Starting /dee2/code/volunteer_pipeline.sh SRR12919361 current disk space = 3050895548416 free memory = 1461327668 SRR12919361 SRAfilesize 7945fa269deebb8387870994ff1b9b24 SRR12919361.sra SRR12919361.sra file validated SRR12919361 is paired end SRR12919361 is conventional basespace SRR12919361 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919361_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6385 37.0 37.0 37.0 37.0 37.0 2 36.37225 37.0 37.0 37.0 37.0 37.0 3 36.68 37.0 37.0 37.0 37.0 37.0 4 36.6505 37.0 37.0 37.0 37.0 37.0 5 36.672 37.0 37.0 37.0 37.0 37.0 6 36.6845 37.0 37.0 37.0 37.0 37.0 7 36.6595 37.0 37.0 37.0 37.0 37.0 8 36.673 37.0 37.0 37.0 37.0 37.0 9 36.6725 37.0 37.0 37.0 37.0 37.0 10-14 36.645500000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.662600000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.6587 37.0 37.0 37.0 37.0 37.0 25-29 36.599599999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.576499999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.5857 37.0 37.0 37.0 37.0 37.0 40-44 36.554199999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.5295 37.0 37.0 37.0 37.0 37.0 50-54 36.5021 37.0 37.0 37.0 37.0 37.0 55-59 36.517399999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.4678 37.0 37.0 37.0 37.0 37.0 65-69 36.4609 37.0 37.0 37.0 37.0 37.0 70-74 36.419799999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.3403 37.0 37.0 37.0 37.0 37.0 80-84 36.3582 37.0 37.0 37.0 37.0 37.0 85-89 36.24159999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.2442 37.0 37.0 37.0 37.0 37.0 95-99 36.2736 37.0 37.0 37.0 37.0 37.0 100-104 36.2398 37.0 37.0 37.0 37.0 37.0 105-109 36.1964 37.0 37.0 37.0 37.0 37.0 110-114 36.1158 37.0 37.0 37.0 37.0 37.0 115-119 36.1212 37.0 37.0 37.0 37.0 37.0 120-124 36.053599999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.994699999999995 37.0 37.0 37.0 37.0 37.0 130-134 36.0033 37.0 37.0 37.0 37.0 37.0 135-139 35.864 37.0 37.0 37.0 37.0 37.0 140-144 35.7924 37.0 37.0 37.0 37.0 37.0 145-149 35.743100000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.5625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 1.0 26 2.0 27 9.0 28 10.0 29 14.0 30 16.0 31 31.0 32 47.0 33 54.0 34 109.0 35 287.0 36 3070.0 37 347.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.6 12.45 6.2 42.75 2 18.41509433962264 13.40880503144654 37.056603773584904 31.11949685534591 3 17.45 16.6 26.875 39.074999999999996 4 22.625 24.625 24.2 28.549999999999997 5 21.55 31.7 24.575 22.175 6 20.8 34.449999999999996 23.825 20.925 7 16.025 26.6 41.225 16.150000000000002 8 16.975 26.424999999999997 32.7 23.9 9 17.325 24.8 35.699999999999996 22.175 10-14 19.17 30.45 27.915 22.465 15-19 19.775000000000002 28.595 28.27 23.36 20-24 19.685 28.915000000000003 28.13 23.27 25-29 18.92 29.28 28.315 23.485 30-34 19.39 28.725 28.025 23.86 35-39 19.115 28.82 28.249999999999996 23.815 40-44 19.509999999999998 29.69 27.315 23.485 45-49 20.395 28.595 27.650000000000002 23.36 50-54 19.580000000000002 29.160000000000004 27.46 23.799999999999997 55-59 19.905 28.96 27.139999999999997 23.995 60-64 20.01 28.98 27.68 23.330000000000002 65-69 19.794999999999998 28.439999999999998 27.575 24.19 70-74 20.21 28.189999999999998 27.43 24.169999999999998 75-79 18.94 28.82 28.165000000000003 24.075 80-84 20.080000000000002 28.560000000000002 27.655 23.705000000000002 85-89 19.825 28.945 27.894999999999996 23.335 90-94 19.845 27.92 28.425 23.810000000000002 95-99 19.495 28.655 27.82 24.03 100-104 19.99 28.775000000000002 27.955000000000002 23.28 105-109 19.905 28.64 27.54 23.915 110-114 19.97 28.405 27.450000000000003 24.175 115-119 20.4 28.499999999999996 