Starting /dee2/code/volunteer_pipeline.sh SRR12919363 current disk space = 3050913542144 free memory = 1505966984 SRR12919363 SRAfilesize 77f17d1810ab7dedd5d78f772b67ee8c SRR12919363.sra SRR12919363.sra file validated SRR12919363 is paired end SRR12919363 is conventional basespace SRR12919363 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919363_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6225 37.0 37.0 37.0 37.0 37.0 2 36.2025 37.0 37.0 37.0 37.0 37.0 3 36.595 37.0 37.0 37.0 37.0 37.0 4 36.709 37.0 37.0 37.0 37.0 37.0 5 36.671 37.0 37.0 37.0 37.0 37.0 6 36.654 37.0 37.0 37.0 37.0 37.0 7 36.6665 37.0 37.0 37.0 37.0 37.0 8 36.684 37.0 37.0 37.0 37.0 37.0 9 36.6815 37.0 37.0 37.0 37.0 37.0 10-14 36.6943 37.0 37.0 37.0 37.0 37.0 15-19 36.64119999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.6322 37.0 37.0 37.0 37.0 37.0 25-29 36.597899999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.55800000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.553000000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.5251 37.0 37.0 37.0 37.0 37.0 45-49 36.5299 37.0 37.0 37.0 37.0 37.0 50-54 36.4642 37.0 37.0 37.0 37.0 37.0 55-59 36.455999999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.448699999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.3623 37.0 37.0 37.0 37.0 37.0 70-74 36.372400000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.302200000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.34960000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.2729 37.0 37.0 37.0 37.0 37.0 90-94 36.19969999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.2201 37.0 37.0 37.0 37.0 37.0 100-104 36.195499999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.17 37.0 37.0 37.0 37.0 37.0 110-114 36.12049999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.1277 37.0 37.0 37.0 37.0 37.0 120-124 36.1317 37.0 37.0 37.0 37.0 37.0 125-129 36.0731 37.0 37.0 37.0 37.0 37.0 130-134 36.02239999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.9528 37.0 37.0 37.0 37.0 37.0 140-144 35.8586 37.0 37.0 37.0 37.0 37.0 145-149 35.892199999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.63825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 0.0 24 2.0 25 5.0 26 1.0 27 3.0 28 10.0 29 16.0 30 25.0 31 31.0 32 32.0 33 53.0 34 97.0 35 311.0 36 3010.0 37 401.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.225 12.675 3.5749999999999997 36.525 2 18.51664984863774 11.629667003027246 41.044399596367306 28.809283551967706 3 16.7 16.725 31.5 35.075 4 20.525 24.575 26.224999999999998 28.675 5 21.275 32.9 25.35 20.474999999999998 6 20.4 35.05 24.45 20.1 7 16.05 27.675 40.225 16.05 8 16.0 27.125 32.550000000000004 24.325 9 16.75 24.349999999999998 34.725 24.175 10-14 19.325 30.15 27.77 22.755 15-19 19.725 27.83 28.22 24.224999999999998 20-24 20.075000000000003 28.375 28.33 23.22 25-29 19.134999999999998 29.065 28.515 23.285 30-34 19.830000000000002 28.83 27.834999999999997 23.505000000000003 35-39 19.46 29.18 27.57 23.79 40-44 19.66 28.125 28.125 24.09 45-49 20.165 28.26 28.17 23.405 50-54 19.900000000000002 28.77 27.810000000000002 23.52 55-59 20.265 28.54 27.455000000000002 23.74 60-64 19.78 28.58 28.26 23.380000000000003 65-69 19.72 28.74 27.650000000000002 23.89 70-74 20.21 28.660000000000004 27.38 23.75 75-79 20.39 28.875 27.435 23.3 80-84 19.950000000000003 28.775000000000002 27.794999999999998 23.48 85-89 19.68 28.12 27.76 24.44 90-94 19.785 29.225 27.134999999999998 23.855 95-99 20.044999999999998 28.470000000000002 28.13 23.355 100-104 20.09 28.58 27.82 23.51 105-109 20.125 28.355000000000004 27.644999999999996 23.875 110-114 20.015 28.110000000000003 28.075 23.799999999999997 115-119 20.635 28.68 27.21 23.474999999999998 120-124 20.615 28.975 27.145000000000003 23.265 125-129 19.835 28.384999999999998 27.534999999999997 24.245 130-134 20.735 28.715000000000003 27.05 23.5 135-139 20.715 28.23 27.310000000000002 23.745 140-144 20.23 28.28 27.605 23.885 145-149 20.565 27.794999999999998 27.265 24.375 150-151 20.200000000000003 28.125 26.775 24.