925 0.26% 119 42551 0.27% 120 43394 0.27% 121 43574 0.27% 122 44382 0.28% 123 45548 0.28% 124 47430 0.30% 125 49387 0.31% 126 50045 0.31% 127 51230 0.32% 128 51057 0.32% 129 51656 0.32% 130 51638 0.32% 131 52232 0.33% 132 52979 0.33% 133 54320 0.34% 134 55128 0.34% 135 56929 0.35% 136 57211 0.36% 137 57774 0.36% 138 58456 0.36% 139 58785 0.37% 140 58598 0.37% 141 58887 0.37% 142 59592 0.37% 143 59929 0.37% 144 61356 0.38% 145 62432 0.39% 146 62371 0.39% 147 63349 0.39% 148 63730 0.40% 149 64182 0.40% 150 63890 0.40% 151 13398589 83.50% 16046711 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=7.49 fanout-score-rank=17 prefix-density=0.34 prefix-fanout=3.7 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=147.37 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=12.6 sequence=ATTTCATCAAAAAAGGAACGTACATGTGGATGATATACACCCAGTTTATTTAAATTAGGAGGCCATTTATGACATATAATTTATTCTAGTACAGTAGGGCATCCTTTTTTATCATACAACTCAAAAGACTCACAAGACTCACGATCGAGGACATTCAT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=12.74 fanout-score-rank=7 prefix-density=0.29 prefix-fanout=6.8 sequence=TTTGACAAGAAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=418.55 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=34.4 sequence=AAGAAGAAGAAA SRR12919359 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:38:47 Started mapping on | Feb 12 20:38:48 Finished on | Feb 12 20:41:15 Mapping speed, Million of reads per hour | 392.98 Number of input reads | 16046711 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14606673 Uniquely mapped reads % | 91.03% Average mapped length | 291.94 Number of splices: Total | 13246420 Number of splices: Annotated (sjdb) | 12914677 Number of splices: GT/AG | 12987446 Number of splices: GC/AG | 199065 Number of splices: AT/AC | 15515 Number of splices: Non-canonical | 44394 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.93 Insertion rate per base | 0.03% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 383343 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 158337 % of reads mapped to too many loci | 0.99% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.37% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1056695 1056695 1056695 N_multimapping 383343 383343 383343 N_noFeature 635140 14407020 723724 N_ambiguous 199819 1084 88252 UnstrandedReadsAssigned:13771714 PositiveStrandReadsAssigned:198569 NegativeStrandReadsAssigned:13794697 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919359 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919359-trimmed-pair1.fastq SRR12919359-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,046,711 reads, 13,913,274 reads pseudoaligned [quant] estimated average fragment length: 235.296 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR12919359.ke.tsv 34699 SRR12919359.se.tsv 87100 total ==> SRR12919359.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.7 503 21.3226 Potri.005G024800.1.v4.1 1035 800.704 151 14.2593 Potri.004G059700.1.v4.1 961 726.875 28 2.91268 Potri.007G009000.2.v4.1 1416 1181.7 0 0 Potri.003G141000.2.v4.1 2943 2708.7 765 21.3547 Potri.016G087400.1.v4.1 270 94.5991 1078 861.64 Potri.015G069301.1.v4.1 564 340.303 0 0 Potri.010G195200.1.v4.1 1773 1538.7 110 5.40545 Potri.012G127500.1.v4.1 977 742.807 4962 505.097 ==> SRR12919359.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 41 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 246 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 0 SRR12919359 completed mapping pipeline successfully