28.21 22.89 120-124 19.175 29.189999999999998 27.07 24.565 125-129 19.950000000000003 28.444999999999997 27.589999999999996 24.015 130-134 20.015 29.275000000000002 27.150000000000002 23.56 135-139 20.080000000000002 28.84 26.985 24.095 140-144 20.355 28.294999999999998 27.82 23.53 145-149 20.560000000000002 27.61 27.935 23.895 150-151 19.8125 29.15 26.5625 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.5 22 1.5 23 0.5 24 2.0 25 4.5 26 5.5 27 7.5 28 8.0 29 12.5 30 20.0 31 24.5 32 33.5 33 45.0 34 58.5 35 84.0 36 102.5 37 123.0 38 132.0 39 146.0 40 205.0 41 244.0 42 247.5 43 270.5 44 280.5 45 278.5 46 259.0 47 241.5 48 239.5 49 193.0 50 155.0 51 129.5 52 98.5 53 76.5 54 64.0 55 55.5 56 38.5 57 27.0 58 24.0 59 17.0 60 11.5 61 9.5 62 7.5 63 4.0 64 1.5 65 1.0 66 2.0 67 1.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.625 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.4 #Duplication Level Percentage of deduplicated Percentage of total 1 90.56969026548673 81.875 2 8.324115044247787 15.049999999999999 3 1.0232300884955752 2.775 4 0.08296460176991151 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.11249999999999999 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 1.8875 0.0 0.0 0.0 0.0 112-113 2.0374999999999996 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.4749999999999996 0.0 0.0 0.0 0.0 118-119 2.7 0.0 0.0 0.0 0.0 120-121 2.9375 0.0 0.0 0.0 0.0 122-123 3.275 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 3.8 0.0 0.0 0.0 0.0 128-129 4.2625 0.0 0.0 0.0 0.0 130-131 4.675 0.0 0.0 0.0 0.0 132-133 4.9125 0.0 0.0 0.0 0.0 134-135 5.15 0.0 0.0 0.0 0.0 136-137 5.6125 0.0 0.0 0.0 0.0 138-139 6.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919361 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919361_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3485 37.0 37.0 37.0 37.0 37.0 2 36.207 37.0 37.0 37.0 37.0 37.0 3 36.276 37.0 37.0 37.0 37.0 37.0 4 36.3625 37.0 37.0 37.0 37.0 37.0 5 36.431 37.0 37.0 37.0 37.0 37.0 6 36.2955 37.0 37.0 37.0 37.0 37.0 7 36.2875 37.0 37.0 37.0 37.0 37.0 8 36.38 37.0 37.0 37.0 37.0 37.0 9 36.359 37.0 37.0 37.0 37.0 37.0 10-14 36.371399999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.3392 37.0 37.0 37.0 37.0 37.0 20-24 36.330600000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.3105 37.0 37.0 37.0 37.0 37.0 30-34 36.1989 37.0 37.0 37.0 37.0 37.0 35-39 36.239 37.0 37.0 37.0 37.0 37.0 40-44 36.184 37.0 37.0 37.0 37.0 37.0 45-49 36.17569999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.1361 37.0 37.0 37.0 37.0 37.0 55-59 36.0679 37.0 37.0 37.0 37.0 37.0 60-64 36.0661 37.0 37.0 37.0 37.0 37.0 65-69 35.980399999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.01989999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.9359 37.0 37.0 37.0 37.0 37.0 80-84 35.972 37.0 37.0 37.0 37.0 37.0 85-89 35.8975 37.0 37.0 37.0 37.0 37.0 90-94 35.818200000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.8916 37.0 37.0 37.0 37.0 37.0 100-104 35.8256 37.0 37.0 37.0 37.0 37.0 105-109 35.8612 37.0 37.0 37.0 37.0 37.0 110-114 35.8115 37.0 37.0 37.0 37.0 37.0 115-119 35.7323 37.0 37.0 37.0 37.0 37.0 120-124 35.6777 37.0 37.0 37.0 37.0 37.0 125-129 35.6575 37.0 37.0 37.0 37.0 37.0 130-134 35.6096 37.0 37.0 37.0 37.0 37.0 135-139 35.39359999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.4794 37.0 37.0 37.0 37.0 37.0 145-149 35.3097 37.0 37.0 37.0 34.6 37.0 150-151 35.07175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 2.0 15 0.0 16 2.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 2.0 23 4.0 24 1.0 25 4.0 26 9.0 27 11.0 28 11.0 29 18.0 30 27.0 31 38.0 32 60.0 33 109.0 34 194.0 35 559.0 36 2680.0 37 262.