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 1.5 22 0.5 23 1.0 24 1.0 25 3.0 26 7.0 27 9.0 28 9.0 29 9.0 30 15.0 31 26.5 32 34.0 33 43.5 34 59.0 35 83.5 36 103.5 37 122.5 38 145.0 39 166.0 40 182.0 41 210.0 42 234.5 43 263.0 44 301.5 45 289.5 46 257.0 47 231.5 48 220.5 49 200.0 50 167.0 51 149.5 52 118.0 53 82.0 54 62.0 55 46.5 56 38.5 57 28.0 58 16.0 59 13.5 60 13.5 61 11.0 62 5.5 63 2.5 64 2.5 65 2.5 66 1.5 67 1.0 68 2.5 69 2.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.8999999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.825 #Duplication Level Percentage of deduplicated Percentage of total 1 90.11967715001391 80.95 2 8.627887559142778 15.5 3 1.057612023378792 2.85 4 0.19482326746451434 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.65 0.0 0.0 0.0 0.0 110-111 1.9874999999999998 0.0 0.0 0.0 0.0 112-113 2.2625 0.0 0.0 0.0 0.0 114-115 2.525 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.25 0.0 0.0 0.0 0.0 120-121 3.625 0.0 0.0 0.0 0.0 122-123 3.825 0.0 0.0 0.0 0.0 124-125 4.1875 0.0 0.0 0.0 0.0 126-127 4.512499999999999 0.0 0.0 0.0 0.0 128-129 4.9125 0.0 0.0 0.0 0.0 130-131 5.55 0.0 0.0 0.0 0.0 132-133 5.987500000000001 0.0 0.0 0.0 0.0 134-135 6.4125 0.0 0.0 0.0 0.0 136-137 6.95 0.0 0.0 0.0 0.0 138-139 7.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCTAC 10 0.006830828 145.0 9 AATCCTA 10 0.006830828 145.0 8 ATGCAGT 10 0.006830828 145.0 145 >>END_MODULE SRR12919363 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919363_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.269 37.0 37.0 37.0 37.0 37.0 2 36.1935 37.0 37.0 37.0 37.0 37.0 3 36.1975 37.0 37.0 37.0 37.0 37.0 4 36.265 37.0 37.0 37.0 37.0 37.0 5 36.3025 37.0 37.0 37.0 37.0 37.0 6 36.262 37.0 37.0 37.0 37.0 37.0 7 36.1745 37.0 37.0 37.0 37.0 37.0 8 36.278 37.0 37.0 37.0 37.0 37.0 9 36.28 37.0 37.0 37.0 37.0 37.0 10-14 36.2932 37.0 37.0 37.0 37.0 37.0 15-19 36.2203 37.0 37.0 37.0 37.0 37.0 20-24 36.187599999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.18339999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.1593 37.0 37.0 37.0 37.0 37.0 35-39 36.127500000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.115300000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.0892 37.0 37.0 37.0 37.0 37.0 50-54 36.0288 37.0 37.0 37.0 37.0 37.0 55-59 36.0194 37.0 37.0 37.0 37.0 37.0 60-64 36.0082 37.0 37.0 37.0 37.0 37.0 65-69 35.964800000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.9382 37.0 37.0 37.0 37.0 37.0 75-79 35.92379999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.9048 37.0 37.0 37.0 37.0 37.0 85-89 35.865100000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.818 37.0 37.0 37.0 37.0 37.0 95-99 35.8767 37.0 37.0 37.0 37.0 37.0 100-104 35.7967 37.0 37.0 37.0 37.0 37.0 105-109 35.741499999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.763099999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.737700000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.669799999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.6383 37.0 37.0 37.0 37.0 37.0 130-134 35.549899999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.4245 37.0 37.0 37.0 37.0 37.0 140-144 35.4285 37.0 37.0 37.0 37.0 37.0 145-149 35.2582 37.0 37.0 37.0 32.2 37.0 150-151 35.033500000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 3.0 15 3.0 16 2.0 17 3.0 18 3.0 19 2.0 20 1.0 21 4.0 22 6.0 23 6.0 24 10.0 25 13.0 26 10.0 27 10.0 28 16.0 29 11.0 30 18.0 31 29.0 32 46.0 33 81.0 34 200.0 35 510.0 36 2719.0 37 289.