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.375 23.175 10.45 28.000000000000004 2 26.375 26.55 31.95 15.125 3 19.45 27.575 33.275 19.7 4 23.25 34.25 23.849999999999998 18.65 5 24.224999999999998 36.875 21.45 17.45 6 19.5 40.175 23.674999999999997 16.650000000000002 7 19.675 22.8 39.875 17.65 8 23.325000000000003 24.425 28.599999999999998 23.65 9 21.575 25.874999999999996 30.625000000000004 21.925 10-14 22.89 29.315 27.29 20.505000000000003 15-19 23.47 28.410000000000004 27.825 20.294999999999998 20-24 22.96 28.54 28.194999999999997 20.305 25-29 22.755 28.015 28.560000000000002 20.669999999999998 30-34 22.075 28.345 28.804999999999996 20.775 35-39 23.455000000000002 27.839999999999996 28.349999999999998 20.355 40-44 23.085 28.265 28.27 20.380000000000003 45-49 23.48 28.15 28.000000000000004 20.369999999999997 50-54 23.015 28.28 28.32 20.385 55-59 23.455000000000002 27.83 28.249999999999996 20.465 60-64 23.03 27.450000000000003 28.535 20.985 65-69 23.325000000000003 28.794999999999998 28.044999999999998 19.835 70-74 23.76 27.925 27.675 20.64 75-79 23.1 28.415000000000003 28.349999999999998 20.135 80-84 23.65 28.26 28.075 20.015 85-89 23.880000000000003 27.54 28.24 20.34 90-94 24.025 27.6 28.53 19.845 95-99 23.51 27.98 27.765 20.745 100-104 24.54 27.939999999999998 27.91 19.61 105-109 23.555 28.244999999999997 28.345 19.855 110-114 24.22 27.775 27.92 20.085 115-119 23.79 27.675 28.03 20.505000000000003 120-124 24.055 27.54 28.305000000000003 20.1 125-129 24.195 28.77 27.36 19.675 130-134 24.365000000000002 28.9 27.3 19.435 135-139 25.31 27.575 27.800000000000004 19.314999999999998 140-144 24.32 28.32 27.315 20.044999999999998 145-149 25.165 28.044999999999998 27.38 19.41 150-151 24.975 27.8125 27.3375 19.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 3.5 24 3.5 25 2.0 26 2.5 27 6.0 28 6.5 29 12.5 30 21.5 31 23.5 32 34.5 33 47.0 34 66.5 35 80.0 36 85.5 37 117.0 38 143.0 39 179.5 40 220.5 41 239.5 42 270.0 43 291.5 44 279.5 45 275.0 46 272.0 47 240.5 48 198.5 49 161.5 50 148.5 51 135.5 52 101.5 53 67.0 54 50.0 55 46.5 56 36.0 57 26.0 58 24.0 59 17.5 60 10.0 61 7.5 62 8.5 63 8.5 64 7.0 65 3.5 66 1.0 67 2.0 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.5 #Duplication Level Percentage of deduplicated Percentage of total 1 90.74585635359117 82.125 2 8.176795580110499 14.799999999999999 3 0.9116022099447514 2.475 4 0.16574585635359115 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.11249999999999999 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 1.8625 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.2249999999999996 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.65 0.0 0.0 0.0 0.0 120-121 2.8875 0.0 0.0 0.0 0.0 122-123 3.25 0.0 0.0 0.0 0.0 124-125 3.5250000000000004 0.0 0.0 0.0 0.0 126-127 3.7750000000000004 0.0 0.0 0.0 0.0 128-129 4.225 0.0 0.0 0.0 0.0 130-131 4.6375 0.0 0.0 0.0 0.0 132-133 4.9 0.0 0.0 0.0 0.0 134-135 5.1625 0.0 0.0 0.0 0.0 136-137 5.6375 0.0 0.0 0.0 0.0 138-139 6.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATAGCT 10 0.006830828 145.0 7 >>END_MODULE Read 1007509 spots for SRR12919361.sra Written 1007509 spots for SRR12919361.sra Read 1007509 spots for SRR12919361.sra Written 1007509 spots for SRR12919361.sra Read 1007509 spots for SRR12919361.sra Written 1007509 spots for SRR12919361.sra Read 1007509 spots for SRR12919361.sra Written 1007509 spots for SRR12919361.sra Read 1007509 spots for SRR12919361.sra Written 1007509 spots for SRR12919361.sra Read 1007509 spots for SRR12919361.sra Written 1007509 spots for SRR12919361.sra Read 1007509 spots for SRR12919361.sra Written 1007509 spots for SRR12919361.sra Read 1007509 spots for SRR12919361.sra Written 1007509 spots for SRR12919361.sra Read 1007509 spots for SRR12919361.sra Written 1007509 spots for SRR12919361.sra Read 1007520 spots for SRR12919361.sra Written 1007520 spots for SRR12919361.sra Read 1007509 spots for SRR12919361.sra Written 1007509 spots for SRR12919361.sra Read 1007509 spots for SRR12919361.sra Written 1007509 spots for SRR12919361.sra Read 1007509 spots for SRR12919361.sra Written 1007509 spots for SRR12919361.sra Read 1007509 spots for SRR12919361.sra Written 1007509 spots for SRR12919361.sra Read 1007509 spots for SRR12919361.sra Written 1007509 spots for SRR12919361.sra Read 1007509 spots for SRR12919361.sra Written 1007509 spots for SRR12919361.sra Read 1007509 spots for SRR12919361.sra Written 1007509 spots for SRR12919361.sra Read 1007509 spots for SRR12919361.sra Written 1007509 spots for SRR12919361.sra Read 1007509 spots for SRR12919361.sra Written 1007509 spots for SRR12919361.sra Read 1007509 spots for SRR12919361.sra Written 1007509 spots for SRR12919361.sra SRR ids: ['SRR12919361.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f06hj_1w SRR12919361.sra spots: 20150191 blocks: [[1, 1007509], [1007510, 2015018], [2015019, 3022527], [3022528, 4030036], [4030037, 5037545], [5037546, 6045054], [6045055, 7052563], [7052564, 8060072], [8060073, 9067581], [9067582, 10075090], [10075091, 11082599], [11082600, 12090108], [12090109, 13097617], [13097618, 14105126], [14105127, 15112635], [15112636, 16120144], [16120145, 17127653], [17127654, 18135162], [18135163, 19142671], [19142672, 20150191]] SRR12919361 file size 6826216 SRR12919361 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919361 SRR12919361_1.fastq SRR12919361_2.fastq Input file: SRR12919361_1.fastq Paired file: SRR12919361_2.fastq trimmed: SRR12919361-trimmed-pair1.fastq, SRR12919361-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:38:56 2025 >> started Wed Feb 12 20:39:19 2025 >> done (22.705s) 20150191 read pairs processed; of these: 36 ( 0.00%) short read pairs filtered out after trimming by size control 498 ( 0.00%) empty read pairs filtered out after trimming by size control 20149657 (100.00%) read pairs available; of these: 1770880 ( 8.79%) trimmed read pairs available after processing 18378777 (91.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 3 0.00% 21 7 0.00% 22 4 0.00% 23 9 0.00% 24 15 0.00% 25 5 0.00% 26 13 0.00% 27 10 0.00% 28 15 0.00% 29 8 0.00% 30 14 0.00% 31 8 0.00% 32 16 0.00% 33 16 0.00% 34 16 0.00% 35 13 0.00% 36 17 0.00% 37 16 0.00% 38 24 0.00% 39 18 0.00% 40 20 0.00% 41 24 0.00% 42 21 0.00% 43 15 0.00% 44 23 0.00% 45 36 0.00% 46 32 0.00% 47 33 0.00% 48 38 0.00% 49 40 0.00% 50 63 0.00% 51 53 0.00% 52 69 0.00% 53 57 0.00% 54 56 0.00% 55 84 0.00% 56 70 0.00% 57 88 0.00% 58 101 0.00% 59 85 0.00% 60 139 0.00% 61 179 0.00% 62 181 0.00% 63 223 0.00% 64 251 0.00% 65 240 0.00% 66 301 0.00% 67 313 0.00% 68 381 0.00% 69 420 0.00% 70 520 0.00% 71 591 0.00% 72 659 0.00% 73 812 0.00% 74 853 0.00% 75 956 0.00% 76 1083 0.01% 77 1198 0.01% 78 1410 0.01% 79 1581 0.01% 80 1818 0.01% 81 2107 0.01% 82 2411 0.01% 83 2756 0.01% 84 3000 0.01% 85 3269 0.02% 86 3731 0.02% 87 4074 0.02% 88 4167 0.02% 89 4691 0.02% 90 5109 0.03% 91 5797 0.03% 92 6342 0.03% 93 7196 0.04% 94 7797 0.04% 95 8413 0.04% 96 9003 0.04% 97 9376 0.05% 98 9979 0.05% 99 10695 0.05% 100 11348 0.06% 101 12158 0.06% 102 13054 0.06% 103 14163 0.07% 104 14855 0.07% 105 15917 0.08% 106 16566 0.08% 107 17562 0.09% 108 18249 0.09% 109 18634 0.09% 110 18948 0.09% 111 20021 0.10% 112 20995 0.10% 113 22359 0.11% 114 23395 0.12% 115 24423 