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.7 27.250000000000004 5.675 22.375 2 27.150000000000002 25.45 31.775 15.625 3 20.325 26.950000000000003 34.849999999999994 17.875 4 22.8 34.35 24.55 18.3 5 24.925 37.574999999999996 20.95 16.55 6 20.125 40.45 21.375 18.05 7 20.875 22.5 38.2 18.425 8 19.075 25.85 30.575000000000003 24.5 9 20.375 24.075 31.025000000000002 24.525 10-14 23.955000000000002 28.665000000000003 26.525 20.855 15-19 23.76 28.255000000000003 27.689999999999998 20.294999999999998 20-24 23.32 29.160000000000004 27.139999999999997 20.380000000000003 25-29 23.150000000000002 28.48 28.050000000000004 20.32 30-34 22.8 28.16 28.785 20.255000000000003 35-39 22.905 29.095 27.255000000000003 20.745 40-44 22.814999999999998 28.794999999999998 27.955000000000002 20.435 45-49 23.044999999999998 28.09 28.395 20.47 50-54 22.795 28.505000000000003 28.199999999999996 20.5 55-59 23.75 28.73 27.48 20.04 60-64 23.06 28.244999999999997 28.025 20.669999999999998 65-69 22.525000000000002 28.71 28.125 20.64 70-74 22.975 28.84 27.589999999999996 20.595 75-79 22.95 28.249999999999996 28.384999999999998 20.415 80-84 23.32 28.22 27.855 20.605 85-89 23.855 28.24 27.744999999999997 20.16 90-94 23.265 28.255000000000003 28.43 20.05 95-99 23.145 28.735 27.384999999999998 20.735 100-104 23.405 28.310000000000002 27.83 20.455000000000002 105-109 23.905 28.625 27.375 20.095 110-114 23.66 28.360000000000003 27.779999999999998 20.200000000000003 115-119 24.63 28.115000000000002 27.27 19.985 120-124 24.15 28.585 27.145000000000003 20.119999999999997 125-129 25.16 28.42 27.015 19.405 130-134 24.195 28.54 27.755000000000003 19.509999999999998 135-139 24.645 28.615000000000002 27.189999999999998 19.55 140-144 24.82 28.349999999999998 27.445000000000004 19.384999999999998 145-149 25.430000000000003 27.750000000000004 27.58 19.24 150-151 26.2625 27.5125 27.0875 19.1375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 1.0 7 1.5 8 1.5 9 1.0 10 0.5 11 1.0 12 1.5 13 1.5 14 0.5 15 1.0 16 1.5 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 1.0 23 1.0 24 2.5 25 3.0 26 3.5 27 9.5 28 11.0 29 7.0 30 11.0 31 22.5 32 31.5 33 41.5 34 61.0 35 77.0 36 86.0 37 117.5 38 156.5 39 182.5 40 212.0 41 239.5 42 263.0 43 279.5 44 285.0 45 277.0 46 263.5 47 241.5 48 204.0 49 178.5 50 151.5 51 118.0 52 96.0 53 78.0 54 60.5 55 43.5 56 34.0 57 29.0 58 21.5 59 18.0 60 15.0 61 9.0 62 7.0 63 6.5 64 3.0 65 2.5 66 2.5 67 2.0 68 2.5 69 0.5 70 0.0 71 0.5 72 1.5 73 1.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.17500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.51843637371778 81.625 2 8.233989464929305 14.85 3 1.1089548100914888 3.0 4 0.11089548100914888 0.4 5 0.02772387025228722 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.65 0.0 0.0 0.0 0.0 110-111 1.9625 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.5 0.0 0.0 0.0 0.0 116-117 2.8499999999999996 0.0 0.0 0.0 0.0 118-119 3.2249999999999996 0.0 0.0 0.0 0.0 120-121 3.5999999999999996 0.0 0.0 0.0 0.0 122-123 3.8 0.0 0.0 0.0 0.0 124-125 4.1625 0.0 0.0 0.0 0.0 126-127 4.512499999999999 0.0 0.0 0.0 0.0 128-129 4.9125 0.0 0.0 0.0 0.0 130-131 5.55 0.0 0.0 0.0 0.0 132-133 6.012499999999999 0.0 0.0 0.0 0.0 134-135 6.4375 0.0 0.0 0.0 0.0 136-137 6.975 0.0 0.0 0.0 0.0 138-139 7.