0.12% 116 24780 0.12% 117 25535 0.13% 118 26472 0.13% 119 26939 0.13% 120 27670 0.14% 121 28192 0.14% 122 28929 0.14% 123 30737 0.15% 124 31698 0.16% 125 32733 0.16% 126 33829 0.17% 127 34644 0.17% 128 35184 0.17% 129 35527 0.18% 130 36423 0.18% 131 36606 0.18% 132 37722 0.19% 133 38911 0.19% 134 39705 0.20% 135 41338 0.21% 136 42495 0.21% 137 43006 0.21% 138 43708 0.22% 139 43994 0.22% 140 43964 0.22% 141 45038 0.22% 142 46240 0.23% 143 46783 0.23% 144 48518 0.24% 145 49460 0.25% 146 50133 0.25% 147 50650 0.25% 148 51057 0.25% 149 51469 0.26% 150 52855 0.26% 151 18378777 91.21% 20149657 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=31 prefix-density=0.61 prefix-fanout=2.2 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCCAGAGTCTGAACTTGTTTCACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACA criterion=fanout-score sequence-density=0.06 sequence-density-rank=29 fanout-score=50.98 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=12.0 sequence=CCTTCCTTGTCCTGGATCTTGGCCTT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=25 prefix-density=0.44 prefix-fanout=2.1 sequence=AATGCCTGCCCGGAAAACCCAAAGTTGTCTTTGGATCGAAGAGTTCTACTTCTGATTTTTACGTTCGAAATAAAGCATACGGAGACTTCCTTAACGATAATTTTGATGCAAAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=118.44 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=10.4 sequence=GAGCTTCAAAGCATGGTCAGTGACCTATAGTGAAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGC SRR12919361 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:40:46 Started mapping on | Feb 12 20:40:47 Finished on | Feb 12 20:43:17 Mapping speed, Million of reads per hour | 483.59 Number of input reads | 20149657 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18875321 Uniquely mapped reads % | 93.68% Average mapped length | 296.52 Number of splices: Total | 17592446 Number of splices: Annotated (sjdb) | 17168545 Number of splices: GT/AG | 17273533 Number of splices: GC/AG | 249453 Number of splices: AT/AC | 15595 Number of splices: Non-canonical | 53865 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.03% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 521267 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 113193 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.00% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 753069 753069 753069 N_multimapping 521267 521267 521267 N_noFeature 789344 18662171 887807 N_ambiguous 234847 1094 119598 UnstrandedReadsAssigned:17851130 PositiveStrandReadsAssigned:212056 NegativeStrandReadsAssigned:17867916 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919361 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919361-trimmed-pair1.fastq SRR12919361-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,149,657 reads, 17,899,365 reads pseudoaligned [quant] estimated average fragment length: 269.799 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52401 SRR12919361.ke.tsv 34699 SRR12919361.se.tsv 87100 total ==> SRR12919361.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.2 778 29.0695 Potri.005G024800.1.v4.1 1035 766.201 336 28.6612 Potri.004G059700.1.v4.1 961 692.377 25 2.35991 Potri.007G009000.2.v4.1 1416 1147.2 0 0 Potri.003G141000.2.v4.1 2943 2674.2 939 22.9493 Potri.016G087400.1.v4.1 270 81.4493 1167 936.442 Potri.015G069301.1.v4.1 564 310.085 0 0 Potri.010G195200.1.v4.1 1773 1504.2 168 7.29963 Potri.012G127500.1.v4.1 977 708.31 5113 471.792 ==> SRR12919361.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 38 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 200 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 159 SRR12919361 completed mapping pipeline successfully