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCCC 10 0.006830828 145.0 4 CAAGCCT 10 0.006830828 145.0 4 >>END_MODULE Read 988758 spots for SRR12919363.sra Written 988758 spots for SRR12919363.sra Read 988758 spots for SRR12919363.sra Written 988758 spots for SRR12919363.sra Read 988758 spots for SRR12919363.sra Written 988758 spots for SRR12919363.sra Read 988758 spots for SRR12919363.sra Written 988758 spots for SRR12919363.sra Read 988758 spots for SRR12919363.sra Written 988758 spots for SRR12919363.sra Read 988758 spots for SRR12919363.sra Written 988758 spots for SRR12919363.sra Read 988758 spots for SRR12919363.sra Written 988758 spots for SRR12919363.sra Read 988758 spots for SRR12919363.sra Written 988758 spots for SRR12919363.sra Read 988758 spots for SRR12919363.sra Written 988758 spots for SRR12919363.sra Read 988758 spots for SRR12919363.sra Written 988758 spots for SRR12919363.sra Read 988758 spots for SRR12919363.sra Written 988758 spots for SRR12919363.sra Read 988758 spots for SRR12919363.sra Written 988758 spots for SRR12919363.sra Read 988758 spots for SRR12919363.sra Written 988758 spots for SRR12919363.sra Read 988758 spots for SRR12919363.sra Written 988758 spots for SRR12919363.sra Read 988758 spots for SRR12919363.sra Written 988758 spots for SRR12919363.sra Read 988776 spots for SRR12919363.sra Written 988776 spots for SRR12919363.sra Read 988758 spots for SRR12919363.sra Written 988758 spots for SRR12919363.sra Read 988758 spots for SRR12919363.sra Written 988758 spots for SRR12919363.sra Read 988758 spots for SRR12919363.sra Written 988758 spots for SRR12919363.sra Read 988758 spots for SRR12919363.sra Written 988758 spots for SRR12919363.sra SRR ids: ['SRR12919363.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_atk69w8u SRR12919363.sra spots: 19775178 blocks: [[1, 988758], [988759, 1977516], [1977517, 2966274], [2966275, 3955032], [3955033, 4943790], [4943791, 5932548], [5932549, 6921306], [6921307, 7910064], [7910065, 8898822], [8898823, 9887580], [9887581, 10876338], [10876339, 11865096], [11865097, 12853854], [12853855, 13842612], [13842613, 14831370], [14831371, 15820128], [15820129, 16808886], [16808887, 17797644], [17797645, 18786402], [18786403, 19775178]] SRR12919363 file size 6698770 SRR12919363 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919363 SRR12919363_1.fastq SRR12919363_2.fastq Input file: SRR12919363_1.fastq Paired file: SRR12919363_2.fastq trimmed: SRR12919363-trimmed-pair1.fastq, SRR12919363-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:37:02 2025 >> started Wed Feb 12 20:37:27 2025 >> done (24.741s) 19775178 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 157 ( 0.00%) empty read pairs filtered out after trimming by size control 19774990 (100.00%) read pairs available; of these: 2190084 (11.08%) trimmed read pairs available after processing 17584906 (88.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 8 0.00% 20 6 0.00% 21 8 0.00% 22 5 0.00% 23 9 0.00% 24 5 0.00% 25 8 0.00% 26 10 0.00% 27 8 0.00% 28 10 0.00% 29 13 0.00% 30 9 0.00% 31 9 0.00% 32 15 0.00% 33 18 0.00% 34 17 0.00% 35 14 0.00% 36 14 0.00% 37 21 0.00% 38 22 0.00% 39 13 0.00% 40 12 0.00% 41 16 0.00% 42 17 0.00% 43 22 0.00% 44 27 0.00% 45 18 0.00% 46 33 0.00% 47 34 0.00% 48 26 0.00% 49 38 0.00% 50 32 0.00% 51 28 0.00% 52 47 0.00% 53 62 0.00% 54 70 0.00% 55 64 0.00% 56 66 0.00% 57 91 0.00% 58 85 0.00% 59 85 0.00% 60 90 0.00% 61 131 0.00% 62 168 0.00% 63 184 0.00% 64 208 0.00% 65 229 0.00% 66 236 0.00% 67 276 0.00% 68 340 0.00% 69 378 0.00% 70 458 0.00% 71 537 0.00% 72 661 0.00% 73 712 0.00% 74 826 0.00% 75 905 0.00% 76 1053 0.01% 77 1177 0.01% 78 1346 0.01% 79 1581 0.01% 80 1800 0.01% 81 2038 0.01% 82 2460 0.01% 83 2803 0.01% 84 3115 0.02% 85 3514 0.02% 86 3813 0.02% 87 4133 0.02% 88 4700 0.02% 89 5117 0.03% 90 5660 0.03% 91 6522 0.03% 92 7048 0.04% 93 7902 0.04% 94 8547 0.04% 95 9732 0.05% 96 10434 0.05% 97 11209 0.06% 98 11734 0.06% 99 12522 0.06% 100 13348 0.07% 101 14396 0.07% 102 15663 0.08% 103 16632 0.08% 104 18017 0.09% 105 19086 0.10% 106 20456 0.10% 107 21214 0.11% 108 22183 0.11% 109 22797 0.12% 110 23521 0.12% 111 24922 0.13% 112 25889 0.13% 113 26897 0.14% 114 28827 0.15% 115 30441 0.15% 116 31060 0.16% 117 32537 0.16% 118 33274 0.17% 119 33753 0.17% 120 34945 0.18% 121 35906 0.18% 122 36712 0.19% 123 38415 0.19% 124 39870 0.20% 125 40970 0.21% 126 42685 0.22% 127 43838 0.22% 128 44602 0.23% 129 45171 0.23% 130 46255 0.23% 131 46468 0.23% 132 47920 0.24% 133 49610 0.25% 134 50133 0.25% 135 51901 0.26% 136 52395 0.26% 137 53409 0.27% 138 54541 0.28% 139 55503 0.28% 140 55578 0.28% 141 56702 0.29% 142 57331 0.29% 143 58421 0.30% 144 60554 0.31% 145 61162 0.31% 146 61829 0.31% 147 63318 0.32% 148 63394 0.32% 149 63368 0.32% 150 64849 0.33% 151 17584906 88.92% 19774990 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=26 prefix-density=0.34 prefix-fanout=2.4 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=51.05 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=12.6 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=28 prefix-density=0.29 prefix-fanout=2.0 sequence=CATAGAATGTCTACAGTCAATTTGGCAGCACTGCTGTTGCTTGGGCTGCTGCTGGTTATGCCACAGCAGTCCATGCAAGCGAGTTTGATAGACCCCATTGCTGAAATCGAGAGAAGCAACTGCAAAATCGCACACCTTCGCTTAGGGCTTGTTTTTAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=120.67 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=11.0 sequence=GAGCTTCAAAGCATGGTCAGTGACCTATAGTGAAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGC SRR12919363 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:38:12 Started mapping on | Feb 12 20:38:13 Finished on | Feb 12 20:40:57 Mapping speed, Million of reads per hour | 434.09 Number of input reads | 19774990 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 18292063 Uniquely mapped reads % | 92.50% Average mapped length | 295.50 Number of splices: Total | 17274286 Number of splices: Annotated (sjdb) | 16833301 Number of splices: GT/AG | 16948080 Number of splices: GC/AG | 251345 Number of splices: AT/AC | 17952 Number of splices: Non-canonical | 56909 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.94 Insertion rate per base | 0.03% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 453251 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 86691 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.57% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1029676 1029676 1029676 N_multimapping 453251 453251 453251 N_noFeature 775574 18086380 863258 N_ambiguous 232310 1127 113652 UnstrandedReadsAssigned:17284179 PositiveStrandReadsAssigned:204556 NegativeStrandReadsAssigned:17315153 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919363 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919363-trimmed-pair1.fastq SRR12919363-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,774,990 reads, 17,378,469 reads pseudoaligned [quant] estimated average fragment length: 254.317 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52401 SRR12919363.ke.tsv 34699 SRR12919363.se.tsv 87100 total ==> SRR12919363.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.68 545 19.3231 Potri.005G024800.1.v4.1 1035 781.683 273 21.8514 Potri.004G059700.1.v4.1 961 707.749 51 4.50856 Potri.007G009000.2.v4.1 1416 1162.68 0 0 Potri.003G141000.2.v4.1 2943 2689.68 704 16.3764 Potri.016G087400.1.v4.1 270 85.6303 1545 1128.88 Potri.015G069301.1.v4.1 564 323.083 0 0 Potri.010G195200.1.v4.1 1773 1519.68 100 4.11713 Potri.012G127500.1.v4.1 977 723.722 5197 449.291 ==> SRR12919363.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 328 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 303 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 46 SRR12919363 completed mapping pipeline successfully